BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 7297817.2.1
(687 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BX840973.1|BX840973 BX840973 Arabidopsis thaliana Flower... 44 0.031
gb|BX841024.1|BX841024 BX841024 Arabidopsis thaliana Flower... 44 0.031
gb|BT002013.1| Arabidopsis thaliana spliceosome associated ... 44 0.031
gb|BT010557.1| Arabidopsis thaliana At4g21660 gene, complet... 44 0.031
gb|AC005168.3| Arabidopsis thaliana chromosome 2 clone F12C... 44 0.031
emb|BX818760.1|CNS0A9RW Arabidopsis thaliana Full-length cD... 44 0.031
emb|BX819204.1|CNS0A9TJ Arabidopsis thaliana Full-length cD... 44 0.031
emb|AJ270060.1| Arabidopsis thaliana DNA chromosome 4, long... 44 0.031
emb|AL035527.1|ATF17L22 Arabidopsis thaliana DNA chromosome... 44 0.031
emb|AL161555.2|ATCHRIV55 Arabidopsis thaliana DNA chromosom... 44 0.031
ref|NM_118286.2| Arabidopsis thaliana unknown protein AT4G2... 44 0.031
ref|NM_128242.3| Arabidopsis thaliana unknown protein AT2G2... 44 0.031
ref|NC_003071.3| Arabidopsis thaliana chromosome 2, complet... 44 0.031
ref|NC_003075.3| Arabidopsis thaliana chromosome 4, complet... 44 0.031
gb|CL491674.1|CL491674 SAIL_559_E09.v1 SAIL Collection Arab... 42 0.12
emb|CR402030.1| Arabidopsis thaliana T-DNA flanking sequenc... 42 0.12
gb|AA585946.1|AA585946 28595 Lambda-PRL2 Arabidopsis thalia... 42 0.12
gb|AV792791.1|AV792791 AV792791 RAFL7 Arabidopsis thaliana ... 42 0.12
gb|AV793525.1|AV793525 AV793525 RAFL8 Arabidopsis thaliana ... 42 0.12
gb|AV794326.1|AV794326 AV794326 RAFL8 Arabidopsis thaliana ... 42 0.12
gb|AV794454.1|AV794454 AV794454 RAFL8 Arabidopsis thaliana ... 42 0.12
gb|AV795321.1|AV795321 AV795321 RAFL8 Arabidopsis thaliana ... 42 0.12
gb|AV795818.1|AV795818 AV795818 RAFL8 Arabidopsis thaliana ... 42 0.12
gb|AV811716.1|AV811716 AV811716 RAFL9 Arabidopsis thaliana ... 42 0.12
gb|AV815226.1|AV815226 AV815226 RAFL9 Arabidopsis thaliana ... 42 0.12
gb|BX836231.1|BX836231 BX836231 Arabidopsis thaliana Hormon... 42 0.12
gb|AV539209.1|AV539209 AV539209 Arabidopsis thaliana roots ... 42 0.12
gb|AV558042.1|AV558042 AV558042 Arabidopsis thaliana green ... 42 0.12
gb|AV563243.1|AV563243 AV563243 Arabidopsis thaliana green ... 42 0.12
gb|AV563722.1|AV563722 AV563722 Arabidopsis thaliana green ... 42 0.12
gb|BP564036.1|BP564036 BP564036 RAFL14 Arabidopsis thaliana... 42 0.12
gb|BP571336.1|BP571336 BP571336 RAFL14 Arabidopsis thaliana... 42 0.12
gb|BP577616.1|BP577616 BP577616 RAFL14 Arabidopsis thaliana... 42 0.12
gb|BP578818.1|BP578818 BP578818 RAFL14 Arabidopsis thaliana... 42 0.12
gb|BP599495.1|BP599495 BP599495 RAFL16 Arabidopsis thaliana... 42 0.12
gb|BP603757.1|BP603757 BP603757 RAFL16 Arabidopsis thaliana... 42 0.12
gb|BP606290.1|BP606290 BP606290 RAFL16 Arabidopsis thaliana... 42 0.12
gb|BP607926.1|BP607926 BP607926 RAFL16 Arabidopsis thaliana... 42 0.12
gb|BP608875.1|BP608875 BP608875 RAFL16 Arabidopsis thaliana... 42 0.12
gb|BP613740.1|BP613740 BP613740 RAFL16 Arabidopsis thaliana... 42 0.12
gb|BP617865.1|BP617865 BP617865 RAFL16 Arabidopsis thaliana... 42 0.12
gb|BP618523.1|BP618523 BP618523 RAFL16 Arabidopsis thaliana... 42 0.12
gb|BP649379.1|BP649379 BP649379 RAFL19 Arabidopsis thaliana... 42 0.12
gb|BP649637.1|BP649637 BP649637 RAFL19 Arabidopsis thaliana... 42 0.12
