BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 8028975.2.1
(595 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AV794513.1|AV794513 AV794513 RAFL8 Arabidopsis thaliana ... 62 1e-007
gb|CB185504.1|CB185504 EST00037 Arabidopsis Salicylic Acid ... 62 1e-007
gb|CB263392.1|CB263392 23-E8861-008-010-M05-pBl2 MPIZ-ADIS-... 62 1e-007
gb|BX835598.1|BX835598 BX835598 Arabidopsis thaliana Adult ... 62 1e-007
gb|AV554428.1|AV554428 AV554428 Arabidopsis thaliana roots ... 62 1e-007
gb|BP568279.1|BP568279 BP568279 RAFL14 Arabidopsis thaliana... 62 1e-007
gb|BP571661.1|BP571661 BP571661 RAFL14 Arabidopsis thaliana... 62 1e-007
gb|BP615816.1|BP615816 BP615816 RAFL16 Arabidopsis thaliana... 62 1e-007
gb|CB252620.1|CB252620 21-E010931-019-003-I05-T7R MPIZ-ADIS... 62 1e-007
gb|U66345.1|ATU66345 Arabidopsis thaliana calreticulin (Crt... 62 1e-007
emb|AX412381.1| Sequence 145 from Patent WO0222675 62 1e-007
emb|AX412706.1| Sequence 470 from Patent WO0222675 62 1e-007
gb|AY056320.1| Arabidopsis thaliana putative calreticulin p... 62 1e-007
emb|AX507182.1| Sequence 1877 from Patent WO0216655 62 1e-007
gb|BT002494.1| Arabidopsis thaliana calreticulin, putative ... 62 1e-007
emb|AX651751.1| Sequence 595 from Patent WO03000898 62 1e-007
emb|BX815527.1|CNS0AATS Arabidopsis thaliana Full-length cD... 62 1e-007
emb|BX815781.1|CNS0ACTU Arabidopsis thaliana Full-length cD... 62 1e-007
ref|NM_100718.2| Arabidopsis thaliana CRT3 (CALRETICULIN 3)... 62 1e-007
ref|NM_202064.1| Arabidopsis thaliana CRT3 (CALRETICULIN 3)... 62 1e-007
gb|BP570685.1|BP570685 BP570685 RAFL14 Arabidopsis thaliana... 58 2e-006
gb|BP582761.1|BP582761 BP582761 RAFL14 Arabidopsis thaliana... 48 0.002
gb|BP611859.1|BP611859 BP611859 RAFL16 Arabidopsis thaliana... 48 0.002
gb|BP648229.1|BP648229 BP648229 RAFL19 Arabidopsis thaliana... 46 0.007
gb|AA042519.1|AA042519 25112 Lambda-PRL2 Arabidopsis thalia... 44 0.027
gb|AI995267.1|AI995267 701503307 A. thaliana, Ohio State cl... 44 0.027
gb|CF651670.1|CF651670 08-L020361-066-002-P01-SP6P MPIZ-ADI... 44 0.027
gb|CF652690.1|CF652690 70-L020830-066-002-P01q-SP6P MPIZ-AD... 44 0.027
gb|AV440909.1|AV440909 AV440909 Arabidopsis thaliana above-... 44 0.027
gb|AV442120.1|AV442120 AV442120 Arabidopsis thaliana above-... 44 0.027
gb|AV520128.1|AV520128 AV520128 Arabidopsis thaliana aboveg... 44 0.027
gb|AV520395.1|AV520395 AV520395 Arabidopsis thaliana aboveg... 44 0.027
gb|U27698.1|ATU27698 Arabidopsis thaliana calreticulin (AtC... 44 0.027
gb|AE005172.1| Arabidopsis thaliana chromosome 1, top arm c... 44 0.027
gb|AY045656.1| Arabidopsis thaliana At1g09210/T12M4_8 mRNA,... 44 0.027
gb|AY059662.1| Arabidopsis thaliana At1g09210/T12M4_8 mRNA,... 44 0.027
emb|AX412271.1| Sequence 35 from Patent WO0222675 44 0.027
emb|AX505492.1| Sequence 187 from Patent WO0216655 44 0.027
gb|AY086745.1| Arabidopsis thaliana clone 27210 mRNA, compl... 44 0.027
gb|AC003114.1|T12M4 Arabidopsis thaliana chromosome 1 BAC T... 44 0.027
ref|NM_100791.2| Arabidopsis thaliana calcium ion binding A... 44 0.027
ref|NC_003070.5| Arabidopsis thaliana chromosome 1, complet... 44 0.027
gb|AV794909.1|AV794909 AV794909 RAFL8 Arabidopsis thaliana ... 42 0.11
gb|AV801404.1|AV801404 AV801404 RAFL9 Arabidopsis thaliana ... 42 0.11
gb|AV806216.1|AV806216 AV806216 RAFL9 Arabidopsis thaliana ... 42 0.11
gb|AV440373.1|AV440373 AV440373 Arabidopsis thaliana above-... 42 0.11
gb|BP621214.1|BP621214 BP621214 RAFL16 Arabidopsis thaliana... 42 0.11
gb|BP641240.1|BP641240 BP641240 RAFL19 Arabidopsis thaliana... 42 0.11
gb|BP645426.1|BP645426 BP645426 RAFL19 Arabidopsis thaliana... 42 0.11
gb|BP663488.1|BP663488 BP663488 RAFL21 Arabidopsis thaliana... 42 0.11
gb|BP812862.1|BP812862 BP812862 RAFL19 Arabidopsis thaliana... 42 0.11
