BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= CCR2
(1466 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BE520377.1|BE520377 M12A7STM Arabidopsis developing seed... 42 0.27
gb|BE521298.1|BE521298 M18G8STM Arabidopsis developing seed... 42 0.27
gb|BE527222.1|BE527222 M67F13STM Arabidopsis developing see... 42 0.27
gb|AV784273.1|AV784273 AV784273 RAFL5 Arabidopsis thaliana ... 42 0.27
gb|BU634974.1|BU634974 013F08 Infected Arabidopsis Leaf Ara... 42 0.27
gb|AV550189.1|AV550189 AV550189 Arabidopsis thaliana roots ... 42 0.27
gb|AF320624.1|AF320624 Arabidopsis thaliana cinnamoyl CoA r... 42 0.27
gb|AE005172.1| Arabidopsis thaliana chromosome 1, top arm c... 42 0.27
gb|AY087316.1| Arabidopsis thaliana clone 34141 mRNA, compl... 42 0.27
gb|AF332459.1| Arabidopsis thaliana clone C00167 (e) putati... 42 0.27
gb|AC010924.2|T24D18 Arabidopsis thaliana chromosome 1 BAC ... 42 0.27
emb|BX815831.1|CNS0AAHT Arabidopsis thaliana Full-length cD... 42 0.27
emb|BX815700.1|CNS0ABD9 Arabidopsis thaliana Full-length cD... 42 0.27
emb|BX815739.1|CNS0ABDT Arabidopsis thaliana Full-length cD... 42 0.27
emb|BX815406.1|CNS0ABFH Arabidopsis thaliana Full-length cD... 42 0.27
emb|BX815742.1|CNS0ABF5 Arabidopsis thaliana Full-length cD... 42 0.27
emb|BX816709.1|CNS0ABPI Arabidopsis thaliana Full-length cD... 42 0.27
emb|BX816189.1|CNS0AE9P Arabidopsis thaliana Full-length cD... 42 0.27
ref|NM_101463.2| Arabidopsis thaliana CCR1 (CINNAMOYL COA R... 42 0.27
gb|AY743921.1| Arabidopsis thaliana cinnamoyl CoA reductase... 42 0.27
ref|NC_003070.5| Arabidopsis thaliana chromosome 1, complet... 42 0.27
gb|BP649172.1|BP649172 BP649172 RAFL19 Arabidopsis thaliana... 38 4.2
dbj|AB013388.1| Arabidopsis thaliana genomic DNA, chromosom... 38 4.2
dbj|BA000015.5| Arabidopsis thaliana DNA, chromosome 5, com... 38 4.2
ref|NM_114508.1| Arabidopsis thaliana ATP binding / kinase/... 38 4.2
ref|NM_124706.1| Arabidopsis thaliana unknown protein AT5G5... 38 4.2
ref|NC_003076.4| Arabidopsis thaliana chromosome 5, complet... 38 4.2
>gb|BE520377.1|BE520377 M12A7STM Arabidopsis developing seed Arabidopsis thaliana cDNA
clone M12A7 5', mRNA sequence
Length = 388
Score = 42.1 bits (21), Expect = 0.27
Identities = 51/61 (83%)
Strand = Plus / Plus
Query: 691 tggtggtggtgaacccggtgctggtgctgggcccgctgctgcagccgacggtgaacgcca 750
|||||||| |||| ||||||||||| || || |||| | | ||||||||| | |||||||
Sbjct: 189 tggtggtgttgaatccggtgctggttcttggaccgccgttacagccgacgatcaacgcca 248
Query: 751 g 751
|
Sbjct: 249 g 249
>gb|BE521298.1|BE521298 M18G8STM Arabidopsis developing seed Arabidopsis thaliana cDNA
clone M18G8 5', mRNA sequence
Length = 413
Score = 42.1 bits (21), Expect = 0.27
Identities = 51/61 (83%)
Strand = Plus / Plus
Query: 691 tggtggtggtgaacccggtgctggtgctgggcccgctgctgcagccgacggtgaacgcca 750
|||||||| |||| ||||||||||| || || |||| | | ||||||||| | |||||||
Sbjct: 244 tggtggtgttgaatccggtgctggttcttggaccgccgttacagccgacgatcaacgcca 303