gb|BP658375.1|BP658375 BP658375 RAFL19 Arabidopsis thaliana... 42 0.12
gb|BP663573.1|BP663573 BP663573 RAFL21 Arabidopsis thaliana... 42 0.12
gb|BP668184.1|BP668184 BP668184 RAFL21 Arabidopsis thaliana... 42 0.12
gb|BP782693.1|BP782693 BP782693 RAFL7 Arabidopsis thaliana ... 42 0.12
gb|BP787746.1|BP787746 BP787746 RAFL7 Arabidopsis thaliana ... 42 0.12
gb|BP789400.1|BP789400 BP789400 RAFL7 Arabidopsis thaliana ... 42 0.12
gb|AF228637.1|AF228637 Arabidopsis thaliana lipoamide dehyd... 42 0.12
gb|AY050376.1| Arabidopsis thaliana AT3g16950/K14A17_7 mRNA... 42 0.12
emb|AJ522266.1|ATH522266 Arabidopsis thaliana T-DNA flankin... 42 0.12
dbj|AB026636.1| Arabidopsis thaliana genomic DNA, chromosom... 42 0.12
emb|CQ799198.1| Sequence 27 from Patent EP1411125 42 0.12
dbj|BA000014.8| Arabidopsis thaliana, chromosome 3, complet... 42 0.12
ref|NM_112571.2| Arabidopsis thaliana LPD1 (LIPOAMIDE DEHYD... 42 0.12
ref|NC_003074.4| Arabidopsis thaliana chromosome 3, complet... 42 0.12
gb|CL496618.1|CL496618 SAIL_628_E10.v1 SAIL Collection Arab... 40 0.49
gb|T22582.1|T22582 4590 Lambda-PRL2 Arabidopsis thaliana cD... 40 0.49
gb|T22966.1|T22966 4974 Lambda-PRL2 Arabidopsis thaliana cD... 40 0.49
gb|AI999766.1|AI999766 701557340 A. thaliana, Columbia Col-... 40 0.49
gb|AV783053.1|AV783053 AV783053 RAFL5 Arabidopsis thaliana ... 40 0.49
gb|AV789692.1|AV789692 AV789692 RAFL6 Arabidopsis thaliana ... 40 0.49
gb|AV794533.1|AV794533 AV794533 RAFL8 Arabidopsis thaliana ... 40 0.49
gb|AV796713.1|AV796713 AV796713 RAFL9 Arabidopsis thaliana ... 40 0.49
gb|AV808881.1|AV808881 AV808881 RAFL9 Arabidopsis thaliana ... 40 0.49
gb|CB260681.1|CB260681 78-E9406-012-002-K10-t7r MPIZ-ADIS-0... 40 0.49
gb|AV561387.1|AV561387 AV561387 Arabidopsis thaliana green ... 40 0.49
gb|AV562178.1|AV562178 AV562178 Arabidopsis thaliana green ... 40 0.49
gb|CK117661.1|CK117661 214j07.p1 AtM1 Arabidopsis thaliana ... 40 0.49
gb|BP578766.1|BP578766 BP578766 RAFL14 Arabidopsis thaliana... 40 0.49
gb|BP661587.1|BP661587 BP661587 RAFL21 Arabidopsis thaliana... 40 0.49
gb|BP665927.1|BP665927 BP665927 RAFL21 Arabidopsis thaliana... 40 0.49
gb|AF262040.1|T10I18 Arabidopsis thaliana BAC T10I18 40 0.49
gb|AY039608.1| Arabidopsis thaliana At1g55530/T5A14_7 mRNA,... 40 0.49
gb|AF424578.1|AF424578 Arabidopsis thaliana At1g55530/T5A14... 40 0.49
gb|BT000502.1| Arabidopsis thaliana unknown protein (At1g55... 40 0.49
emb|AX507321.1| Sequence 2016 from Patent WO0216655 40 0.49
emb|AX651389.1| Sequence 184 from Patent WO03000898 40 0.49
gb|AY091123.1| Arabidopsis thaliana At5g22085 mRNA sequence 40 0.49
gb|BT010797.1| Arabidopsis thaliana At5g28610 mRNA, complet... 40 0.49
gb|AC005223.1| Arabidopsis thaliana chromosome I BAC T5A14,... 40 0.49
emb|BX841659.1|CNS09YI2 Arabidopsis thaliana Full-length cD... 40 0.49
emb|BX831183.1|CNS0A0R2 Arabidopsis thaliana Full-length cD... 40 0.49
emb|BX814912.1|CNS0ACXJ Arabidopsis thaliana Full-length cD... 40 0.49
emb|BX815303.1|CNS0ACTI Arabidopsis thaliana Full-length cD... 40 0.49
emb|BX817043.1|CNS0AD94 Arabidopsis thaliana Full-length cD... 40 0.49
dbj|AK118109.1| Arabidopsis thaliana At5g22090 mRNA for unk... 40 0.49
dbj|BA000015.5| Arabidopsis thaliana DNA, chromosome 5, com... 40 0.49
gb|AY800625.1| Arabidopsis thaliana clone H0000001232 hypot... 40 0.49
gb|AY954850.1| Arabidopsis thaliana hypothetical protein (A... 40 0.49