gb|BP814410.1|BP814410 BP814410 RAFL19 Arabidopsis thaliana... 42 0.11
dbj|AK220714.1| Arabidopsis thaliana mRNA for calreticulin ... 42 0.11
emb|Y12496.1|ATY12496 A.thaliana regulatory DNA sequence, p... 40 0.42
emb|A79355.1| Sequence 4 from Patent WO9746692 40 0.42
gb|AC006932.8|AC006932 Genomic sequence for Arabidopsis tha... 40 0.42
>gb|AV794513.1|AV794513 AV794513 RAFL8 Arabidopsis thaliana cDNA clone RAFL08-13-D09 3',
mRNA sequence
Length = 448
Score = 61.9 bits (31), Expect = 1e-007
Identities = 64/75 (85%)
Strand = Plus / Minus
Query: 14 attgaagtatggcaggtcaaagctggttcagtttttgacaacattttgatttgcgatgac 73
||||||||||||||||| || ||||| ||| | |||||||| || ||||| |||||||||
Sbjct: 435 attgaagtatggcaggtgaaggctggctcaatctttgacaatatattgatctgcgatgac 376
Query: 74 ccagactatgcaaga 88
|| | |||||||||
Sbjct: 375 ccggcatatgcaaga 361
Score = 42.1 bits (21), Expect = 0.11
Identities = 36/41 (87%)
Strand = Plus / Minus
Query: 167 gctagagaagaagaggaagcacggagggcacgggaggaagg 207
||||||||||| |||||||| |||| |||||||| |||||
Sbjct: 282 gctagagaagatgaggaagctcggatagcacgggaagaagg 242
>gb|CB185504.1|CB185504 EST00037 Arabidopsis Salicylic Acid Subtracted Library Arabidopsis
thaliana cDNA clone SA1-G2 similar to putative
calreticulin, mRNA sequence
Length = 496
Score = 61.9 bits (31), Expect = 1e-007
Identities = 64/75 (85%)
Strand = Plus / Plus
Query: 14 attgaagtatggcaggtcaaagctggttcagtttttgacaacattttgatttgcgatgac 73
||||||||||||||||| || ||||| ||| | |||||||| || ||||| |||||||||
Sbjct: 130 attgaagtatggcaggtgaaggctggctcaatctttgacaatatattgatctgcgatgac 189
Query: 74 ccagactatgcaaga 88
|| | |||||||||
Sbjct: 190 ccggcatatgcaaga 204
>gb|CB263392.1|CB263392 23-E8861-008-010-M05-pBl2 MPIZ-ADIS-008 Arabidopsis thaliana cDNA
clone MPIZp767M0510Q 5-PRIME, mRNA sequence
Length = 510
Score = 61.9 bits (31), Expect = 1e-007
Identities = 64/75 (85%)
Strand = Plus / Plus
Query: 14 attgaagtatggcaggtcaaagctggttcagtttttgacaacattttgatttgcgatgac 73
||||||||||||||||| || ||||| ||| | |||||||| || ||||| |||||||||
Sbjct: 191 attgaagtatggcaggtgaaggctggctcaatctttgacaatatattgatctgcgatgac 250
Query: 74 ccagactatgcaaga 88
|| | |||||||||
Sbjct: 251 ccggcatatgcaaga 265
Score = 42.1 bits (21), Expect = 0.11
Identities = 36/41 (87%)
Strand = Plus / Plus
Query: 167 gctagagaagaagaggaagcacggagggcacgggaggaagg 207
||||||||||| |||||||| |||| |||||||| |||||
Sbjct: 344 gctagagaagatgaggaagctcggatagcacgggaagaagg 384
>gb|BX835598.1|BX835598 BX835598 Arabidopsis thaliana Adult vegetative tissue Col-0
Arabidopsis thaliana cDNA clone GSLTLS79ZB05 3PRIM, mRNA
sequence
Length = 605
Score = 61.9 bits (31), Expect = 1e-007
Identities = 64/75 (85%)
Strand = Plus / Minus
Query: 14 attgaagtatggcaggtcaaagctggttcagtttttgacaacattttgatttgcgatgac 73
||||||||||||||||| || ||||| ||| | |||||||| || ||||| |||||||||
Sbjct: 402 attgaagtatggcaggtgaaggctggctcaatctttgacaatatattgatctgcgatgac 343
Query: 74 ccagactatgcaaga 88
|| | |||||||||
Sbjct: 342 ccggcatatgcaaga 328
Score = 42.1 bits (21), Expect = 0.11
Identities = 36/41 (87%)
Strand = Plus / Minus
Query: 167 gctagagaagaagaggaagcacggagggcacgggaggaagg 207
||||||||||| |||||||| |||| |||||||| |||||
Sbjct: 249 gctagagaagatgaggaagctcggatagcacgggaagaagg 209
>gb|AV554428.1|AV554428 AV554428 Arabidopsis thaliana roots Columbia Arabidopsis thaliana
cDNA clone RZ90g01R 5', mRNA sequence
Length = 467
Score = 61.9 bits (31), Expect = 1e-007
Identities = 64/75 (85%)
Strand = Plus / Minus
Query: 14 attgaagtatggcaggtcaaagctggttcagtttttgacaacattttgatttgcgatgac 73
||||||||||||||||| || ||||| ||| | |||||||| || ||||| |||||||||
Sbjct: 427 attgaagtatggcaggtgaaggctggctcaatctttgacaatatattgatctgcgatgac 368
Query: 74 ccagactatgcaaga 88
|| | |||||||||
Sbjct: 367 ccggcatatgcaaga 353
Score = 42.1 bits (21), Expect = 0.11
