BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 8616263.2.1
(509 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
emb|BX842419.1|CNS0A7PD Arabidopsis thaliana Full-length cD... 56 6e-006
emb|BX822041.1|CNS0AAEO Arabidopsis thaliana Full-length cD... 56 6e-006
ref|NM_128470.3| Arabidopsis thaliana copper ion binding AT... 56 6e-006
gb|B28556.1|B28556 T13C14TR TAMU Arabidopsis thaliana genom... 54 2e-005
gb|BZ382558.1|BZ382558 SALK_118473.54.40.x Arabidopsis thal... 54 2e-005
gb|AV561049.1|AV561049 AV561049 Arabidopsis thaliana green ... 54 2e-005
gb|AV563756.1|AV563756 AV563756 Arabidopsis thaliana green ... 54 2e-005
gb|BP787187.1|BP787187 BP787187 RAFL7 Arabidopsis thaliana ... 54 2e-005
emb|AL807518.1| Arabidopsis thaliana transposon insertion S... 54 2e-005
emb|AL807557.1| Arabidopsis thaliana transposon insertion S... 54 2e-005
emb|BX295241.1| Arabidopsis thaliana transposon insertion S... 54 2e-005
gb|BT014855.1| Arabidopsis thaliana At5g01190 gene, complet... 54 2e-005
dbj|BA000015.5| Arabidopsis thaliana DNA, chromosome 5, com... 54 2e-005
emb|AL137189.2|ATF7J8 Arabidopsis thaliana DNA chromosome 5... 54 2e-005
ref|NM_120197.3| Arabidopsis thaliana copper ion binding AT... 54 2e-005
ref|NC_003076.4| Arabidopsis thaliana chromosome 5, complet... 54 2e-005
gb|AI998334.1|AI998334 701545291 A. thaliana, Columbia Col-... 52 9e-005
gb|AV787312.1|AV787312 AV787312 RAFL6 Arabidopsis thaliana ... 52 9e-005
gb|AV792270.1|AV792270 AV792270 RAFL7 Arabidopsis thaliana ... 52 9e-005
gb|AV815278.1|AV815278 AV815278 RAFL9 Arabidopsis thaliana ... 52 9e-005
gb|AV816241.1|AV816241 AV816241 RAFL9 Arabidopsis thaliana ... 52 9e-005
gb|AV532135.1|AV532135 AV532135 Arabidopsis thaliana flower... 52 9e-005
gb|AV540676.1|AV540676 AV540676 Arabidopsis thaliana roots ... 52 9e-005
gb|BP792246.1|BP792246 BP792246 RAFL7 Arabidopsis thaliana ... 52 9e-005
gb|AY052669.1| Arabidopsis thaliana At2g38080/T8P21. mRNA, ... 52 9e-005
gb|AY063730.1| Arabidopsis thaliana At2g38080/T8P21. mRNA, ... 52 9e-005
gb|AY065187.1| Arabidopsis thaliana putative diphenol oxida... 52 9e-005
gb|AY114636.1| Arabidopsis thaliana putative diphenol oxida... 52 9e-005
emb|BX819300.1|CNS0A9ZV Arabidopsis thaliana Full-length cD... 52 9e-005
emb|BX821553.1|CNS0AA40 Arabidopsis thaliana Full-length cD... 52 9e-005
ref|NM_129364.2| Arabidopsis thaliana IRX12; copper ion bin... 52 9e-005
ref|NM_125281.1| Arabidopsis thaliana copper ion binding AT... 48 0.001
gb|AV800583.1|AV800583 AV800583 RAFL9 Arabidopsis thaliana ... 46 0.006
gb|AC003028.3| Arabidopsis thaliana chromosome 2 clone F16M... 46 0.006
gb|AC005315.3| Arabidopsis thaliana chromosome 2 clone T9I4... 46 0.006
emb|CR379253.1| Arabidopsis thaliana transposon insertion S... 46 0.006
ref|NC_003071.3| Arabidopsis thaliana chromosome 2, complet... 46 0.006
gb|AV787178.1|AV787178 AV787178 RAFL6 Arabidopsis thaliana ... 44 0.023
gb|BE521176.1|BE521176 M18A3XTM Arabidopsis developing seed... 40 0.36