emb|AL132965.1|ATT16K5 Arabidopsis thaliana DNA chromosome ... 40 0.49
emb|AL589883.1|ATT6G21 Arabidopsis thaliana DNA chromosome ... 40 0.49
gb|AE005173.1| Arabidopsis thaliana chromosome 1, bottom ar... 40 0.49
ref|NM_147890.2| Arabidopsis thaliana unknown protein AT5G2... 40 0.49
ref|NM_122744.2| Arabidopsis thaliana unknown protein AT5G2... 40 0.49
ref|NM_104428.2| Arabidopsis thaliana protein binding / ubi... 40 0.49
ref|NM_114837.2| Arabidopsis thaliana unknown protein AT3G4... 40 0.49
ref|NC_003076.4| Arabidopsis thaliana chromosome 5, complet... 40 0.49
ref|NC_003070.5| Arabidopsis thaliana chromosome 1, complet... 40 0.49
>gb|BX840973.1|BX840973 BX840973 Arabidopsis thaliana Flowers and buds Col-0 Arabidopsis
thaliana cDNA clone GSLTFB95ZC10 5PRIM, mRNA sequence
Length = 862
Score = 44.1 bits (22), Expect = 0.031
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 662 tcctcctcctcttcttcttcct 683
||||||||||||||||||||||
Sbjct: 87 tcctcctcctcttcttcttcct 108
>gb|BX841024.1|BX841024 BX841024 Arabidopsis thaliana Flowers and buds Col-0 Arabidopsis
thaliana cDNA clone GSLTFB45ZG07 5PRIM, mRNA sequence
Length = 429
Score = 44.1 bits (22), Expect = 0.031
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 662 tcctcctcctcttcttcttcct 683
||||||||||||||||||||||
Sbjct: 74 tcctcctcctcttcttcttcct 95
>gb|BT002013.1| Arabidopsis thaliana spliceosome associated protein - like
(At4g21660) mRNA, complete cds
Length = 1980
Score = 44.1 bits (22), Expect = 0.031
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 662 tcctcctcctcttcttcttcct 683
||||||||||||||||||||||
Sbjct: 1298 tcctcctcctcttcttcttcct 1277
>gb|BT010557.1| Arabidopsis thaliana At4g21660 gene, complete cds
Length = 1755
Score = 44.1 bits (22), Expect = 0.031
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 662 tcctcctcctcttcttcttcct 683
||||||||||||||||||||||
Sbjct: 1256 tcctcctcctcttcttcttcct 1235
>gb|AC005168.3| Arabidopsis thaliana chromosome 2 clone F12C20 map B68, complete
sequence
Length = 87978
Score = 44.1 bits (22), Expect = 0.031
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 662 tcctcctcctcttcttcttcct 683
||||||||||||||||||||||
Sbjct: 53372 tcctcctcctcttcttcttcct 53393
>emb|BX818760.1|CNS0A9RW Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTFB10ZB05 of Flowers and buds of strain col-0 of
Arabidopsis thaliana (thale cress)
Length = 1525
Score = 44.1 bits (22), Expect = 0.031
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 662 tcctcctcctcttcttcttcct 683
||||||||||||||||||||||
Sbjct: 86 tcctcctcctcttcttcttcct 107
>emb|BX819204.1|CNS0A9TJ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTFB57ZA10 of Flowers and buds of strain col-0 of
Arabidopsis thaliana (thale cress)
Length = 1489
Score = 44.1 bits (22), Expect = 0.031
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 662 tcctcctcctcttcttcttcct 683
||||||||||||||||||||||
Sbjct: 68 tcctcctcctcttcttcttcct 89
>emb|AJ270060.1| Arabidopsis thaliana DNA chromosome 4, long arm
Length = 14497843
Score = 44.1 bits (22), Expect = 0.031
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 662 tcctcctcctcttcttcttcct 683
||||||||||||||||||||||
Sbjct: 7419931 tcctcctcctcttcttcttcct 7419952
>emb|AL035527.1|ATF17L22 Arabidopsis thaliana DNA chromosome 4, BAC clone F17L22 (ESSAII
