BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 8228841.2.1
         (621 letters)

Database: At_nucl_with_EST.fasta 
           1,013,581 sequences; 908,940,872 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|CL506354.1|CL506354  SAIL_765_F11.v1 SAIL Collection Arab...    46   0.007
gb|CL515693.1|CL515693  SAIL_903_F03.v1 SAIL Collection Arab...    46   0.007
gb|BP649344.1|BP649344  BP649344 RAFL19 Arabidopsis thaliana...    46   0.007
gb|BP785598.1|BP785598  BP785598 RAFL7 Arabidopsis thaliana ...    46   0.007
gb|BT010611.1|  Arabidopsis thaliana At5g36890 gene, complet...    46   0.007
dbj|AB016877.1|  Arabidopsis thaliana genomic DNA, chromosom...    46   0.007
dbj|AK175760.1|  Arabidopsis thaliana mRNA for beta-glucosid...    46   0.007
ref|NM_123047.2|  Arabidopsis thaliana hydrolase, hydrolyzin...    46   0.007
ref|NM_001036898.1|  Arabidopsis thaliana hydrolase, hydroly...    46   0.007
ref|NC_003076.4|  Arabidopsis thaliana chromosome 5, complet...    46   0.007
>gb|CL506354.1|CL506354 SAIL_765_F11.v1 SAIL Collection Arabidopsis thaliana genomic clone
           SAIL_765_F11.v1, DNA sequence
          Length = 939

 Score = 46.1 bits (23), Expect = 0.007
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 255 tggtctctgctggacaacttcgagtgg 281
           ||||| |||||||||||||||||||||
Sbjct: 444 tggtcgctgctggacaacttcgagtgg 418
>gb|CL515693.1|CL515693 SAIL_903_F03.v1 SAIL Collection Arabidopsis thaliana genomic clone
           SAIL_903_F03.v1, DNA sequence
          Length = 907

 Score = 46.1 bits (23), Expect = 0.007
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 255 tggtctctgctggacaacttcgagtgg 281
           ||||| |||||||||||||||||||||
Sbjct: 740 tggtcgctgctggacaacttcgagtgg 714
>gb|BP649344.1|BP649344 BP649344 RAFL19 Arabidopsis thaliana cDNA clone RAFL19-13-E11 3',
           mRNA sequence
          Length = 362

 Score = 46.1 bits (23), Expect = 0.007
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 255 tggtctctgctggacaacttcgagtgg 281
           ||||| |||||||||||||||||||||
Sbjct: 297 tggtcgctgctggacaacttcgagtgg 271
>gb|BP785598.1|BP785598 BP785598 RAFL7 Arabidopsis thaliana cDNA clone RAFL07-95-I24 3',
           mRNA sequence
          Length = 406

 Score = 46.1 bits (23), Expect = 0.007
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 255 tggtctctgctggacaacttcgagtgg 281
           ||||| |||||||||||||||||||||
Sbjct: 333 tggtcgctgctggacaacttcgagtgg 307
>gb|BT010611.1| Arabidopsis thaliana At5g36890 gene, complete cds
          Length = 1473

 Score = 46.1 bits (23), Expect = 0.007
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                       
Query: 255  tggtctctgctggacaacttcgagtgg 281
            ||||| |||||||||||||||||||||
Sbjct: 1309 tggtcgctgctggacaacttcgagtgg 1335
>dbj|AB016877.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MLF18
          Length = 74842

 Score = 46.1 bits (23), Expect = 0.007
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 255  tggtctctgctggacaacttcgagtgg 281
            ||||| |||||||||||||||||||||
Sbjct: 2046 tggtcgctgctggacaacttcgagtgg 2020
>dbj|AK175760.1| Arabidopsis thaliana mRNA for beta-glucosidase -like protein,
            complete cds, clone: RAFL22-32-D12
          Length = 1760

 Score = 46.1 bits (23), Expect = 0.007
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                       
Query: 255  tggtctctgctggacaacttcgagtgg 281
            ||||| |||||||||||||||||||||
Sbjct: 1449 tggtcgctgctggacaacttcgagtgg 1475
>ref|NM_123047.2| Arabidopsis thaliana hydrolase, hydrolyzing O-glycosyl compounds
            AT5G36890 transcript variant AT5G36890.1 mRNA, complete
            cds
          Length = 1473

 Score = 46.1 bits (23), Expect = 0.007
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                       
Query: 255  tggtctctgctggacaacttcgagtgg 281
            ||||| |||||||||||||||||||||
Sbjct: 1309 tggtcgctgctggacaacttcgagtgg 1335
>ref|NM_001036898.1| Arabidopsis thaliana hydrolase, hydrolyzing O-glycosyl compounds
            AT5G36890 transcript variant AT5G36890.2 mRNA, complete
            cds
          Length = 1780

 Score = 46.1 bits (23), Expect = 0.007
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                       
Query: 255  tggtctctgctggacaacttcgagtgg 281
            ||||| |||||||||||||||||||||
Sbjct: 1448 tggtcgctgctggacaacttcgagtgg 1474
>ref|NC_003076.4| Arabidopsis thaliana chromosome 5, complete sequence
          Length = 26992728

 Score = 46.1 bits (23), Expect = 0.007
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                           
Query: 255      tggtctctgctggacaacttcgagtgg 281
                ||||| |||||||||||||||||||||
Sbjct: 14559558 tggtcgctgctggacaacttcgagtgg 14559532
  Database: At_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:09 PM
  Number of letters in database: 908,940,872
  Number of sequences in database:  1,013,581
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 326,270
Number of Sequences: 1013581
Number of extensions: 326270
Number of successful extensions: 25765
Number of sequences better than  0.5: 10
Number of HSP's better than  0.5 without gapping: 10
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 25605
Number of HSP's gapped (non-prelim): 160
length of query: 621
length of database: 908,940,872
effective HSP length: 20
effective length of query: 601
effective length of database: 888,669,252
effective search space: 534090220452
effective search space used: 534090220452
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)