gb|BE521178.1|BE521178 M18A4XP Arabidopsis developing seed ... 40 0.36
gb|BE521179.1|BE521179 M18A4XTM Arabidopsis developing seed... 40 0.36
gb|AU227405.1|AU227405 AU227405 RAFL15 Arabidopsis thaliana... 40 0.36
gb|AV555534.1|AV555534 AV555534 Arabidopsis thaliana green ... 40 0.36
gb|AV556399.1|AV556399 AV556399 Arabidopsis thaliana green ... 40 0.36
gb|AV556618.1|AV556618 AV556618 Arabidopsis thaliana green ... 40 0.36
gb|AV559179.1|AV559179 AV559179 Arabidopsis thaliana green ... 40 0.36
gb|AV559182.1|AV559182 AV559182 Arabidopsis thaliana green ... 40 0.36
gb|AV560195.1|AV560195 AV560195 Arabidopsis thaliana green ... 40 0.36
gb|AV563443.1|AV563443 AV563443 Arabidopsis thaliana green ... 40 0.36
gb|AV564567.1|AV564567 AV564567 Arabidopsis thaliana green ... 40 0.36
gb|AV564942.1|AV564942 AV564942 Arabidopsis thaliana green ... 40 0.36
gb|BP588013.1|BP588013 BP588013 RAFL15 Arabidopsis thaliana... 40 0.36
gb|BP593146.1|BP593146 BP593146 RAFL15 Arabidopsis thaliana... 40 0.36
gb|BP593699.1|BP593699 BP593699 RAFL15 Arabidopsis thaliana... 40 0.36
gb|BP594393.1|BP594393 BP594393 RAFL15 Arabidopsis thaliana... 40 0.36
gb|BP595630.1|BP595630 BP595630 RAFL15 Arabidopsis thaliana... 40 0.36
gb|BP595768.1|BP595768 BP595768 RAFL15 Arabidopsis thaliana... 40 0.36
gb|BT002919.1| Arabidopsis thaliana clone RAFL15-04-D21 (R2... 40 0.36
gb|BT005152.1| Arabidopsis thaliana clone U20177 putative l... 40 0.36
emb|AL163812.1|ATF14F18 Arabidopsis thaliana DNA chromosome... 40 0.36
emb|CS130513.1| Sequence 31 from Patent WO2005063995 40 0.36
ref|NM_124184.2| Arabidopsis thaliana copper ion binding AT... 40 0.36
>emb|BX842419.1|CNS0A7PD Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTSIL2ZD01 of Silique of strain col-0 of Arabidopsis
thaliana (thale cress)
Length = 510
Score = 56.0 bits (28), Expect = 6e-006
Identities = 55/64 (85%)
Strand = Plus / Minus
Query: 376 tggcaatgcatgaaccaaaccccggggttgtcggcgaggaagcggatggccacccatccg 435
||||||||||| | ||| || ||||| || ||||| |||||||||||||| ||||||||
Sbjct: 183 tggcaatgcatcacccacacaccgggattatcggcaaggaagcggatggcgacccatcca 124
Query: 436 ccgg 439
||||
Sbjct: 123 ccgg 120
>emb|BX822041.1|CNS0AAEO Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTSIL94ZA07 of Silique of strain col-0 of Arabidopsis
thaliana (thale cress)
Length = 498
Score = 56.0 bits (28), Expect = 6e-006
Identities = 55/64 (85%)
Strand = Plus / Minus
Query: 376 tggcaatgcatgaaccaaaccccggggttgtcggcgaggaagcggatggccacccatccg 435
||||||||||| | ||| || ||||| || ||||| |||||||||||||| ||||||||
Sbjct: 89 tggcaatgcatcagccacacaccgggattatcggcaaggaagcggatggcgacccatcca 30
Query: 436 ccgg 439
||||
Sbjct: 29 ccgg 26
>ref|NM_128470.3| Arabidopsis thaliana copper ion binding AT2G29130 mRNA, complete cds
Length = 2022
Score = 56.0 bits (28), Expect = 6e-006
Identities = 55/64 (85%)
Strand = Plus / Minus
Query: 376 tggcaatgcatgaaccaaaccccggggttgtcggcgaggaagcggatggccacccatccg 435
||||||||||| | ||| || ||||| || ||||| |||||||||||||| ||||||||