project)
Length = 107702
Score = 44.1 bits (22), Expect = 0.031
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 662 tcctcctcctcttcttcttcct 683
||||||||||||||||||||||
Sbjct: 38975 tcctcctcctcttcttcttcct 38996
>emb|AL161555.2|ATCHRIV55 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 55
Length = 194916
Score = 44.1 bits (22), Expect = 0.031
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 662 tcctcctcctcttcttcttcct 683
||||||||||||||||||||||
Sbjct: 125033 tcctcctcctcttcttcttcct 125054
>ref|NM_118286.2| Arabidopsis thaliana unknown protein AT4G21660 mRNA, complete cds
Length = 2082
Score = 44.1 bits (22), Expect = 0.031
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 662 tcctcctcctcttcttcttcct 683
||||||||||||||||||||||
Sbjct: 1298 tcctcctcctcttcttcttcct 1277
>ref|NM_128242.3| Arabidopsis thaliana unknown protein AT2G26850 mRNA, complete cds
Length = 1522
Score = 44.1 bits (22), Expect = 0.031
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 662 tcctcctcctcttcttcttcct 683
||||||||||||||||||||||
Sbjct: 86 tcctcctcctcttcttcttcct 107
>ref|NC_003071.3| Arabidopsis thaliana chromosome 2, complete sequence
Length = 19705359
Score = 44.1 bits (22), Expect = 0.031
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 662 tcctcctcctcttcttcttcct 683
||||||||||||||||||||||
Sbjct: 11458232 tcctcctcctcttcttcttcct 11458211
>ref|NC_003075.3| Arabidopsis thaliana chromosome 4, complete sequence
Length = 18585042
Score = 44.1 bits (22), Expect = 0.031
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 662 tcctcctcctcttcttcttcct 683
||||||||||||||||||||||
Sbjct: 11507178 tcctcctcctcttcttcttcct 11507199
>gb|CL491674.1|CL491674 SAIL_559_E09.v1 SAIL Collection Arabidopsis thaliana genomic clone
SAIL_559_E09.v1, DNA sequence
Length = 2130
Score = 42.1 bits (21), Expect = 0.12
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 662 tcctcctcctcttcttcttcc 682
|||||||||||||||||||||
Sbjct: 46 tcctcctcctcttcttcttcc 26
>emb|CR402030.1| Arabidopsis thaliana T-DNA flanking sequence GK-851F01-025842,
genomic survey sequence
Length = 205
Score = 42.1 bits (21), Expect = 0.12
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 665 tcctcctcttcttcttccttg 685
|||||||||||||||||||||
Sbjct: 91 tcctcctcttcttcttccttg 111
>gb|AA585946.1|AA585946 28595 Lambda-PRL2 Arabidopsis thaliana cDNA clone 36A9XP 3', mRNA
sequence
Length = 486
Score = 42.1 bits (21), Expect = 0.12
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 664 ctcctcctcttcttcttcctt 684
|||||||||||||||||||||
Sbjct: 254 ctcctcctcttcttcttcctt 234
>gb|AV792791.1|AV792791 AV792791 RAFL7 Arabidopsis thaliana cDNA clone RAFL07-16-K04 3',
mRNA sequence
Length = 444
Score = 42.1 bits (21), Expect = 0.12
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 664 ctcctcctcttcttcttcctt 684
|||||||||||||||||||||
Sbjct: 240 ctcctcctcttcttcttcctt 260
>gb|AV793525.1|AV793525 AV793525 RAFL8 Arabidopsis thaliana cDNA clone RAFL08-09-A17 3',
mRNA sequence
Length = 443
Score = 42.1 bits (21), Expect = 0.12
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 664 ctcctcctcttcttcttcctt 684
|||||||||||||||||||||
Sbjct: 243 ctcctcctcttcttcttcctt 263
>gb|AV794326.1|AV794326 AV794326 RAFL8 Arabidopsis thaliana cDNA clone RAFL08-12-G12 3',
mRNA sequence
Length = 451
Score = 42.1 bits (21), Expect = 0.12
