BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= AF019146.2.1
(1761 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AY089003.1| Arabidopsis thaliana clone 151603 mRNA, comp... 58 5e-006
gb|CB261636.1|CB261636 92-E9724-008-016-H24-pBl2 MPIZ-ADIS-... 56 2e-005
gb|CF652394.1|CF652394 52-L020579-066-004-H13-SP6P MPIZ-ADI... 56 2e-005
gb|AV439468.2|AV439468 AV439468 Arabidopsis thaliana above-... 56 2e-005
emb|AX507656.1| Sequence 2351 from Patent WO0216655 56 2e-005
dbj|AK119026.1| Arabidopsis thaliana At3g48350 mRNA for put... 56 2e-005
emb|CQ805902.1| Sequence 2313 from Patent WO2004035798 56 2e-005
dbj|BA000014.8| Arabidopsis thaliana, chromosome 3, complet... 56 2e-005
emb|AL049659.2|ATT29H11 Arabidopsis thaliana DNA chromosome... 56 2e-005
ref|NM_114696.2| Arabidopsis thaliana cysteine-type endopep... 56 2e-005
ref|NC_003074.4| Arabidopsis thaliana chromosome 3, complet... 56 2e-005
gb|AC012329.5|AC012329 Arabidopsis thaliana chromosome 1 BA... 54 8e-005
emb|AL132956.2|ATF2K15 Arabidopsis thaliana DNA chromosome ... 54 8e-005
ref|NM_114794.1| Arabidopsis thaliana cysteine-type endopep... 54 8e-005
gb|AY201463.1|AY201463 AY201463 Arabidopsis thaliana Landsb... 48 0.005
gb|AU239908.1|AU239908 AU239908 RAFL21 Arabidopsis thaliana... 46 0.021
ref|NM_128959.2| Arabidopsis thaliana cysteine-type endopep... 44 0.082
gb|CL474706.1|CL474706 SAIL_224_D09.v1 SAIL Collection Arab... 42 0.32
gb|BX837850.1|BX837850 BX837850 Arabidopsis thaliana Hormon... 42 0.32
gb|BX841334.1|BX841334 BX841334 Arabidopsis thaliana Adult ... 42 0.32
dbj|AB025624.1| Arabidopsis thaliana genomic DNA, chromosom... 42 0.32
dbj|AK118509.1| Arabidopsis thaliana At3g19400 mRNA for put... 42 0.32
ref|NM_112827.2| Arabidopsis thaliana cysteine-type endopep... 42 0.32
ref|NM_202612.1| Arabidopsis thaliana cysteine-type endopep... 42 0.32
>gb|AY089003.1| Arabidopsis thaliana clone 151603 mRNA, complete sequence
Length = 1304
Score = 58.0 bits (29), Expect = 5e-006
Identities = 44/49 (89%)
Strand = Plus / Plus
Query: 617 tgctgggcgttctcggcggtggcagcggtggaagggatcaacaagatcg 665
||||||||||| ||| |||| ||||| ||||||||||| ||||||||||
Sbjct: 470 tgctgggcgttttcgacggttgcagcagtggaagggataaacaagatcg 518
>gb|CB261636.1|CB261636 92-E9724-008-016-H24-pBl2 MPIZ-ADIS-008 Arabidopsis thaliana cDNA
clone MPIZp767H2416Q 5-PRIME, mRNA sequence
Length = 664
Score = 56.0 bits (28), Expect = 2e-005
Identities = 43/48 (89%)
Strand = Plus / Plus
Query: 617 tgctgggcgttctcggcggtggcagcggtggaagggatcaacaagatc 664
||||||||||| ||| |||| ||||| ||||||||||| |||||||||
Sbjct: 436 tgctgggcgttttcgacggttgcagcagtggaagggataaacaagatc 483
>gb|CF652394.1|CF652394 52-L020579-066-004-H13-SP6P MPIZ-ADIS-066 Arabidopsis thaliana cDNA
clone MPIZp2001H134Q 5-PRIME, mRNA sequence
Length = 859
Score = 56.0 bits (28), Expect = 2e-005
Identities = 43/48 (89%)
Strand = Plus / Plus
Query: 617 tgctgggcgttctcggcggtggcagcggtggaagggatcaacaagatc 664
||||||||||| ||| |||| ||||| ||||||||||| |||||||||
Sbjct: 422 tgctgggcgttttcgacggttgcagcagtggaagggataaacaagatc 469
>gb|AV439468.2|AV439468 AV439468 Arabidopsis thaliana above-ground organ two to six-week
old Arabidopsis thaliana cDNA clone APD01b05_f 3', mRNA
sequence