Sbjct: 1613 tggcaatgcatcagccacacaccgggattatcggcaaggaagcggatggcgacccatcca 1554
Query: 436 ccgg 439
||||
Sbjct: 1553 ccgg 1550
>gb|B28556.1|B28556 T13C14TR TAMU Arabidopsis thaliana genomic clone T13C14, DNA
sequence
Length = 437
Score = 54.0 bits (27), Expect = 2e-005
Identities = 42/47 (89%)
Strand = Plus / Minus
Query: 352 ccccatgttgtgtgcgcctccaaatggcaatgcatgaaccaaacccc 398
||||||||||| || |||| |||||||||||||| |||||||||||
Sbjct: 367 ccccatgttgtatgtacctctaaatggcaatgcataaaccaaacccc 321
>gb|BZ382558.1|BZ382558 SALK_118473.54.40.x Arabidopsis thaliana TDNA insertion lines
Arabidopsis thaliana genomic clone SALK_118473.54.40.x,
DNA sequence
Length = 439
Score = 54.0 bits (27), Expect = 2e-005
Identities = 42/47 (89%)
Strand = Plus / Minus
Query: 352 ccccatgttgtgtgcgcctccaaatggcaatgcatgaaccaaacccc 398
||||||||||| || |||| |||||||||||||| |||||||||||
Sbjct: 386 ccccatgttgtatgtacctctaaatggcaatgcataaaccaaacccc 340
>gb|AV561049.1|AV561049 AV561049 Arabidopsis thaliana green siliques Columbia Arabidopsis
thaliana cDNA clone SQ145a12F 3', mRNA sequence
Length = 404
Score = 54.0 bits (27), Expect = 2e-005
Identities = 51/59 (86%)
Strand = Plus / Plus
Query: 376 tggcaatgcatgaaccaaaccccggggttgtcggcgaggaagcggatggccacccatcc 434
||||||||||| | ||| || ||||| || ||||| |||||||||||||| ||||||||
Sbjct: 343 tggcaatgcatcagccacacaccgggattatcggcaaggaagcggatggcgacccatcc 401
>gb|AV563756.1|AV563756 AV563756 Arabidopsis thaliana green siliques Columbia Arabidopsis
thaliana cDNA clone SQ192g09F 3', mRNA sequence
Length = 394
Score = 54.0 bits (27), Expect = 2e-005
Identities = 51/59 (86%)
Strand = Plus / Plus
Query: 376 tggcaatgcatgaaccaaaccccggggttgtcggcgaggaagcggatggccacccatcc 434
||||||||||| | ||| || ||||| || ||||| |||||||||||||| ||||||||
Sbjct: 332 tggcaatgcatcagccacacaccgggattatcggcaaggaagcggatggcgacccatcc 390
>gb|BP787187.1|BP787187 BP787187 RAFL7 Arabidopsis thaliana cDNA clone RAFL26-03-F10 3',
mRNA sequence
Length = 423
Score = 54.0 bits (27), Expect = 2e-005
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 352 ccccatgttgtgtgcgcctccaaatggcaatgcatgaaccaaacccc 398
||||||||||| || |||| |||||||||||||| |||||||||||
Sbjct: 201 ccccatgttgtatgtacctctaaatggcaatgcataaaccaaacccc 247
>emb|AL807518.1| Arabidopsis thaliana transposon insertion STS SM_3.20902, sequence
tagged site
Length = 439
Score = 54.0 bits (27), Expect = 2e-005
Identities = 42/47 (89%)
Strand = Plus / Minus
Query: 352 ccccatgttgtgtgcgcctccaaatggcaatgcatgaaccaaacccc 398
||||||||||| || |||| |||||||||||||| |||||||||||
Sbjct: 306 ccccatgttgtatgtacctctaaatggcaatgcataaaccaaacccc 260
>emb|AL807557.1| Arabidopsis thaliana transposon insertion STS SM_3.20891, sequence
tagged site
Length = 445
Score = 54.0 bits (27), Expect = 2e-005
Identities = 42/47 (89%)
Strand = Plus / Minus
Query: 352 ccccatgttgtgtgcgcctccaaatggcaatgcatgaaccaaacccc 398
||||||||||| || |||| |||||||||||||| |||||||||||
Sbjct: 306 ccccatgttgtatgtacctctaaatggcaatgcataaaccaaacccc 260
