BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 8228841.2.1
(621 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CL506354.1|CL506354 SAIL_765_F11.v1 SAIL Collection Arab... 46 0.007
gb|CL515693.1|CL515693 SAIL_903_F03.v1 SAIL Collection Arab... 46 0.007
gb|BP649344.1|BP649344 BP649344 RAFL19 Arabidopsis thaliana... 46 0.007
gb|BP785598.1|BP785598 BP785598 RAFL7 Arabidopsis thaliana ... 46 0.007
gb|BT010611.1| Arabidopsis thaliana At5g36890 gene, complet... 46 0.007
dbj|AB016877.1| Arabidopsis thaliana genomic DNA, chromosom... 46 0.007
dbj|AK175760.1| Arabidopsis thaliana mRNA for beta-glucosid... 46 0.007
ref|NM_123047.2| Arabidopsis thaliana hydrolase, hydrolyzin... 46 0.007
ref|NM_001036898.1| Arabidopsis thaliana hydrolase, hydroly... 46 0.007
ref|NC_003076.4| Arabidopsis thaliana chromosome 5, complet... 46 0.007
>gb|CL506354.1|CL506354 SAIL_765_F11.v1 SAIL Collection Arabidopsis thaliana genomic clone
SAIL_765_F11.v1, DNA sequence
Length = 939
Score = 46.1 bits (23), Expect = 0.007
Identities = 26/27 (96%)
Strand = Plus / Minus
Query: 255 tggtctctgctggacaacttcgagtgg 281
||||| |||||||||||||||||||||
Sbjct: 444 tggtcgctgctggacaacttcgagtgg 418
>gb|CL515693.1|CL515693 SAIL_903_F03.v1 SAIL Collection Arabidopsis thaliana genomic clone
SAIL_903_F03.v1, DNA sequence
Length = 907
Score = 46.1 bits (23), Expect = 0.007
Identities = 26/27 (96%)
Strand = Plus / Minus
Query: 255 tggtctctgctggacaacttcgagtgg 281
||||| |||||||||||||||||||||
Sbjct: 740 tggtcgctgctggacaacttcgagtgg 714
>gb|BP649344.1|BP649344 BP649344 RAFL19 Arabidopsis thaliana cDNA clone RAFL19-13-E11 3',
mRNA sequence
Length = 362
Score = 46.1 bits (23), Expect = 0.007
Identities = 26/27 (96%)
Strand = Plus / Minus
Query: 255 tggtctctgctggacaacttcgagtgg 281
||||| |||||||||||||||||||||
Sbjct: 297 tggtcgctgctggacaacttcgagtgg 271
>gb|BP785598.1|BP785598 BP785598 RAFL7 Arabidopsis thaliana cDNA clone RAFL07-95-I24 3',
mRNA sequence
Length = 406
Score = 46.1 bits (23), Expect = 0.007
Identities = 26/27 (96%)
Strand = Plus / Minus
Query: 255 tggtctctgctggacaacttcgagtgg 281
||||| |||||||||||||||||||||
Sbjct: 333 tggtcgctgctggacaacttcgagtgg 307
>gb|BT010611.1| Arabidopsis thaliana At5g36890 gene, complete cds
Length = 1473
Score = 46.1 bits (23), Expect = 0.007
Identities = 26/27 (96%)
Strand = Plus / Plus
Query: 255 tggtctctgctggacaacttcgagtgg 281
||||| |||||||||||||||||||||
Sbjct: 1309 tggtcgctgctggacaacttcgagtgg 1335
>dbj|AB016877.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MLF18
Length = 74842
Score = 46.1 bits (23), Expect = 0.007
Identities = 26/27 (96%)
Strand = Plus / Minus
Query: 255 tggtctctgctggacaacttcgagtgg 281
||||| |||||||||||||||||||||
Sbjct: 2046 tggtcgctgctggacaacttcgagtgg 2020
>dbj|AK175760.1| Arabidopsis thaliana mRNA for beta-glucosidase -like protein,
complete cds, clone: RAFL22-32-D12
Length = 1760
Score = 46.1 bits (23), Expect = 0.007
Identities = 26/27 (96%)
Strand = Plus / Plus
Query: 255 tggtctctgctggacaacttcgagtgg 281
||||| |||||||||||||||||||||
Sbjct: 1449 tggtcgctgctggacaacttcgagtgg 1475
>ref|NM_123047.2| Arabidopsis thaliana hydrolase, hydrolyzing O-glycosyl compounds
AT5G36890 transcript variant AT5G36890.1 mRNA, complete
cds
Length = 1473
Score = 46.1 bits (23), Expect = 0.007
Identities = 26/27 (96%)
Strand = Plus / Plus
Query: 255 tggtctctgctggacaacttcgagtgg 281
||||| |||||||||||||||||||||
Sbjct: 1309 tggtcgctgctggacaacttcgagtgg 1335
>ref|NM_001036898.1| Arabidopsis thaliana hydrolase, hydrolyzing O-glycosyl compounds
AT5G36890 transcript variant AT5G36890.2 mRNA, complete
cds
Length = 1780
Score = 46.1 bits (23), Expect = 0.007
Identities = 26/27 (96%)
Strand = Plus / Plus
Query: 255 tggtctctgctggacaacttcgagtgg 281
||||| |||||||||||||||||||||
Sbjct: 1448 tggtcgctgctggacaacttcgagtgg 1474
>ref|NC_003076.4| Arabidopsis thaliana chromosome 5, complete sequence
Length = 26992728
Score = 46.1 bits (23), Expect = 0.007
Identities = 26/27 (96%)
Strand = Plus / Minus
Query: 255 tggtctctgctggacaacttcgagtgg 281
||||| |||||||||||||||||||||
Sbjct: 14559558 tggtcgctgctggacaacttcgagtgg 14559532
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 326,270
Number of Sequences: 1013581
Number of extensions: 326270
Number of successful extensions: 25765
Number of sequences better than 0.5: 10
Number of HSP's better than 0.5 without gapping: 10
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 25605
Number of HSP's gapped (non-prelim): 160
length of query: 621
length of database: 908,940,872
effective HSP length: 20
effective length of query: 601
effective length of database: 888,669,252
effective search space: 534090220452
effective search space used: 534090220452
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)