Length = 612
Score = 56.0 bits (28), Expect = 2e-005
Identities = 43/48 (89%)
Strand = Plus / Plus
Query: 617 tgctgggcgttctcggcggtggcagcggtggaagggatcaacaagatc 664
||||||||||| ||| |||| ||||| ||||||||||| |||||||||
Sbjct: 458 tgctgggcgttttcgacggttgcagcagtggaagggataaacaagatc 505
>emb|AX507656.1| Sequence 2351 from Patent WO0216655
Length = 1095
Score = 56.0 bits (28), Expect = 2e-005
Identities = 43/48 (89%)
Strand = Plus / Plus
Query: 617 tgctgggcgttctcggcggtggcagcggtggaagggatcaacaagatc 664
||||||||||| ||| |||| ||||| ||||||||||| |||||||||
Sbjct: 448 tgctgggcgttttcgacggttgcagcagtggaagggataaacaagatc 495
>dbj|AK119026.1| Arabidopsis thaliana At3g48350 mRNA for putative cysteine
endopeptidase precursor, complete cds, clone:
RAFL21-34-N20
Length = 1307
Score = 56.0 bits (28), Expect = 2e-005
Identities = 43/48 (89%)
Strand = Plus / Plus
Query: 617 tgctgggcgttctcggcggtggcagcggtggaagggatcaacaagatc 664
||||||||||| ||| |||| ||||| ||||||||||| |||||||||
Sbjct: 469 tgctgggcgttttcgacggttgcagcagtggaagggataaacaagatc 516
>emb|CQ805902.1| Sequence 2313 from Patent WO2004035798
Length = 1095
Score = 56.0 bits (28), Expect = 2e-005
Identities = 43/48 (89%)
Strand = Plus / Plus
Query: 617 tgctgggcgttctcggcggtggcagcggtggaagggatcaacaagatc 664
||||||||||| ||| |||| ||||| ||||||||||| |||||||||
Sbjct: 448 tgctgggcgttttcgacggttgcagcagtggaagggataaacaagatc 495
>dbj|BA000014.8| Arabidopsis thaliana, chromosome 3, complete sequence
Length = 23403063
Score = 56.0 bits (28), Expect = 2e-005
Identities = 43/48 (89%)
Strand = Plus / Plus
Query: 617 tgctgggcgttctcggcggtggcagcggtggaagggatcaacaagatc 664
||||||||||| ||| |||| ||||| ||||||||||| |||||||||
Sbjct: 17870408 tgctgggcgttttcgacggttgcagcagtggaagggataaacaagatc 17870455
Score = 54.0 bits (27), Expect = 8e-005
Identities = 33/35 (94%)
Strand = Plus / Minus
Query: 617 tgctgggcgttctcggcggtggcagcggtggaagg 651
|||||||| ||||||||||||||||| ||||||||
Sbjct: 18257380 tgctgggctttctcggcggtggcagcagtggaagg 18257346
Score = 42.1 bits (21), Expect = 0.32
Identities = 39/45 (86%)
Strand = Plus / Plus
Query: 620 tgggcgttctcggcggtggcagcggtggaagggatcaacaagatc 664
|||||||| || ||||| | ||| ||||||||||||||| |||||
Sbjct: 6693679 tgggcgttttctgcggttggagcagtggaagggatcaaccagatc 6693723
>emb|AL049659.2|ATT29H11 Arabidopsis thaliana DNA chromosome 3, BAC clone T29H11
Length = 97488
Score = 56.0 bits (28), Expect = 2e-005
Identities = 43/48 (89%)
Strand = Plus / Plus
Query: 617 tgctgggcgttctcggcggtggcagcggtggaagggatcaacaagatc 664
||||||||||| ||| |||| ||||| ||||||||||| |||||||||
Sbjct: 38993 tgctgggcgttttcgacggttgcagcagtggaagggataaacaagatc 39040
>ref|NM_114696.2| Arabidopsis thaliana cysteine-type endopeptidase/ cysteine-type
peptidase AT3G48350 mRNA, complete cds
Length = 1306
Score = 56.0 bits (28), Expect = 2e-005
Identities = 43/48 (89%)
Strand = Plus / Plus
Query: 617 tgctgggcgttctcggcggtggcagcggtggaagggatcaacaagatc 664
||||||||||| ||| |||| ||||| ||||||||||| |||||||||
Sbjct: 468 tgctgggcgttttcgacggttgcagcagtggaagggataaacaagatc 515
>ref|NC_003074.4| Arabidopsis thaliana chromosome 3, complete sequence
Length = 23470805
Score = 56.0 bits (28), Expect = 2e-005
Identities = 43/48 (89%)
Strand = Plus / Plus