>emb|BX295241.1| Arabidopsis thaliana transposon insertion STS SM_3.5243, sequence
tagged site
Length = 309
Score = 54.0 bits (27), Expect = 2e-005
Identities = 42/47 (89%)
Strand = Plus / Minus
Query: 352 ccccatgttgtgtgcgcctccaaatggcaatgcatgaaccaaacccc 398
||||||||||| || |||| |||||||||||||| |||||||||||
Sbjct: 299 ccccatgttgtatgtacctctaaatggcaatgcataaaccaaacccc 253
>gb|BT014855.1| Arabidopsis thaliana At5g01190 gene, complete cds
Length = 1677
Score = 54.0 bits (27), Expect = 2e-005
Identities = 42/47 (89%)
Strand = Plus / Minus
Query: 352 ccccatgttgtgtgcgcctccaaatggcaatgcatgaaccaaacccc 398
||||||||||| || |||| |||||||||||||| |||||||||||
Sbjct: 1592 ccccatgttgtatgtacctctaaatggcaatgcataaaccaaacccc 1546
>dbj|BA000015.5| Arabidopsis thaliana DNA, chromosome 5, complete sequence
Length = 23810767
Score = 54.0 bits (27), Expect = 2e-005
Identities = 42/47 (89%)
Strand = Plus / Minus
Query: 352 ccccatgttgtgtgcgcctccaaatggcaatgcatgaaccaaacccc 398
||||||||||| || |||| |||||||||||||| |||||||||||
Sbjct: 74083 ccccatgttgtatgtacctctaaatggcaatgcataaaccaaacccc 74037
Score = 40.1 bits (20), Expect = 0.36
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 153 aaattgcaattggcaatgaa 172
||||||||||||||||||||
Sbjct: 3660515 aaattgcaattggcaatgaa 3660534
>emb|AL137189.2|ATF7J8 Arabidopsis thaliana DNA chromosome 5, BAC clone F7J8 (ESSA project)
Length = 118507
Score = 54.0 bits (27), Expect = 2e-005
Identities = 42/47 (89%)
Strand = Plus / Minus
Query: 352 ccccatgttgtgtgcgcctccaaatggcaatgcatgaaccaaacccc 398
||||||||||| || |||| |||||||||||||| |||||||||||
Sbjct: 69944 ccccatgttgtatgtacctctaaatggcaatgcataaaccaaacccc 69898
>ref|NM_120197.3| Arabidopsis thaliana copper ion binding AT5G01190 mRNA, complete cds
Length = 1821
Score = 54.0 bits (27), Expect = 2e-005
Identities = 42/47 (89%)
Strand = Plus / Minus
Query: 352 ccccatgttgtgtgcgcctccaaatggcaatgcatgaaccaaacccc 398
||||||||||| || |||| |||||||||||||| |||||||||||
Sbjct: 1592 ccccatgttgtatgtacctctaaatggcaatgcataaaccaaacccc 1546
>ref|NC_003076.4| Arabidopsis thaliana chromosome 5, complete sequence
Length = 26992728
Score = 54.0 bits (27), Expect = 2e-005
Identities = 42/47 (89%)
Strand = Plus / Minus
Query: 352 ccccatgttgtgtgcgcctccaaatggcaatgcatgaaccaaacccc 398
||||||||||| || |||| |||||||||||||| |||||||||||
Sbjct: 74526 ccccatgttgtatgtacctctaaatggcaatgcataaaccaaacccc 74480
Score = 40.1 bits (20), Expect = 0.36
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 153 aaattgcaattggcaatgaa 172
||||||||||||||||||||
Sbjct: 3847546 aaattgcaattggcaatgaa 3847565
>gb|AI998334.1|AI998334 701545291 A. thaliana, Columbia Col-0, rosette-2 Arabidopsis
thaliana cDNA clone 701545291, mRNA sequence
Length = 483
Score = 52.0 bits (26), Expect = 9e-005
Identities = 32/34 (94%)
Strand = Plus / Plus
Query: 368 cctccaaatggcaatgcatgaaccaaaccccggg 401
||||||| || |||||||||||||||||||||||
Sbjct: 366 cctccaagtgacaatgcatgaaccaaaccccggg 399
>gb|AV787312.1|AV787312 AV787312 RAFL6 Arabidopsis thaliana cDNA clone RAFL06-74-P20 3',
mRNA sequence