Query: 751 g 751
|
Sbjct: 304 g 304
>gb|BE527222.1|BE527222 M67F13STM Arabidopsis developing seed Arabidopsis thaliana cDNA
clone 600036051R1 5', mRNA sequence
Length = 246
Score = 42.1 bits (21), Expect = 0.27
Identities = 51/61 (83%)
Strand = Plus / Plus
Query: 691 tggtggtggtgaacccggtgctggtgctgggcccgctgctgcagccgacggtgaacgcca 750
|||||||| |||| ||||||||||| || || |||| | | ||||||||| | |||||||
Sbjct: 172 tggtggtgttgaatccggtgctggttcttggaccgccgttacagccgacgatcaacgcca 231
Query: 751 g 751
|
Sbjct: 232 g 232
>gb|AV784273.1|AV784273 AV784273 RAFL5 Arabidopsis thaliana cDNA clone RAFL05-17-P18 3',
mRNA sequence
Length = 700
Score = 42.1 bits (21), Expect = 0.27
Identities = 51/61 (83%)
Strand = Plus / Minus
Query: 691 tggtggtggtgaacccggtgctggtgctgggcccgctgctgcagccgacggtgaacgcca 750
|||||||| |||| ||||||||||| || || |||| | | ||||||||| | |||||||
Sbjct: 694 tggtggtgttgaatccggtgctggttcttggaccgccgttacagccgacgatcaacgcca 635
Query: 751 g 751
|
Sbjct: 634 g 634
>gb|BU634974.1|BU634974 013F08 Infected Arabidopsis Leaf Arabidopsis thaliana cDNA, mRNA
sequence
Length = 701
Score = 42.1 bits (21), Expect = 0.27
Identities = 51/61 (83%)
Strand = Plus / Plus
Query: 691 tggtggtggtgaacccggtgctggtgctgggcccgctgctgcagccgacggtgaacgcca 750
|||||||| |||| ||||||||||| || || |||| | | ||||||||| | |||||||
Sbjct: 533 tggtggtgttgaatccggtgctggttcttggaccgccgttacagccgacgatcaacgcca 592
Query: 751 g 751
|
Sbjct: 593 g 593
>gb|AV550189.1|AV550189 AV550189 Arabidopsis thaliana roots Columbia Arabidopsis thaliana
cDNA clone RZ109e03R 5', mRNA sequence
Length = 547
Score = 42.1 bits (21), Expect = 0.27
Identities = 51/61 (83%)
Strand = Plus / Plus
Query: 691 tggtggtggtgaacccggtgctggtgctgggcccgctgctgcagccgacggtgaacgcca 750
|||||||| |||| ||||||||||| || || |||| | | ||||||||| | |||||||
Sbjct: 439 tggtggtgttgaatccggtgctggttcttggaccgccgttacagccgacgatcaacgcca 498
Query: 751 g 751
|
Sbjct: 499 g 499
>gb|AF320624.1|AF320624 Arabidopsis thaliana cinnamoyl CoA reductase isoform 1 (CCR1) mRNA,
complete cds
Length = 1269
Score = 42.1 bits (21), Expect = 0.27
Identities = 51/61 (83%)
Strand = Plus / Plus
Query: 691 tggtggtggtgaacccggtgctggtgctgggcccgctgctgcagccgacggtgaacgcca 750
|||||||| |||| ||||||||||| || || |||| | | ||||||||| | |||||||
Sbjct: 548 tggtggtgttgaatccggtgctggttcttggaccgccgttacagccgacgatcaacgcca 607
Query: 751 g 751
|
Sbjct: 608 g 608
>gb|AE005172.1| Arabidopsis thaliana chromosome 1, top arm complete sequence
Length = 14221815
Score = 42.1 bits (21), Expect = 0.27
Identities = 51/61 (83%)
Strand = Plus / Plus
Query: 691 tggtggtggtgaacccggtgctggtgctgggcccgctgctgcagccgacggtgaacgcca 750
|||||||| |||| ||||||||||| || || |||| | | ||||||||| | |||||||
Sbjct: 5480045 tggtggtgttgaatccggtgctggttcttggaccgccgttacagccgacgatcaacgcca 5480104
Query: 751 g 751
|
Sbjct: 5480105 g 5480105
>gb|AY087316.1| Arabidopsis thaliana clone 34141 mRNA, complete sequence