Identities = 36/41 (87%)
Strand = Plus / Minus
Query: 167 gctagagaagaagaggaagcacggagggcacgggaggaagg 207
||||||||||| |||||||| |||| |||||||| |||||
Sbjct: 274 gctagagaagatgaggaagctcggatagcacgggaagaagg 234
>gb|BP568279.1|BP568279 BP568279 RAFL14 Arabidopsis thaliana cDNA clone RAFL14-61-H21 3',
mRNA sequence
Length = 446
Score = 61.9 bits (31), Expect = 1e-007
Identities = 64/75 (85%)
Strand = Plus / Minus
Query: 14 attgaagtatggcaggtcaaagctggttcagtttttgacaacattttgatttgcgatgac 73
||||||||||||||||| || ||||| ||| | |||||||| || ||||| |||||||||
Sbjct: 445 attgaagtatggcaggtgaaggctggctcaatctttgacaatatattgatctgcgatgac 386
Query: 74 ccagactatgcaaga 88
|| | |||||||||
Sbjct: 385 ccggcatatgcaaga 371
>gb|BP571661.1|BP571661 BP571661 RAFL14 Arabidopsis thaliana cDNA clone RAFL14-77-B20 3',
mRNA sequence
Length = 449
Score = 61.9 bits (31), Expect = 1e-007
Identities = 64/75 (85%)
Strand = Plus / Minus
Query: 14 attgaagtatggcaggtcaaagctggttcagtttttgacaacattttgatttgcgatgac 73
||||||||||||||||| || ||||| ||| | |||||||| || ||||| |||||||||
Sbjct: 427 attgaagtatggcaggtgaaggctggctcaatctttgacaatatattgatctgcgatgac 368
Query: 74 ccagactatgcaaga 88
|| | |||||||||
Sbjct: 367 ccggcatatgcaaga 353
Score = 42.1 bits (21), Expect = 0.11
Identities = 36/41 (87%)
Strand = Plus / Minus
Query: 167 gctagagaagaagaggaagcacggagggcacgggaggaagg 207
||||||||||| |||||||| |||| |||||||| |||||
Sbjct: 274 gctagagaagatgaggaagctcggatagcacgggaagaagg 234
>gb|BP615816.1|BP615816 BP615816 RAFL16 Arabidopsis thaliana cDNA clone RAFL16-17-F22 3',
mRNA sequence
Length = 433
Score = 61.9 bits (31), Expect = 1e-007
Identities = 64/75 (85%)
Strand = Plus / Minus
Query: 14 attgaagtatggcaggtcaaagctggttcagtttttgacaacattttgatttgcgatgac 73
||||||||||||||||| || ||||| ||| | |||||||| || ||||| |||||||||
Sbjct: 427 attgaagtatggcaggtgaaggctggctcaatctttgacaatatattgatctgcgatgac 368
Query: 74 ccagactatgcaaga 88
|| | |||||||||
Sbjct: 367 ccggcatatgcaaga 353
Score = 42.1 bits (21), Expect = 0.11
Identities = 36/41 (87%)
Strand = Plus / Minus
Query: 167 gctagagaagaagaggaagcacggagggcacgggaggaagg 207
||||||||||| |||||||| |||| |||||||| |||||
Sbjct: 274 gctagagaagatgaggaagctcggatagcacgggaagaagg 234
>gb|CB252620.1|CB252620 21-E010931-019-003-I05-T7R MPIZ-ADIS-019 Arabidopsis thaliana cDNA
clone MPIZp768I053Q 5-PRIME, mRNA sequence
Length = 478
Score = 61.9 bits (31), Expect = 1e-007
Identities = 64/75 (85%)
Strand = Plus / Plus
Query: 14 attgaagtatggcaggtcaaagctggttcagtttttgacaacattttgatttgcgatgac 73
||||||||||||||||| || ||||| ||| | |||||||| || ||||| |||||||||
Sbjct: 358 attgaagtatggcaggtgaaggctggctcaatctttgacaatatattgatctgcgatgac 417
Query: 74 ccagactatgcaaga 88
|| | |||||||||
Sbjct: 418 ccggcatatgcaaga 432
>gb|U66345.1|ATU66345 Arabidopsis thaliana calreticulin (Crt3) mRNA, complete cds
Length = 1424
Score = 61.9 bits (31), Expect = 1e-007
Identities = 64/75 (85%)
Strand = Plus / Plus
Query: 14 attgaagtatggcaggtcaaagctggttcagtttttgacaacattttgatttgcgatgac 73
||||||||||||||||| || ||||| ||| | |||||||| || ||||| |||||||||
Sbjct: 998 attgaagtatggcaggtgaaggctggctcaatctttgacaatatattgatctgcgatgac 1057
Query: 74 ccagactatgcaaga 88
|| | |||||||||
Sbjct: 1058 ccggcatatgcaaga 1072
Score = 42.1 bits (21), Expect = 0.11
Identities = 36/41 (87%)
Strand = Plus / Plus
Query: 167 gctagagaagaagaggaagcacggagggcacgggaggaagg 207
||||||||||| |||||||| |||| |||||||| |||||
Sbjct: 1151 gctagagaagatgaggaagctcggatagcacgggaagaagg 1191
>emb|AX412381.1| Sequence 145 from Patent WO0222675
Length = 1242
Score = 61.9 bits (31), Expect = 1e-007
Identities = 64/75 (85%)
Strand = Plus / Plus
Query: 14 attgaagtatggcaggtcaaagctggttcagtttttgacaacattttgatttgcgatgac 73
||||||||||||||||| || ||||| ||| | |||||||| || ||||| |||||||||
Sbjct: 901 attgaagtatggcaggtgaaggctggctcaatctttgacaatatattgatctgcgatgac 960