Query: 617 tgctgggcgttctcggcggtggcagcggtggaagggatcaacaagatc 664
||||||||||| ||| |||| ||||| ||||||||||| |||||||||
Sbjct: 17917346 tgctgggcgttttcgacggttgcagcagtggaagggataaacaagatc 17917393
Score = 54.0 bits (27), Expect = 8e-005
Identities = 33/35 (94%)
Strand = Plus / Minus
Query: 617 tgctgggcgttctcggcggtggcagcggtggaagg 651
|||||||| ||||||||||||||||| ||||||||
Sbjct: 18304907 tgctgggctttctcggcggtggcagcagtggaagg 18304873
Score = 42.1 bits (21), Expect = 0.32
Identities = 39/45 (86%)
Strand = Plus / Plus
Query: 620 tgggcgttctcggcggtggcagcggtggaagggatcaacaagatc 664
|||||||| || ||||| | ||| ||||||||||||||| |||||
Sbjct: 6726064 tgggcgttttctgcggttggagcagtggaagggatcaaccagatc 6726108
>gb|AC012329.5|AC012329 Arabidopsis thaliana chromosome 1 BAC T1G12 genomic sequence, complete
sequence
Length = 80367
Score = 54.0 bits (27), Expect = 8e-005
Identities = 33/35 (94%)
Strand = Plus / Minus
Query: 617 tgctgggcgttctcggcggtggcagcggtggaagg 651
|||||||| ||||||||||||||||| ||||||||
Sbjct: 14711 tgctgggctttctcggcggtggcagcagtggaagg 14677
>emb|AL132956.2|ATF2K15 Arabidopsis thaliana DNA chromosome 3, BAC clone F2K15
Length = 129757
Score = 54.0 bits (27), Expect = 8e-005
Identities = 33/35 (94%)
Strand = Plus / Minus
Query: 617 tgctgggcgttctcggcggtggcagcggtggaagg 651
|||||||| ||||||||||||||||| ||||||||
Sbjct: 96579 tgctgggctttctcggcggtggcagcagtggaagg 96545
>ref|NM_114794.1| Arabidopsis thaliana cysteine-type endopeptidase/ cysteine-type
peptidase AT3G49340 mRNA, complete cds
Length = 1026
Score = 54.0 bits (27), Expect = 8e-005
Identities = 33/35 (94%)
Strand = Plus / Plus
Query: 617 tgctgggcgttctcggcggtggcagcggtggaagg 651
|||||||| ||||||||||||||||| ||||||||
Sbjct: 451 tgctgggctttctcggcggtggcagcagtggaagg 485
>gb|AY201463.1|AY201463 AY201463 Arabidopsis thaliana Landsberg erecta DNA Arabidopsis
thaliana genomic clone GT3344.Ds3.03.24.00.b.384, DNA
sequence
Length = 384
Score = 48.1 bits (24), Expect = 0.005
Identities = 42/48 (87%)
Strand = Plus / Plus
Query: 617 tgctgggcgttctcggcggtggcagcggtggaagggatcaacaagatc 664
||||||||||| || |||| ||||| ||||||||||| |||||||||
Sbjct: 167 tgctgggcgttttcaacggttgcagcagtggaagggataaacaagatc 214
>gb|AU239908.1|AU239908 AU239908 RAFL21 Arabidopsis thaliana cDNA clone RAFL21-34-N20 5',
mRNA sequence
Length = 534
Score = 46.1 bits (23), Expect = 0.021
Identities = 41/48 (85%)
Strand = Plus / Plus
Query: 617 tgctgggcgttctcggcggtggcagcggtggaagggatcaacaagatc 664
||||||||||| ||| | || ||||| ||||| ||||| |||||||||
Sbjct: 470 tgctgggcgttttcgacngttgcagcngtggangggataaacaagatc 517
>ref|NM_128959.2| Arabidopsis thaliana cysteine-type endopeptidase/ cysteine-type
peptidase AT2G34080 mRNA, complete cds
Length = 1364
Score = 44.1 bits (22), Expect = 0.082
Identities = 52/62 (83%)
Strand = Plus / Plus
Query: 590 gtcaaggaccagggccaatgcggtgggtgctgggcgttctcggcggtggcagcggtggaa 649
|||||| |||| ||||||||||| | |||||||| || ||||| || ||||| ||||||
Sbjct: 514 gtcaagtaccaaggccaatgcggatgttgctgggcattttcggctgtagcagcagtggaa 573
Query: 650 gg 651
||
Sbjct: 574 gg 575
>gb|CL474706.1|CL474706 SAIL_224_D09.v1 SAIL Collection Arabidopsis thaliana genomic clone
SAIL_224_D09.v1, DNA sequence
Length = 1038
Score = 42.1 bits (21), Expect = 0.32