Length = 1370
Score = 42.1 bits (21), Expect = 0.27
Identities = 51/61 (83%)
Strand = Plus / Plus
Query: 691 tggtggtggtgaacccggtgctggtgctgggcccgctgctgcagccgacggtgaacgcca 750
|||||||| |||| ||||||||||| || || |||| | | ||||||||| | |||||||
Sbjct: 650 tggtggtgttgaatccggtgctggttcttggaccgccgttacagccgacgatcaacgcca 709
Query: 751 g 751
|
Sbjct: 710 g 710
>gb|AF332459.1| Arabidopsis thaliana clone C00167 (e) putative cinnamoyl CoA
reductase (At1g15950) mRNA, complete cds
Length = 1035
Score = 42.1 bits (21), Expect = 0.27
Identities = 51/61 (83%)
Strand = Plus / Plus
Query: 691 tggtggtggtgaacccggtgctggtgctgggcccgctgctgcagccgacggtgaacgcca 750
|||||||| |||| ||||||||||| || || |||| | | ||||||||| | |||||||
Sbjct: 548 tggtggtgttgaatccggtgctggttcttggaccgccgttacagccgacgatcaacgcca 607
Query: 751 g 751
|
Sbjct: 608 g 608
>gb|AC010924.2|T24D18 Arabidopsis thaliana chromosome 1 BAC T24D18 sequence, complete
sequence
Length = 80442
Score = 42.1 bits (21), Expect = 0.27
Identities = 51/61 (83%)
Strand = Plus / Plus
Query: 691 tggtggtggtgaacccggtgctggtgctgggcccgctgctgcagccgacggtgaacgcca 750
|||||||| |||| ||||||||||| || || |||| | | ||||||||| | |||||||
Sbjct: 15478 tggtggtgttgaatccggtgctggttcttggaccgccgttacagccgacgatcaacgcca 15537
Query: 751 g 751
|
Sbjct: 15538 g 15538
>emb|BX815831.1|CNS0AAHT Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTPGH11ZC11 of Hormone Treated Callus of strain col-0
of Arabidopsis thaliana (thale cress)
Length = 1305
Score = 42.1 bits (21), Expect = 0.27
Identities = 51/61 (83%)
Strand = Plus / Plus
Query: 691 tggtggtggtgaacccggtgctggtgctgggcccgctgctgcagccgacggtgaacgcca 750
|||||||| |||| ||||||||||| || || |||| | | ||||||||| | |||||||
Sbjct: 630 tggtggtgttgaatccggtgctggttcttggaccgccgttacagccgacgatcaacgcca 689
Query: 751 g 751
|
Sbjct: 690 g 690
>emb|BX815700.1|CNS0ABD9 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTLS85ZF05 of Adult vegetative tissue of strain col-0
of Arabidopsis thaliana (thale cress)
Length = 1314
Score = 42.1 bits (21), Expect = 0.27
Identities = 51/61 (83%)
Strand = Plus / Plus
Query: 691 tggtggtggtgaacccggtgctggtgctgggcccgctgctgcagccgacggtgaacgcca 750
|||||||| |||| ||||||||||| || || |||| | | ||||||||| | |||||||
Sbjct: 630 tggtggtgttgaatccggtgctggttcttggaccgccgttacagccgacgatcaacgcca 689
Query: 751 g 751
|
Sbjct: 690 g 690
>emb|BX815739.1|CNS0ABDT Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTLS8ZE04 of Adult vegetative tissue of strain col-0
of Arabidopsis thaliana (thale cress)
Length = 1292
Score = 42.1 bits (21), Expect = 0.27
Identities = 51/61 (83%)
Strand = Plus / Plus
Query: 691 tggtggtggtgaacccggtgctggtgctgggcccgctgctgcagccgacggtgaacgcca 750
|||||||| |||| ||||||||||| || || |||| | | ||||||||| | |||||||
Sbjct: 603 tggtggtgttgaatccggtgctggttcttggaccgccgttacagccgacgatcaacgcca 662
Query: 751 g 751
|
Sbjct: 663 g 663
>emb|BX815406.1|CNS0ABFH Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTLS58ZD09 of Adult vegetative tissue of strain col-0