Query: 74 ccagactatgcaaga 88
|| | |||||||||
Sbjct: 961 ccggcatatgcaaga 975
Score = 42.1 bits (21), Expect = 0.11
Identities = 36/41 (87%)
Strand = Plus / Plus
Query: 167 gctagagaagaagaggaagcacggagggcacgggaggaagg 207
||||||||||| |||||||| |||| |||||||| |||||
Sbjct: 1054 gctagagaagatgaggaagctcggatagcacgggaagaagg 1094
>emb|AX412706.1| Sequence 470 from Patent WO0222675
Length = 1242
Score = 61.9 bits (31), Expect = 1e-007
Identities = 64/75 (85%)
Strand = Plus / Plus
Query: 14 attgaagtatggcaggtcaaagctggttcagtttttgacaacattttgatttgcgatgac 73
||||||||||||||||| || ||||| ||| | |||||||| || ||||| |||||||||
Sbjct: 901 attgaagtatggcaggtgaaggctggctcaatctttgacaatatattgatctgcgatgac 960
Query: 74 ccagactatgcaaga 88
|| | |||||||||
Sbjct: 961 ccggcatatgcaaga 975
Score = 42.1 bits (21), Expect = 0.11
Identities = 36/41 (87%)
Strand = Plus / Plus
Query: 167 gctagagaagaagaggaagcacggagggcacgggaggaagg 207
||||||||||| |||||||| |||| |||||||| |||||
Sbjct: 1054 gctagagaagatgaggaagctcggatagcacgggaagaagg 1094
>gb|AY056320.1| Arabidopsis thaliana putative calreticulin protein (At1g08450) mRNA,
complete cds
Length = 1462
Score = 61.9 bits (31), Expect = 1e-007
Identities = 64/75 (85%)
Strand = Plus / Plus
Query: 14 attgaagtatggcaggtcaaagctggttcagtttttgacaacattttgatttgcgatgac 73
||||||||||||||||| || ||||| ||| | |||||||| || ||||| |||||||||
Sbjct: 1001 attgaagtatggcaggtgaaggctggctcaatctttgacaatatattgatctgcgatgac 1060
Query: 74 ccagactatgcaaga 88
|| | |||||||||
Sbjct: 1061 ccggcatatgcaaga 1075
Score = 42.1 bits (21), Expect = 0.11
Identities = 36/41 (87%)
Strand = Plus / Plus
Query: 167 gctagagaagaagaggaagcacggagggcacgggaggaagg 207
||||||||||| |||||||| |||| |||||||| |||||
Sbjct: 1154 gctagagaagatgaggaagctcggatagcacgggaagaagg 1194
>emb|AX507182.1| Sequence 1877 from Patent WO0216655
Length = 1242
Score = 61.9 bits (31), Expect = 1e-007
Identities = 64/75 (85%)
Strand = Plus / Plus
Query: 14 attgaagtatggcaggtcaaagctggttcagtttttgacaacattttgatttgcgatgac 73
||||||||||||||||| || ||||| ||| | |||||||| || ||||| |||||||||
Sbjct: 901 attgaagtatggcaggtgaaggctggctcaatctttgacaatatattgatctgcgatgac 960
Query: 74 ccagactatgcaaga 88
|| | |||||||||
Sbjct: 961 ccggcatatgcaaga 975
Score = 42.1 bits (21), Expect = 0.11
Identities = 36/41 (87%)
Strand = Plus / Plus
Query: 167 gctagagaagaagaggaagcacggagggcacgggaggaagg 207
||||||||||| |||||||| |||| |||||||| |||||
Sbjct: 1054 gctagagaagatgaggaagctcggatagcacgggaagaagg 1094
>gb|BT002494.1| Arabidopsis thaliana calreticulin, putative (At1g08450) mRNA,
complete cds
Length = 1426
Score = 61.9 bits (31), Expect = 1e-007
Identities = 64/75 (85%)
Strand = Plus / Plus
Query: 14 attgaagtatggcaggtcaaagctggttcagtttttgacaacattttgatttgcgatgac 73
||||||||||||||||| || ||||| ||| | |||||||| || ||||| |||||||||
Sbjct: 1001 attgaagtatggcaggtgaaggctggctcaatctttgacaatatattgatctgcgatgac 1060
Query: 74 ccagactatgcaaga 88
|| | |||||||||
Sbjct: 1061 ccggcatatgcaaga 1075
>emb|AX651751.1| Sequence 595 from Patent WO03000898
Length = 1242
Score = 61.9 bits (31), Expect = 1e-007
Identities = 64/75 (85%)
Strand = Plus / Plus
Query: 14 attgaagtatggcaggtcaaagctggttcagtttttgacaacattttgatttgcgatgac 73
||||||||||||||||| || ||||| ||| | |||||||| || ||||| |||||||||
Sbjct: 901 attgaagtatggcaggtgaaggctggctcaatctttgacaatatattgatctgcgatgac 960
Query: 74 ccagactatgcaaga 88
|| | |||||||||
Sbjct: 961 ccggcatatgcaaga 975
Score = 42.1 bits (21), Expect = 0.11
Identities = 36/41 (87%)
Strand = Plus / Plus
Query: 167 gctagagaagaagaggaagcacggagggcacgggaggaagg 207
||||||||||| |||||||| |||| |||||||| |||||
Sbjct: 1054 gctagagaagatgaggaagctcggatagcacgggaagaagg 1094
>emb|BX815527.1|CNS0AATS Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTLS6ZD12 of Adult vegetative tissue of strain col-0 of