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 664 ctcctcctcttcttcttcctt 684
|||||||||||||||||||||
Sbjct: 234 ctcctcctcttcttcttcctt 254
>gb|AV794454.1|AV794454 AV794454 RAFL8 Arabidopsis thaliana cDNA clone RAFL08-12-P09 3',
mRNA sequence
Length = 448
Score = 42.1 bits (21), Expect = 0.12
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 664 ctcctcctcttcttcttcctt 684
|||||||||||||||||||||
Sbjct: 234 ctcctcctcttcttcttcctt 254
>gb|AV795321.1|AV795321 AV795321 RAFL8 Arabidopsis thaliana cDNA clone RAFL08-17-A11 3',
mRNA sequence
Length = 443
Score = 42.1 bits (21), Expect = 0.12
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 664 ctcctcctcttcttcttcctt 684
|||||||||||||||||||||
Sbjct: 233 ctcctcctcttcttcttcctt 253
>gb|AV795818.1|AV795818 AV795818 RAFL8 Arabidopsis thaliana cDNA clone RAFL08-19-E16 3',
mRNA sequence
Length = 413
Score = 42.1 bits (21), Expect = 0.12
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 664 ctcctcctcttcttcttcctt 684
|||||||||||||||||||||
Sbjct: 234 ctcctcctcttcttcttcctt 254
>gb|AV811716.1|AV811716 AV811716 RAFL9 Arabidopsis thaliana cDNA clone RAFL09-69-G03 3',
mRNA sequence
Length = 385
Score = 42.1 bits (21), Expect = 0.12
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 664 ctcctcctcttcttcttcctt 684
|||||||||||||||||||||
Sbjct: 160 ctcctcctcttcttcttcctt 180
>gb|AV815226.1|AV815226 AV815226 RAFL9 Arabidopsis thaliana cDNA clone RAFL09-85-O07 3',
mRNA sequence
Length = 404
Score = 42.1 bits (21), Expect = 0.12
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 664 ctcctcctcttcttcttcctt 684
|||||||||||||||||||||
Sbjct: 238 ctcctcctcttcttcttcctt 258
>gb|BX836231.1|BX836231 BX836231 Arabidopsis thaliana Hormone Treated Callus Col-0
Arabidopsis thaliana cDNA clone GSLTPGH35ZF11 3PRIM,
mRNA sequence
Length = 787
Score = 42.1 bits (21), Expect = 0.12
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 664 ctcctcctcttcttcttcctt 684
|||||||||||||||||||||
Sbjct: 198 ctcctcctcttcttcttcctt 218
>gb|AV539209.1|AV539209 AV539209 Arabidopsis thaliana roots Columbia Arabidopsis thaliana
cDNA clone RZ129b05F 3', mRNA sequence
Length = 402
Score = 42.1 bits (21), Expect = 0.12
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 664 ctcctcctcttcttcttcctt 684
|||||||||||||||||||||
Sbjct: 244 ctcctcctcttcttcttcctt 264
>gb|AV558042.1|AV558042 AV558042 Arabidopsis thaliana green siliques Columbia Arabidopsis
thaliana cDNA clone SQ087c10F 3', mRNA sequence
Length = 538
Score = 42.1 bits (21), Expect = 0.12
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 664 ctcctcctcttcttcttcctt 684
|||||||||||||||||||||
Sbjct: 221 ctcctcctcttcttcttcctt 241
>gb|AV563243.1|AV563243 AV563243 Arabidopsis thaliana green siliques Columbia Arabidopsis
thaliana cDNA clone SQ183h02F 3', mRNA sequence
Length = 498
Score = 42.1 bits (21), Expect = 0.12
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 664 ctcctcctcttcttcttcctt 684
|||||||||||||||||||||
Sbjct: 235 ctcctcctcttcttcttcctt 255
>gb|AV563722.1|AV563722 AV563722 Arabidopsis thaliana green siliques Columbia Arabidopsis
thaliana cDNA clone SQ192b05F 3', mRNA sequence
Length = 341
Score = 42.1 bits (21), Expect = 0.12
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 664 ctcctcctcttcttcttcctt 684
|||||||||||||||||||||
Sbjct: 232 ctcctcctcttcttcttcctt 252