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 288 ccgacgccggcgccggcgccg 308
|||||||||||||||||||||
Sbjct: 750 ccgacgccggcgccggcgccg 770
>gb|BX837850.1|BX837850 BX837850 Arabidopsis thaliana Hormone Treated Callus Col-0
Arabidopsis thaliana cDNA clone GSLTPGH62ZE12 5PRIM,
mRNA sequence
Length = 1043
Score = 42.1 bits (21), Expect = 0.32
Identities = 39/45 (86%)
Strand = Plus / Plus
Query: 620 tgggcgttctcggcggtggcagcggtggaagggatcaacaagatc 664
|||||||| || ||||| | ||| ||||||||||||||| |||||
Sbjct: 467 tgggcgttttctgcggttggagcagtggaagggatcaaccagatc 511
>gb|BX841334.1|BX841334 BX841334 Arabidopsis thaliana Adult vegetative tissue Col-0
Arabidopsis thaliana cDNA clone GSLTLS41ZF02 5PRIM, mRNA
sequence
Length = 925
Score = 42.1 bits (21), Expect = 0.32
Identities = 39/45 (86%)
Strand = Plus / Plus
Query: 620 tgggcgttctcggcggtggcagcggtggaagggatcaacaagatc 664
|||||||| || ||||| | ||| ||||||||||||||| |||||
Sbjct: 494 tgggcgttttctgcggttggagcagtggaagggatcaaccagatc 538
>dbj|AB025624.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MLD14
Length = 83097
Score = 42.1 bits (21), Expect = 0.32
Identities = 39/45 (86%)
Strand = Plus / Plus
Query: 620 tgggcgttctcggcggtggcagcggtggaagggatcaacaagatc 664
|||||||| || ||||| | ||| ||||||||||||||| |||||
Sbjct: 39284 tgggcgttttctgcggttggagcagtggaagggatcaaccagatc 39328
>dbj|AK118509.1| Arabidopsis thaliana At3g19400 mRNA for putative cysteine
proteinase RD21A precursor, complete cds, clone:
RAFL19-74-E13
Length = 1178
Score = 42.1 bits (21), Expect = 0.32
Identities = 39/45 (86%)
Strand = Plus / Plus
Query: 620 tgggcgttctcggcggtggcagcggtggaagggatcaacaagatc 664
|||||||| || ||||| | ||| ||||||||||||||| |||||
Sbjct: 505 tgggcgttttctgcggttggagcagtggaagggatcaaccagatc 549
>ref|NM_112827.2| Arabidopsis thaliana cysteine-type endopeptidase/ cysteine-type
peptidase AT3G19400 transcript variant AT3G19400.1 mRNA,
complete cds
Length = 1253
Score = 42.1 bits (21), Expect = 0.32
Identities = 39/45 (86%)
Strand = Plus / Plus
Query: 620 tgggcgttctcggcggtggcagcggtggaagggatcaacaagatc 664
|||||||| || ||||| | ||| ||||||||||||||| |||||
Sbjct: 505 tgggcgttttctgcggttggagcagtggaagggatcaaccagatc 549
>ref|NM_202612.1| Arabidopsis thaliana cysteine-type endopeptidase/ cysteine-type
peptidase AT3G19400 transcript variant AT3G19400.2 mRNA,
complete cds
Length = 936
Score = 42.1 bits (21), Expect = 0.32
Identities = 39/45 (86%)
Strand = Plus / Plus
Query: 620 tgggcgttctcggcggtggcagcggtggaagggatcaacaagatc 664
|||||||| || ||||| | ||| ||||||||||||||| |||||
Sbjct: 505 tgggcgttttctgcggttggagcagtggaagggatcaaccagatc 549
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 481,555
Number of Sequences: 1013581
Number of extensions: 481555
Number of successful extensions: 38449
Number of sequences better than 0.5: 24
Number of HSP's better than 0.5 without gapping: 26
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 37806
Number of HSP's gapped (non-prelim): 643
length of query: 1761
length of database: 908,940,872
effective HSP length: 21
effective length of query: 1740
effective length of database: 887,655,671
effective search space: 1544520867540
effective search space used: 1544520867540
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)