Arabidopsis thaliana (thale cress)
Length = 1359
Score = 61.9 bits (31), Expect = 1e-007
Identities = 64/75 (85%)
Strand = Plus / Plus
Query: 14 attgaagtatggcaggtcaaagctggttcagtttttgacaacattttgatttgcgatgac 73
||||||||||||||||| || ||||| ||| | |||||||| || ||||| |||||||||
Sbjct: 988 attgaagtatggcaggtgaaggctggctcaatctttgacaatatattgatctgcgatgac 1047
Query: 74 ccagactatgcaaga 88
|| | |||||||||
Sbjct: 1048 ccggcatatgcaaga 1062
Score = 42.1 bits (21), Expect = 0.11
Identities = 36/41 (87%)
Strand = Plus / Plus
Query: 167 gctagagaagaagaggaagcacggagggcacgggaggaagg 207
||||||||||| |||||||| |||| |||||||| |||||
Sbjct: 1141 gctagagaagatgaggaagctcggatagcacgggaagaagg 1181
>emb|BX815781.1|CNS0ACTU Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTLS93ZH04 of Adult vegetative tissue of strain col-0
of Arabidopsis thaliana (thale cress)
Length = 1391
Score = 61.9 bits (31), Expect = 1e-007
Identities = 64/75 (85%)
Strand = Plus / Plus
Query: 14 attgaagtatggcaggtcaaagctggttcagtttttgacaacattttgatttgcgatgac 73
||||||||||||||||| || ||||| ||| | |||||||| || ||||| |||||||||
Sbjct: 986 attgaagtatggcaggtgaaggctggctcaatctttgacaatatattgatctgcgatgac 1045
Query: 74 ccagactatgcaaga 88
|| | |||||||||
Sbjct: 1046 ccggcatatgcaaga 1060
Score = 42.1 bits (21), Expect = 0.11
Identities = 36/41 (87%)
Strand = Plus / Plus
Query: 167 gctagagaagaagaggaagcacggagggcacgggaggaagg 207
||||||||||| |||||||| |||| |||||||| |||||
Sbjct: 1139 gctagagaagatgaggaagctcggatagcacgggaagaagg 1179
>ref|NM_100718.2| Arabidopsis thaliana CRT3 (CALRETICULIN 3); calcium ion binding
AT1G08450 (CRT3) transcript variant AT1G08450.1 mRNA,
complete cds
Length = 1469
Score = 61.9 bits (31), Expect = 1e-007
Identities = 64/75 (85%)
Strand = Plus / Plus
Query: 14 attgaagtatggcaggtcaaagctggttcagtttttgacaacattttgatttgcgatgac 73
||||||||||||||||| || ||||| ||| | |||||||| || ||||| |||||||||
Sbjct: 1001 attgaagtatggcaggtgaaggctggctcaatctttgacaatatattgatctgcgatgac 1060
Query: 74 ccagactatgcaaga 88
|| | |||||||||
Sbjct: 1061 ccggcatatgcaaga 1075
Score = 42.1 bits (21), Expect = 0.11
Identities = 36/41 (87%)
Strand = Plus / Plus
Query: 167 gctagagaagaagaggaagcacggagggcacgggaggaagg 207
||||||||||| |||||||| |||| |||||||| |||||
Sbjct: 1154 gctagagaagatgaggaagctcggatagcacgggaagaagg 1194
>ref|NM_202064.1| Arabidopsis thaliana CRT3 (CALRETICULIN 3); calcium ion binding
AT1G08450 (CRT3) transcript variant AT1G08450.2 mRNA,
complete cds
Length = 1307
Score = 61.9 bits (31), Expect = 1e-007
Identities = 64/75 (85%)
Strand = Plus / Plus
Query: 14 attgaagtatggcaggtcaaagctggttcagtttttgacaacattttgatttgcgatgac 73
||||||||||||||||| || ||||| ||| | |||||||| || ||||| |||||||||
Sbjct: 839 attgaagtatggcaggtgaaggctggctcaatctttgacaatatattgatctgcgatgac 898
Query: 74 ccagactatgcaaga 88
|| | |||||||||
Sbjct: 899 ccggcatatgcaaga 913
Score = 42.1 bits (21), Expect = 0.11
Identities = 36/41 (87%)
Strand = Plus / Plus
Query: 167 gctagagaagaagaggaagcacggagggcacgggaggaagg 207
||||||||||| |||||||| |||| |||||||| |||||
Sbjct: 992 gctagagaagatgaggaagctcggatagcacgggaagaagg 1032
>gb|BP570685.1|BP570685 BP570685 RAFL14 Arabidopsis thaliana cDNA clone RAFL14-73-H18 3',
mRNA sequence
Length = 425
Score = 58.0 bits (29), Expect = 2e-006
Identities = 62/73 (84%)
Strand = Plus / Minus
Query: 16 tgaagtatggcaggtcaaagctggttcagtttttgacaacattttgatttgcgatgaccc 75
||||||||||||||| || ||||| ||| | |||||||| || ||||| |||||||||||
Sbjct: 425 tgaagtatggcaggtgaaggctggctcaatctttgacaatatattgatctgcgatgaccc 366
Query: 76 agactatgcaaga 88
| |||||||||
Sbjct: 365 ggcatatgcaaga 353
>gb|BP582761.1|BP582761 BP582761 RAFL14 Arabidopsis thaliana cDNA clone RAFL14-37-O16 3',
mRNA sequence
Length = 433
Score = 48.1 bits (24), Expect = 0.002
Identities = 39/44 (88%)
Strand = Plus / Minus