>gb|BP564036.1|BP564036 BP564036 RAFL14 Arabidopsis thaliana cDNA clone RAFL14-05-M06 3',
mRNA sequence
Length = 416
Score = 42.1 bits (21), Expect = 0.12
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 664 ctcctcctcttcttcttcctt 684
|||||||||||||||||||||
Sbjct: 161 ctcctcctcttcttcttcctt 181
>gb|BP571336.1|BP571336 BP571336 RAFL14 Arabidopsis thaliana cDNA clone RAFL14-75-O06 3',
mRNA sequence
Length = 440
Score = 42.1 bits (21), Expect = 0.12
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 664 ctcctcctcttcttcttcctt 684
|||||||||||||||||||||
Sbjct: 160 ctcctcctcttcttcttcctt 180
>gb|BP577616.1|BP577616 BP577616 RAFL14 Arabidopsis thaliana cDNA clone RAFL14-97-H01 3',
mRNA sequence
Length = 260
Score = 42.1 bits (21), Expect = 0.12
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 664 ctcctcctcttcttcttcctt 684
|||||||||||||||||||||
Sbjct: 161 ctcctcctcttcttcttcctt 181
>gb|BP578818.1|BP578818 BP578818 RAFL14 Arabidopsis thaliana cDNA clone RAFL14-19-L15 3',
mRNA sequence
Length = 418
Score = 42.1 bits (21), Expect = 0.12
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 664 ctcctcctcttcttcttcctt 684
|||||||||||||||||||||
Sbjct: 163 ctcctcctcttcttcttcctt 183
>gb|BP599495.1|BP599495 BP599495 RAFL16 Arabidopsis thaliana cDNA clone RAFL16-07-H21 3',
mRNA sequence
Length = 367
Score = 42.1 bits (21), Expect = 0.12
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 664 ctcctcctcttcttcttcctt 684
|||||||||||||||||||||
Sbjct: 234 ctcctcctcttcttcttcctt 254
>gb|BP603757.1|BP603757 BP603757 RAFL16 Arabidopsis thaliana cDNA clone RAFL16-59-P05 3',
mRNA sequence
Length = 396
Score = 42.1 bits (21), Expect = 0.12
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 664 ctcctcctcttcttcttcctt 684
|||||||||||||||||||||
Sbjct: 234 ctcctcctcttcttcttcctt 254
>gb|BP606290.1|BP606290 BP606290 RAFL16 Arabidopsis thaliana cDNA clone RAFL16-70-F15 3',
mRNA sequence
Length = 434
Score = 42.1 bits (21), Expect = 0.12
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 664 ctcctcctcttcttcttcctt 684
|||||||||||||||||||||
Sbjct: 240 ctcctcctcttcttcttcctt 260
>gb|BP607926.1|BP607926 BP607926 RAFL16 Arabidopsis thaliana cDNA clone RAFL16-76-L17 3',
mRNA sequence
Length = 418
Score = 42.1 bits (21), Expect = 0.12
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 664 ctcctcctcttcttcttcctt 684
|||||||||||||||||||||
Sbjct: 234 ctcctcctcttcttcttcctt 254
>gb|BP608875.1|BP608875 BP608875 RAFL16 Arabidopsis thaliana cDNA clone RAFL16-80-C14 3',
mRNA sequence
Length = 418
Score = 42.1 bits (21), Expect = 0.12
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 664 ctcctcctcttcttcttcctt 684
|||||||||||||||||||||
Sbjct: 233 ctcctcctcttcttcttcctt 253
>gb|BP613740.1|BP613740 BP613740 RAFL16 Arabidopsis thaliana cDNA clone RAFL16-94-D03 3',
mRNA sequence
Length = 428
Score = 42.1 bits (21), Expect = 0.12
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 664 ctcctcctcttcttcttcctt 684
|||||||||||||||||||||
Sbjct: 234 ctcctcctcttcttcttcctt 254
>gb|BP617865.1|BP617865 BP617865 RAFL16 Arabidopsis thaliana cDNA clone RAFL16-25-N15 3',
mRNA sequence
Length = 441
Score = 42.1 bits (21), Expect = 0.12
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 664 ctcctcctcttcttcttcctt 684
|||||||||||||||||||||
Sbjct: 235 ctcctcctcttcttcttcctt 255