Length = 401
Score = 52.0 bits (26), Expect = 9e-005
Identities = 32/34 (94%)
Strand = Plus / Plus
Query: 368 cctccaaatggcaatgcatgaaccaaaccccggg 401
||||||| || |||||||||||||||||||||||
Sbjct: 300 cctccaagtgacaatgcatgaaccaaaccccggg 333
>gb|AV792270.1|AV792270 AV792270 RAFL7 Arabidopsis thaliana cDNA clone RAFL07-14-E01 3',
mRNA sequence
Length = 416
Score = 52.0 bits (26), Expect = 9e-005
Identities = 32/34 (94%)
Strand = Plus / Plus
Query: 368 cctccaaatggcaatgcatgaaccaaaccccggg 401
||||||| || |||||||||||||||||||||||
Sbjct: 280 cctccaagtgacaatgcatgaaccaaaccccggg 313
>gb|AV815278.1|AV815278 AV815278 RAFL9 Arabidopsis thaliana cDNA clone RAFL09-86-B19 3',
mRNA sequence
Length = 412
Score = 52.0 bits (26), Expect = 9e-005
Identities = 32/34 (94%)
Strand = Plus / Plus
Query: 368 cctccaaatggcaatgcatgaaccaaaccccggg 401
||||||| || |||||||||||||||||||||||
Sbjct: 303 cctccaagtgacaatgcatgaaccaaaccccggg 336
>gb|AV816241.1|AV816241 AV816241 RAFL9 Arabidopsis thaliana cDNA clone RAFL09-89-O09 3',
mRNA sequence
Length = 448
Score = 52.0 bits (26), Expect = 9e-005
Identities = 32/34 (94%)
Strand = Plus / Plus
Query: 368 cctccaaatggcaatgcatgaaccaaaccccggg 401
||||||| || |||||||||||||||||||||||
Sbjct: 346 cctccaagtgacaatgcatgaaccaaaccccggg 379
>gb|AV532135.1|AV532135 AV532135 Arabidopsis thaliana flower buds Columbia Arabidopsis
thaliana cDNA clone FB036d04F 3', mRNA sequence
Length = 559
Score = 52.0 bits (26), Expect = 9e-005
Identities = 32/34 (94%)
Strand = Plus / Plus
Query: 368 cctccaaatggcaatgcatgaaccaaaccccggg 401
||||||| || |||||||||||||||||||||||
Sbjct: 299 cctccaagtgacaatgcatgaaccaaaccccggg 332
>gb|AV540676.1|AV540676 AV540676 Arabidopsis thaliana roots Columbia Arabidopsis thaliana
cDNA clone RZ153f04F 3', mRNA sequence
Length = 537
Score = 52.0 bits (26), Expect = 9e-005
Identities = 32/34 (94%)
Strand = Plus / Plus
Query: 368 cctccaaatggcaatgcatgaaccaaaccccggg 401
||||||| || |||||||||||||||||||||||
Sbjct: 307 cctccaagtgacaatgcatgaaccaaaccccggg 340
>gb|BP792246.1|BP792246 BP792246 RAFL7 Arabidopsis thaliana cDNA clone RAFL07-51-B21 3',
mRNA sequence
Length = 379
Score = 52.0 bits (26), Expect = 9e-005
Identities = 32/34 (94%)
Strand = Plus / Plus
Query: 368 cctccaaatggcaatgcatgaaccaaaccccggg 401
||||||| || |||||||||||||||||||||||
Sbjct: 325 cctccaagtgacaatgcatgaaccaaaccccggg 358
>gb|AY052669.1| Arabidopsis thaliana At2g38080/T8P21. mRNA, complete cds
Length = 1891
Score = 52.0 bits (26), Expect = 9e-005
Identities = 32/34 (94%)
Strand = Plus / Minus
Query: 368 cctccaaatggcaatgcatgaaccaaaccccggg 401
||||||| || |||||||||||||||||||||||
Sbjct: 1592 cctccaagtgacaatgcatgaaccaaaccccggg 1559
>gb|AY063730.1| Arabidopsis thaliana At2g38080/T8P21. mRNA, complete cds
Length = 1677
Score = 52.0 bits (26), Expect = 9e-005
Identities = 32/34 (94%)
Strand = Plus / Minus
Query: 368 cctccaaatggcaatgcatgaaccaaaccccggg 401
||||||| || |||||||||||||||||||||||
Sbjct: 1576 cctccaagtgacaatgcatgaaccaaaccccggg 1543