Query: 164 aaggctagagaagaagaggaagcacggagggcacgggaggaagg 207
|||||||||||||| |||||||| |||| |||||||| |||||
Sbjct: 295 aaggctagagaagatgaggaagctcggatagcacgggaagaagg 252
>gb|BP611859.1|BP611859 BP611859 RAFL16 Arabidopsis thaliana cDNA clone RAFL16-87-G12 3',
mRNA sequence
Length = 438
Score = 48.1 bits (24), Expect = 0.002
Identities = 64/76 (84%), Gaps = 1/76 (1%)
Strand = Plus / Minus
Query: 14 attgaagtatgg-caggtcaaagctggttcagtttttgacaacattttgatttgcgatga 72
|||||||||||| ||||| || ||||| ||| | |||||||| || ||||| ||||||||
Sbjct: 428 attgaagtatgggcaggtgaaggctggctcaatctttgacaatatattgatctgcgatga 369
Query: 73 cccagactatgcaaga 88
||| | |||||||||
Sbjct: 368 cccggcatatgcaaga 353
Score = 42.1 bits (21), Expect = 0.11
Identities = 36/41 (87%)
Strand = Plus / Minus
Query: 167 gctagagaagaagaggaagcacggagggcacgggaggaagg 207
||||||||||| |||||||| |||| |||||||| |||||
Sbjct: 274 gctagagaagatgaggaagctcggatagcacgggaagaagg 234
>gb|BP648229.1|BP648229 BP648229 RAFL19 Arabidopsis thaliana cDNA clone RAFL19-78-B05 3',
mRNA sequence
Length = 403
Score = 46.1 bits (23), Expect = 0.007
Identities = 41/47 (87%)
Strand = Plus / Minus
Query: 161 aggaaggctagagaagaagaggaagcacggagggcacgggaggaagg 207
||||| ||||||||||| |||||||| |||| |||||||| |||||
Sbjct: 328 aggaaagctagagaagatgaggaagctcggatagcacgggaagaagg 282
>gb|AA042519.1|AA042519 25112 Lambda-PRL2 Arabidopsis thaliana cDNA clone 251K15T7, mRNA
sequence
Length = 620
Score = 44.1 bits (22), Expect = 0.027
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 59 ttgatttgcgatgacccagactatgc 84
||||| ||||||||||||||||||||
Sbjct: 302 ttgatctgcgatgacccagactatgc 327
>gb|AI995267.1|AI995267 701503307 A. thaliana, Ohio State clone set Arabidopsis thaliana
cDNA clone 701503307, mRNA sequence
Length = 424
Score = 44.1 bits (22), Expect = 0.027
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 59 ttgatttgcgatgacccagactatgc 84
||||| ||||||||||||||||||||
Sbjct: 302 ttgatctgcgatgacccagactatgc 327
>gb|CF651670.1|CF651670 08-L020361-066-002-P01-SP6P MPIZ-ADIS-066 Arabidopsis thaliana cDNA
clone MPIZp2001P012Q 5-PRIME, mRNA sequence
Length = 757
Score = 44.1 bits (22), Expect = 0.027
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 59 ttgatttgcgatgacccagactatgc 84
||||| ||||||||||||||||||||
Sbjct: 198 ttgatctgcgatgacccagactatgc 223
>gb|CF652690.1|CF652690 70-L020830-066-002-P01q-SP6P MPIZ-ADIS-066 Arabidopsis thaliana
cDNA clone MPIZp2001P012Q 5-PRIME, mRNA sequence
Length = 852
Score = 44.1 bits (22), Expect = 0.027
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 59 ttgatttgcgatgacccagactatgc 84
||||| ||||||||||||||||||||
Sbjct: 198 ttgatctgcgatgacccagactatgc 223
>gb|AV440909.1|AV440909 AV440909 Arabidopsis thaliana above-ground organ two to six-week
old Arabidopsis thaliana cDNA clone APZ14a07_f 3', mRNA
sequence
Length = 651
Score = 44.1 bits (22), Expect = 0.027
Identities = 25/26 (96%)
Strand = Plus / Minus
Query: 59 ttgatttgcgatgacccagactatgc 84
||||| ||||||||||||||||||||
Sbjct: 416 ttgatctgcgatgacccagactatgc 391
>gb|AV442120.1|AV442120 AV442120 Arabidopsis thaliana above-ground organ two to six-week
old Arabidopsis thaliana cDNA clone APZ14a07_r 5', mRNA
sequence
Length = 574
Score = 44.1 bits (22), Expect = 0.027
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 59 ttgatttgcgatgacccagactatgc 84
||||| ||||||||||||||||||||
Sbjct: 521 ttgatctgcgatgacccagactatgc 546
>gb|AV520128.1|AV520128 AV520128 Arabidopsis thaliana aboveground organs two to six-week
old Arabidopsis thaliana cDNA clone APZ07g11F 3', mRNA
sequence
Length = 646
Score = 44.1 bits (22), Expect = 0.027
Identities = 25/26 (96%)
Strand = Plus / Minus
Query: 59 ttgatttgcgatgacccagactatgc 84
||||| ||||||||||||||||||||
Sbjct: 426 ttgatctgcgatgacccagactatgc 401