of Arabidopsis thaliana (thale cress)
Length = 1305
Score = 42.1 bits (21), Expect = 0.27
Identities = 51/61 (83%)
Strand = Plus / Plus
Query: 691 tggtggtggtgaacccggtgctggtgctgggcccgctgctgcagccgacggtgaacgcca 750
|||||||| |||| ||||||||||| || || |||| | | ||||||||| | |||||||
Sbjct: 603 tggtggtgttgaatccggtgctggttcttggaccgccgttacagccgacgatcaacgcca 662
Query: 751 g 751
|
Sbjct: 663 g 663
>emb|BX815742.1|CNS0ABF5 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTLS8ZF03 of Adult vegetative tissue of strain col-0
of Arabidopsis thaliana (thale cress)
Length = 1338
Score = 42.1 bits (21), Expect = 0.27
Identities = 51/61 (83%)
Strand = Plus / Plus
Query: 691 tggtggtggtgaacccggtgctggtgctgggcccgctgctgcagccgacggtgaacgcca 750
|||||||| |||| ||||||||||| || || |||| | | ||||||||| | |||||||
Sbjct: 630 tggtggtgttgaatccggtgctggttcttggaccgccgttacagccgacgatcaacgcca 689
Query: 751 g 751
|
Sbjct: 690 g 690
>emb|BX816709.1|CNS0ABPI Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTPGH64ZG07 of Hormone Treated Callus of strain col-0
of Arabidopsis thaliana (thale cress)
Length = 1291
Score = 42.1 bits (21), Expect = 0.27
Identities = 51/61 (83%)
Strand = Plus / Plus
Query: 691 tggtggtggtgaacccggtgctggtgctgggcccgctgctgcagccgacggtgaacgcca 750
|||||||| |||| ||||||||||| || || |||| | | ||||||||| | |||||||
Sbjct: 603 tggtggtgttgaatccggtgctggttcttggaccgccgttacagccgacgatcaacgcca 662
Query: 751 g 751
|
Sbjct: 663 g 663
>emb|BX816189.1|CNS0AE9P Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTPGH33ZD01 of Hormone Treated Callus of strain col-0
of Arabidopsis thaliana (thale cress)
Length = 1305
Score = 42.1 bits (21), Expect = 0.27
Identities = 51/61 (83%)
Strand = Plus / Plus
Query: 691 tggtggtggtgaacccggtgctggtgctgggcccgctgctgcagccgacggtgaacgcca 750
|||||||| |||| ||||||||||| || || |||| | | ||||||||| | |||||||
Sbjct: 608 tggtggtgttgaatccggtgctggttcttggaccgccgttacagccgacgatcaacgcca 667
Query: 751 g 751
|
Sbjct: 668 g 668
>ref|NM_101463.2| Arabidopsis thaliana CCR1 (CINNAMOYL COA REDUCTASE 1) AT1G15950
(CCR1) mRNA, complete cds
Length = 1386
Score = 42.1 bits (21), Expect = 0.27
Identities = 51/61 (83%)
Strand = Plus / Plus
Query: 691 tggtggtggtgaacccggtgctggtgctgggcccgctgctgcagccgacggtgaacgcca 750
|||||||| |||| ||||||||||| || || |||| | | ||||||||| | |||||||
Sbjct: 649 tggtggtgttgaatccggtgctggttcttggaccgccgttacagccgacgatcaacgcca 708
Query: 751 g 751
|
Sbjct: 709 g 709
>gb|AY743921.1| Arabidopsis thaliana cinnamoyl CoA reductase 1 (ccr1) mRNA,
complete cds
Length = 1035
Score = 42.1 bits (21), Expect = 0.27
Identities = 51/61 (83%)
Strand = Plus / Plus
Query: 691 tggtggtggtgaacccggtgctggtgctgggcccgctgctgcagccgacggtgaacgcca 750
|||||||| |||| ||||||||||| || || |||| | | ||||||||| | |||||||
Sbjct: 548 tggtggtgttgaatccggtgctggttcttggaccgccgttacagccgacgatcaacgcca 607
Query: 751 g 751
|
Sbjct: 608 g 608