>gb|BP618523.1|BP618523 BP618523 RAFL16 Arabidopsis thaliana cDNA clone RAFL16-28-K03 3',
mRNA sequence
Length = 450
Score = 42.1 bits (21), Expect = 0.12
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 664 ctcctcctcttcttcttcctt 684
|||||||||||||||||||||
Sbjct: 235 ctcctcctcttcttcttcctt 255
>gb|BP649379.1|BP649379 BP649379 RAFL19 Arabidopsis thaliana cDNA clone RAFL19-13-G09 3',
mRNA sequence
Length = 381
Score = 42.1 bits (21), Expect = 0.12
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 664 ctcctcctcttcttcttcctt 684
|||||||||||||||||||||
Sbjct: 243 ctcctcctcttcttcttcctt 263
>gb|BP649637.1|BP649637 BP649637 RAFL19 Arabidopsis thaliana cDNA clone RAFL19-80-B09 3',
mRNA sequence
Length = 427
Score = 42.1 bits (21), Expect = 0.12
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 664 ctcctcctcttcttcttcctt 684
|||||||||||||||||||||
Sbjct: 251 ctcctcctcttcttcttcctt 271
>gb|BP658375.1|BP658375 BP658375 RAFL19 Arabidopsis thaliana cDNA clone RAFL19-35-D21 3',
mRNA sequence
Length = 402
Score = 42.1 bits (21), Expect = 0.12
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 664 ctcctcctcttcttcttcctt 684
|||||||||||||||||||||
Sbjct: 242 ctcctcctcttcttcttcctt 262
>gb|BP663573.1|BP663573 BP663573 RAFL21 Arabidopsis thaliana cDNA clone RAFL21-48-L13 3',
mRNA sequence
Length = 381
Score = 42.1 bits (21), Expect = 0.12
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 664 ctcctcctcttcttcttcctt 684
|||||||||||||||||||||
Sbjct: 252 ctcctcctcttcttcttcctt 272
>gb|BP668184.1|BP668184 BP668184 RAFL21 Arabidopsis thaliana cDNA clone RAFL21-26-D23 3',
mRNA sequence
Length = 401
Score = 42.1 bits (21), Expect = 0.12
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 664 ctcctcctcttcttcttcctt 684
|||||||||||||||||||||
Sbjct: 242 ctcctcctcttcttcttcctt 262
>gb|BP782693.1|BP782693 BP782693 RAFL7 Arabidopsis thaliana cDNA clone RAFL07-83-D10 3',
mRNA sequence
Length = 417
Score = 42.1 bits (21), Expect = 0.12
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 664 ctcctcctcttcttcttcctt 684
|||||||||||||||||||||
Sbjct: 235 ctcctcctcttcttcttcctt 255
>gb|BP787746.1|BP787746 BP787746 RAFL7 Arabidopsis thaliana cDNA clone RAFL26-05-H24 3',
mRNA sequence
Length = 388
Score = 42.1 bits (21), Expect = 0.12
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 664 ctcctcctcttcttcttcctt 684
|||||||||||||||||||||
Sbjct: 244 ctcctcctcttcttcttcctt 264
>gb|BP789400.1|BP789400 BP789400 RAFL7 Arabidopsis thaliana cDNA clone RAFL07-38-K07 3',
mRNA sequence
Length = 416
Score = 42.1 bits (21), Expect = 0.12
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 664 ctcctcctcttcttcttcctt 684
|||||||||||||||||||||
Sbjct: 235 ctcctcctcttcttcttcctt 255
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 462,296
Number of Sequences: 1013581
Number of extensions: 462296
Number of successful extensions: 47570
Number of sequences better than 0.5: 101
Number of HSP's better than 0.5 without gapping: 105
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 44571
Number of HSP's gapped (non-prelim): 2977
length of query: 687
length of database: 908,940,872
effective HSP length: 20
effective length of query: 667
effective length of database: 888,669,252
effective search space: 592742391084
effective search space used: 592742391084
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)