>gb|AV520395.1|AV520395 AV520395 Arabidopsis thaliana aboveground organs two to six-week
old Arabidopsis thaliana cDNA clone APZ18h10F 3', mRNA
sequence
Length = 670
Score = 44.1 bits (22), Expect = 0.027
Identities = 25/26 (96%)
Strand = Plus / Minus
Query: 59 ttgatttgcgatgacccagactatgc 84
||||| ||||||||||||||||||||
Sbjct: 648 ttgatctgcgatgacccagactatgc 623
>gb|U27698.1|ATU27698 Arabidopsis thaliana calreticulin (AtCRTL) mRNA, partial cds
Length = 1413
Score = 44.1 bits (22), Expect = 0.027
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 59 ttgatttgcgatgacccagactatgc 84
||||| ||||||||||||||||||||
Sbjct: 958 ttgatctgcgatgacccagactatgc 983
>gb|AE005172.1| Arabidopsis thaliana chromosome 1, top arm complete sequence
Length = 14221815
Score = 44.1 bits (22), Expect = 0.027
Identities = 25/26 (96%)
Strand = Plus / Minus
Query: 59 ttgatttgcgatgacccagactatgc 84
||||| ||||||||||||||||||||
Sbjct: 2973746 ttgatctgcgatgacccagactatgc 2973721
Score = 40.1 bits (20), Expect = 0.42
Identities = 53/64 (82%)
Strand = Plus / Minus
Query: 25 gcaggtcaaagctggttcagtttttgacaacattttgatttgcgatgacccagactatgc 84
|||||| || ||||| ||| | |||||||| || ||||| ||||||||||| | |||||
Sbjct: 2668639 gcaggtgaaggctggctcaatctttgacaatatattgatctgcgatgacccggcatatgc 2668580
Query: 85 aaga 88
||||
Sbjct: 2668579 aaga 2668576
>gb|AY045656.1| Arabidopsis thaliana At1g09210/T12M4_8 mRNA, complete cds
Length = 1516
Score = 44.1 bits (22), Expect = 0.027
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 59 ttgatttgcgatgacccagactatgc 84
||||| ||||||||||||||||||||
Sbjct: 1045 ttgatctgcgatgacccagactatgc 1070
>gb|AY059662.1| Arabidopsis thaliana At1g09210/T12M4_8 mRNA, complete cds
Length = 1275
Score = 44.1 bits (22), Expect = 0.027
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 59 ttgatttgcgatgacccagactatgc 84
||||| ||||||||||||||||||||
Sbjct: 1003 ttgatctgcgatgacccagactatgc 1028
>emb|AX412271.1| Sequence 35 from Patent WO0222675
Length = 1275
Score = 44.1 bits (22), Expect = 0.027
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 59 ttgatttgcgatgacccagactatgc 84
||||| ||||||||||||||||||||
Sbjct: 1003 ttgatctgcgatgacccagactatgc 1028
>emb|AX505492.1| Sequence 187 from Patent WO0216655
Length = 1275
Score = 44.1 bits (22), Expect = 0.027
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 59 ttgatttgcgatgacccagactatgc 84
||||| ||||||||||||||||||||
Sbjct: 1003 ttgatctgcgatgacccagactatgc 1028
>gb|AY086745.1| Arabidopsis thaliana clone 27210 mRNA, complete sequence
Length = 1532
Score = 44.1 bits (22), Expect = 0.027
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 59 ttgatttgcgatgacccagactatgc 84
||||| ||||||||||||||||||||
Sbjct: 1077 ttgatctgcgatgacccagactatgc 1102
>gb|AC003114.1|T12M4 Arabidopsis thaliana chromosome 1 BAC T12M4 sequence, complete sequence
Length = 59261
Score = 44.1 bits (22), Expect = 0.027
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 59 ttgatttgcgatgacccagactatgc 84
||||| ||||||||||||||||||||
Sbjct: 28325 ttgatctgcgatgacccagactatgc 28350
>ref|NM_100791.2| Arabidopsis thaliana calcium ion binding AT1G09210 mRNA, complete cds
Length = 1724
Score = 44.1 bits (22), Expect = 0.027
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 59 ttgatttgcgatgacccagactatgc 84
||||| ||||||||||||||||||||
Sbjct: 1077 ttgatctgcgatgacccagactatgc 1102
>ref|NC_003070.5| Arabidopsis thaliana chromosome 1, complete sequence
Length = 30432563
Score = 44.1 bits (22), Expect = 0.027
Identities = 25/26 (96%)
Strand = Plus / Minus
Query: 59 ttgatttgcgatgacccagactatgc 84
||||| ||||||||||||||||||||
Sbjct: 2973926 ttgatctgcgatgacccagactatgc 2973901
Score = 40.1 bits (20), Expect = 0.42
Identities = 53/64 (82%)
Strand = Plus / Minus
Query: 25 gcaggtcaaagctggttcagtttttgacaacattttgatttgcgatgacccagactatgc 84