>gb|AY065187.1| Arabidopsis thaliana putative diphenol oxidase (At2g38080; F16M14.1)
mRNA, complete cds
Length = 1937
Score = 52.0 bits (26), Expect = 9e-005
Identities = 32/34 (94%)
Strand = Plus / Minus
Query: 368 cctccaaatggcaatgcatgaaccaaaccccggg 401
||||||| || |||||||||||||||||||||||
Sbjct: 1658 cctccaagtgacaatgcatgaaccaaaccccggg 1625
>gb|AY114636.1| Arabidopsis thaliana putative diphenol oxidase (At2g38080) mRNA,
complete cds
Length = 1759
Score = 52.0 bits (26), Expect = 9e-005
Identities = 32/34 (94%)
Strand = Plus / Minus
Query: 368 cctccaaatggcaatgcatgaaccaaaccccggg 401
||||||| || |||||||||||||||||||||||
Sbjct: 1576 cctccaagtgacaatgcatgaaccaaaccccggg 1543
>emb|BX819300.1|CNS0A9ZV Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTFB66ZE03 of Flowers and buds of strain col-0 of
Arabidopsis thaliana (thale cress)
Length = 1967
Score = 52.0 bits (26), Expect = 9e-005
Identities = 32/34 (94%)
Strand = Plus / Minus
Query: 368 cctccaaatggcaatgcatgaaccaaaccccggg 401
||||||| || |||||||||||||||||||||||
Sbjct: 1646 cctccaagtgacaatgcatgaaccaaaccccggg 1613
>emb|BX821553.1|CNS0AA40 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTSIL52ZF06 of Silique of strain col-0 of Arabidopsis
thaliana (thale cress)
Length = 611
Score = 52.0 bits (26), Expect = 9e-005
Identities = 32/34 (94%)
Strand = Plus / Minus
Query: 368 cctccaaatggcaatgcatgaaccaaaccccggg 401
||||||| || |||||||||||||||||||||||
Sbjct: 286 cctccaagtgacaatgcatgaaccaaaccccggg 253
>ref|NM_129364.2| Arabidopsis thaliana IRX12; copper ion binding AT2G38080 (IRX12)
mRNA, complete cds
Length = 2019
Score = 52.0 bits (26), Expect = 9e-005
Identities = 32/34 (94%)
Strand = Plus / Minus
Query: 368 cctccaaatggcaatgcatgaaccaaaccccggg 401
||||||| || |||||||||||||||||||||||
Sbjct: 1654 cctccaagtgacaatgcatgaaccaaaccccggg 1621
>ref|NM_125281.1| Arabidopsis thaliana copper ion binding AT5G58910 mRNA, complete cds
Length = 1572
Score = 48.1 bits (24), Expect = 0.001
Identities = 39/44 (88%)
Strand = Plus / Minus
Query: 369 ctccaaatggcaatgcatgaaccaaaccccggggttgtcggcga 412
|||||| || |||||||||||||| ||||| || ||||||||||
Sbjct: 1470 ctccaagtgacaatgcatgaaccatacccctggattgtcggcga 1427
>gb|AV800583.1|AV800583 AV800583 RAFL9 Arabidopsis thaliana cDNA clone RAFL09-24-L13 3',
mRNA sequence
Length = 414
Score = 46.1 bits (23), Expect = 0.006
Identities = 29/31 (93%)
Strand = Plus / Plus
Query: 368 cctccaaatggcaatgcatgaaccaaacccc 398
||||||| || ||||||||||||||||||||
Sbjct: 345 cctccaagtgacaatgcatgaaccaaacccc 375
>gb|AC003028.3| Arabidopsis thaliana chromosome 2 clone F16M14 map ve018, complete
sequence
Length = 115359
Score = 46.1 bits (23), Expect = 0.006
Identities = 29/31 (93%)
Strand = Plus / Minus
Query: 368 cctccaaatggcaatgcatgaaccaaacccc 398
||||||| || ||||||||||||||||||||
Sbjct: 4978 cctccaagtgacaatgcatgaaccaaacccc 4948
>gb|AC005315.3| Arabidopsis thaliana chromosome 2 clone T9I4 map mi54, complete sequence
Length = 108393
Score = 46.1 bits (23), Expect = 0.006
Identities = 38/43 (88%)