>ref|NC_003070.5| Arabidopsis thaliana chromosome 1, complete sequence
Length = 30432563
Score = 42.1 bits (21), Expect = 0.27
Identities = 51/61 (83%)
Strand = Plus / Plus
Query: 691 tggtggtggtgaacccggtgctggtgctgggcccgctgctgcagccgacggtgaacgcca 750
|||||||| |||| ||||||||||| || || |||| | | ||||||||| | |||||||
Sbjct: 5480221 tggtggtgttgaatccggtgctggttcttggaccgccgttacagccgacgatcaacgcca 5480280
Query: 751 g 751
|
Sbjct: 5480281 g 5480281
>gb|BP649172.1|BP649172 BP649172 RAFL19 Arabidopsis thaliana cDNA clone RAFL19-12-J24 3',
mRNA sequence
Length = 367
Score = 38.2 bits (19), Expect = 4.2
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 694 tggtggtgaacccggtgct 712
|||||||||||||||||||
Sbjct: 292 tggtggtgaacccggtgct 274
>dbj|AB013388.1| Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K19E1
Length = 73428
Score = 38.2 bits (19), Expect = 4.2
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 1374 catgcaatgtatctctttg 1392
|||||||||||||||||||
Sbjct: 20479 catgcaatgtatctctttg 20461
>dbj|BA000015.5| Arabidopsis thaliana DNA, chromosome 5, complete sequence
Length = 23810767
Score = 38.2 bits (19), Expect = 4.2
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 1374 catgcaatgtatctctttg 1392
|||||||||||||||||||
Sbjct: 19357567 catgcaatgtatctctttg 19357549
>ref|NM_114508.1| Arabidopsis thaliana ATP binding / kinase/ protein kinase/ protein
serine/threonine kinase/ protein-tyrosine kinase
AT3G46410 mRNA, complete cds
Length = 876
Score = 38.2 bits (19), Expect = 4.2
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 1346 catgctttcctgacaagtg 1364
|||||||||||||||||||
Sbjct: 229 catgctttcctgacaagtg 211
>ref|NM_124706.1| Arabidopsis thaliana unknown protein AT5G53270 mRNA, complete cds
Length = 480
Score = 38.2 bits (19), Expect = 4.2
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 1374 catgcaatgtatctctttg 1392
|||||||||||||||||||
Sbjct: 461 catgcaatgtatctctttg 479
>ref|NC_003076.4| Arabidopsis thaliana chromosome 5, complete sequence
Length = 26992728
Score = 38.2 bits (19), Expect = 4.2
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 1374 catgcaatgtatctctttg 1392
|||||||||||||||||||
Sbjct: 21623516 catgcaatgtatctctttg 21623498
Database: At_nucl_with_EST.fasta
Posted date: May 2, 2006 2:53 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 375,238
Number of Sequences: 1013581
Number of extensions: 375238
Number of successful extensions: 27842
Number of sequences better than 10.0: 27
Number of HSP's better than 10.0 without gapping: 27
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 27257
Number of HSP's gapped (non-prelim): 585
length of query: 1466
length of database: 908,940,872
effective HSP length: 21
effective length of query: 1445
effective length of database: 887,655,671
effective search space: 1282662444595
effective search space used: 1282662444595
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)