BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 8010496.2.1
         (1046 letters)

Database: At_nucl_with_EST.fasta 
           1,013,581 sequences; 908,940,872 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|B27493.1|B27493  T9E17TF TAMU Arabidopsis thaliana genomi...    42   0.19 
gb|AC003672.3|  Arabidopsis thaliana chromosome 2 clone F16B...    42   0.19 
ref|NM_130021.2|  Arabidopsis thaliana hydrolase, hydrolyzin...    42   0.19 
ref|NC_003071.3|  Arabidopsis thaliana chromosome 2, complet...    42   0.19 

>gb|B27493.1|B27493 T9E17TF TAMU Arabidopsis thaliana genomic clone T9E17, DNA sequence
          Length = 436

 Score = 42.1 bits (21), Expect = 0.19
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 521 ccaaccacgtagctcatcttcttggggtt 549
           ||||||| ||||||||| |||||||||||
Sbjct: 271 ccaaccatgtagctcattttcttggggtt 243



>gb|AC003672.3| Arabidopsis thaliana chromosome 2 clone F16B22 map m336, complete
             sequence
          Length = 109375

 Score = 42.1 bits (21), Expect = 0.19
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 521   ccaaccacgtagctcatcttcttggggtt 549
             ||||||| ||||||||| |||||||||||
Sbjct: 15203 ccaaccatgtagctcattttcttggggtt 15231



>ref|NM_130021.2| Arabidopsis thaliana hydrolase, hydrolyzing O-glycosyl compounds
            AT2G44570 mRNA, complete cds
          Length = 1662

 Score = 42.1 bits (21), Expect = 0.19
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 521  ccaaccacgtagctcatcttcttggggtt 549
            ||||||| ||||||||| |||||||||||
Sbjct: 1211 ccaaccatgtagctcattttcttggggtt 1183



>ref|NC_003071.3| Arabidopsis thaliana chromosome 2, complete sequence
          Length = 19705359

 Score = 42.1 bits (21), Expect = 0.19
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                             
Query: 521      ccaaccacgtagctcatcttcttggggtt 549
                ||||||| ||||||||| |||||||||||
Sbjct: 18401769 ccaaccatgtagctcattttcttggggtt 18401797



  Database: At_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:09 PM
  Number of letters in database: 908,940,872
  Number of sequences in database:  1,013,581
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 254,129
Number of Sequences: 1013581
Number of extensions: 254129
Number of successful extensions: 16481
Number of sequences better than  0.5: 4
Number of HSP's better than  0.5 without gapping: 4
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 16390
Number of HSP's gapped (non-prelim): 91
length of query: 1046
length of database: 908,940,872
effective HSP length: 20
effective length of query: 1026
effective length of database: 888,669,252
effective search space: 911774652552
effective search space used: 911774652552
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)