Strand = Plus / Plus
Query: 397 ccggggttgtcggcgaggaagcggatggccacccatccgccgg 439
||||| || ||||| |||||||||||||| |||||||| ||||
Sbjct: 105209 ccgggattatcggcaaggaagcggatggcgacccatccaccgg 105251
>emb|CR379253.1| Arabidopsis thaliana transposon insertion STS GT_5.108674, sequence
tagged site
Length = 394
Score = 46.1 bits (23), Expect = 0.006
Identities = 38/43 (88%)
Strand = Plus / Minus
Query: 397 ccggggttgtcggcgaggaagcggatggccacccatccgccgg 439
||||| || ||||| |||||||||||||| |||||||| ||||
Sbjct: 373 ccgggattatcggcaaggaagcggatggcgacccatccaccgg 331
>ref|NC_003071.3| Arabidopsis thaliana chromosome 2, complete sequence
Length = 19705359
Score = 46.1 bits (23), Expect = 0.006
Identities = 29/31 (93%)
Strand = Plus / Minus
Query: 368 cctccaaatggcaatgcatgaaccaaacccc 398
||||||| || ||||||||||||||||||||
Sbjct: 15944329 cctccaagtgacaatgcatgaaccaaacccc 15944299
Score = 46.1 bits (23), Expect = 0.006
Identities = 38/43 (88%)
Strand = Plus / Plus
Query: 397 ccggggttgtcggcgaggaagcggatggccacccatccgccgg 439
||||| || ||||| |||||||||||||| |||||||| ||||
Sbjct: 12532550 ccgggattatcggcaaggaagcggatggcgacccatccaccgg 12532592
>gb|AV787178.1|AV787178 AV787178 RAFL6 Arabidopsis thaliana cDNA clone RAFL06-74-H07 3',
mRNA sequence
Length = 400
Score = 44.1 bits (22), Expect = 0.023
Identities = 28/30 (93%)
Strand = Plus / Plus
Query: 368 cctccaaatggcaatgcatgaaccaaaccc 397
||||||| || |||||||||||||||||||
Sbjct: 299 cctccaagtgacaatgcatgaaccaaaccc 328
>gb|BE521176.1|BE521176 M18A3XTM Arabidopsis developing seed Arabidopsis thaliana cDNA
clone M18A3 3', mRNA sequence
Length = 393
Score = 40.1 bits (20), Expect = 0.36
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 382 tgcatgaaccaaaccccggg 401
||||||||||||||||||||
Sbjct: 236 tgcatgaaccaaaccccggg 255
>gb|BE521178.1|BE521178 M18A4XP Arabidopsis developing seed Arabidopsis thaliana cDNA clone
M18A4 3', mRNA sequence
Length = 443
Score = 40.1 bits (20), Expect = 0.36
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 382 tgcatgaaccaaaccccggg 401
||||||||||||||||||||
Sbjct: 250 tgcatgaaccaaaccccggg 269
>gb|BE521179.1|BE521179 M18A4XTM Arabidopsis developing seed Arabidopsis thaliana cDNA
clone M18A4 3', mRNA sequence
Length = 324
Score = 40.1 bits (20), Expect = 0.36
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 382 tgcatgaaccaaaccccggg 401
||||||||||||||||||||
Sbjct: 250 tgcatgaaccaaaccccggg 269
>gb|AU227405.1|AU227405 AU227405 RAFL15 Arabidopsis thaliana cDNA clone RAFL15-04-D21 3',
mRNA sequence
Length = 449
Score = 40.1 bits (20), Expect = 0.36
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 382 tgcatgaaccaaaccccggg 401
||||||||||||||||||||
Sbjct: 237 tgcatgaaccaaaccccggg 256
>gb|AV555534.1|AV555534 AV555534 Arabidopsis thaliana green siliques Columbia Arabidopsis
thaliana cDNA clone SQ017e04F 3', mRNA sequence
Length = 568
Score = 40.1 bits (20), Expect = 0.36
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 382 tgcatgaaccaaaccccggg 401
||||||||||||||||||||