|||||| || ||||| ||| | |||||||| || ||||| ||||||||||| | |||||
Sbjct: 2668792 gcaggtgaaggctggctcaatctttgacaatatattgatctgcgatgacccggcatatgc 2668733
Query: 85 aaga 88
||||
Sbjct: 2668732 aaga 2668729
>gb|AV794909.1|AV794909 AV794909 RAFL8 Arabidopsis thaliana cDNA clone RAFL08-15-C18 3',
mRNA sequence
Length = 435
Score = 42.1 bits (21), Expect = 0.11
Identities = 36/41 (87%)
Strand = Plus / Minus
Query: 167 gctagagaagaagaggaagcacggagggcacgggaggaagg 207
||||||||||| |||||||| |||| |||||||| |||||
Sbjct: 317 gctagagaagatgaggaagctcggatagcacgggaagaagg 277
>gb|AV801404.1|AV801404 AV801404 RAFL9 Arabidopsis thaliana cDNA clone RAFL09-27-P13 3',
mRNA sequence
Length = 392
Score = 42.1 bits (21), Expect = 0.11
Identities = 36/41 (87%)
Strand = Plus / Minus
Query: 167 gctagagaagaagaggaagcacggagggcacgggaggaagg 207
||||||||||| |||||||| |||| |||||||| |||||
Sbjct: 272 gctagagaagatgaggaagctcggatagcacgggaagaagg 232
>gb|AV806216.1|AV806216 AV806216 RAFL9 Arabidopsis thaliana cDNA clone RAFL09-45-L22 3',
mRNA sequence
Length = 411
Score = 42.1 bits (21), Expect = 0.11
Identities = 36/41 (87%)
Strand = Plus / Minus
Query: 167 gctagagaagaagaggaagcacggagggcacgggaggaagg 207
||||||||||| |||||||| |||| |||||||| |||||
Sbjct: 315 gctagagaagatgaggaagctcggatagcacgggaagaagg 275
>gb|AV440373.1|AV440373 AV440373 Arabidopsis thaliana above-ground organ two to six-week
old Arabidopsis thaliana cDNA clone APD60a01_f 3', mRNA
sequence
Length = 380
Score = 42.1 bits (21), Expect = 0.11
Identities = 36/41 (87%)
Strand = Plus / Minus
Query: 167 gctagagaagaagaggaagcacggagggcacgggaggaagg 207
||||||||||| |||||||| |||| |||||||| |||||
Sbjct: 289 gctagagaagatgaggaagctcggatagcacgggaagaagg 249
>gb|BP621214.1|BP621214 BP621214 RAFL16 Arabidopsis thaliana cDNA clone RAFL16-40-H06 3',
mRNA sequence
Length = 415
Score = 42.1 bits (21), Expect = 0.11
Identities = 36/41 (87%)
Strand = Plus / Minus
Query: 167 gctagagaagaagaggaagcacggagggcacgggaggaagg 207
||||||||||| |||||||| |||| |||||||| |||||
Sbjct: 275 gctagagaagatgaggaagctcggatagcacgggaagaagg 235
>gb|BP641240.1|BP641240 BP641240 RAFL19 Arabidopsis thaliana cDNA clone RAFL19-54-I24 3',
mRNA sequence
Length = 388
Score = 42.1 bits (21), Expect = 0.11
Identities = 36/41 (87%)
Strand = Plus / Minus
Query: 167 gctagagaagaagaggaagcacggagggcacgggaggaagg 207
||||||||||| |||||||| |||| |||||||| |||||
Sbjct: 276 gctagagaagatgaggaagctcggatagcacgggaagaagg 236
>gb|BP645426.1|BP645426 BP645426 RAFL19 Arabidopsis thaliana cDNA clone RAFL19-68-L18 3',
mRNA sequence
Length = 402
Score = 42.1 bits (21), Expect = 0.11
Identities = 36/41 (87%)
Strand = Plus / Minus
Query: 167 gctagagaagaagaggaagcacggagggcacgggaggaagg 207
||||||||||| |||||||| |||| |||||||| |||||
Sbjct: 290 gctagagaagatgaggaagctcggatagcacgggaagaagg 250
>gb|BP663488.1|BP663488 BP663488 RAFL21 Arabidopsis thaliana cDNA clone RAFL21-48-E18 3',
mRNA sequence
Length = 338
Score = 42.1 bits (21), Expect = 0.11
Identities = 36/41 (87%)
Strand = Plus / Minus
Query: 167 gctagagaagaagaggaagcacggagggcacgggaggaagg 207
||||||||||| |||||||| |||| |||||||| |||||
Sbjct: 323 gctagagaagatgaggaagctcggatagcacgggaagaagg 283
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 339,823
Number of Sequences: 1013581
Number of extensions: 339823
Number of successful extensions: 30665
Number of sequences better than 0.5: 56
Number of HSP's better than 0.5 without gapping: 56
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 30191
Number of HSP's gapped (non-prelim): 474
length of query: 595
length of database: 908,940,872
effective HSP length: 20
effective length of query: 575
effective length of database: 888,669,252
effective search space: 510984819900
effective search space used: 510984819900
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)