Sbjct: 325 tgcatgaaccaaaccccggg 344
>gb|AV556399.1|AV556399 AV556399 Arabidopsis thaliana green siliques Columbia Arabidopsis
thaliana cDNA clone SQ042a09F 3', mRNA sequence
Length = 369
Score = 40.1 bits (20), Expect = 0.36
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 382 tgcatgaaccaaaccccggg 401
||||||||||||||||||||
Sbjct: 250 tgcatgaaccaaaccccggg 269
>gb|AV556618.1|AV556618 AV556618 Arabidopsis thaliana green siliques Columbia Arabidopsis
thaliana cDNA clone SQ048a01F 3', mRNA sequence
Length = 321
Score = 40.1 bits (20), Expect = 0.36
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 382 tgcatgaaccaaaccccggg 401
||||||||||||||||||||
Sbjct: 187 tgcatgaaccaaaccccggg 206
>gb|AV559179.1|AV559179 AV559179 Arabidopsis thaliana green siliques Columbia Arabidopsis
thaliana cDNA clone SQ112f05F 3', mRNA sequence
Length = 561
Score = 40.1 bits (20), Expect = 0.36
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 382 tgcatgaaccaaaccccggg 401
||||||||||||||||||||
Sbjct: 236 tgcatgaaccaaaccccggg 255
>gb|AV559182.1|AV559182 AV559182 Arabidopsis thaliana green siliques Columbia Arabidopsis
thaliana cDNA clone SQ112f08F 3', mRNA sequence
Length = 593
Score = 40.1 bits (20), Expect = 0.36
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 382 tgcatgaaccaaaccccggg 401
||||||||||||||||||||
Sbjct: 291 tgcatgaaccaaaccccggg 310
>gb|AV560195.1|AV560195 AV560195 Arabidopsis thaliana green siliques Columbia Arabidopsis
thaliana cDNA clone SQ130h04F 3', mRNA sequence
Length = 487
Score = 40.1 bits (20), Expect = 0.36
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 382 tgcatgaaccaaaccccggg 401
||||||||||||||||||||
Sbjct: 236 tgcatgaaccaaaccccggg 255
>gb|AV563443.1|AV563443 AV563443 Arabidopsis thaliana green siliques Columbia Arabidopsis
thaliana cDNA clone SQ187d07F 3', mRNA sequence
Length = 518
Score = 40.1 bits (20), Expect = 0.36
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 382 tgcatgaaccaaaccccggg 401
||||||||||||||||||||
Sbjct: 216 tgcatgaaccaaaccccggg 235
>gb|AV564567.1|AV564567 AV564567 Arabidopsis thaliana green siliques Columbia Arabidopsis
thaliana cDNA clone SQ206e05F 3', mRNA sequence
Length = 436
Score = 40.1 bits (20), Expect = 0.36
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 382 tgcatgaaccaaaccccggg 401
||||||||||||||||||||
Sbjct: 236 tgcatgaaccaaaccccggg 255
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 229,410
Number of Sequences: 1013581
Number of extensions: 229410
Number of successful extensions: 17086
Number of sequences better than 0.5: 62
Number of HSP's better than 0.5 without gapping: 63
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 16647
Number of HSP's gapped (non-prelim): 439
length of query: 509
length of database: 908,940,872
effective HSP length: 20
effective length of query: 489
effective length of database: 888,669,252
effective search space: 434559264228
effective search space used: 434559264228
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)