BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 5705280.3.1
(980 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AV802365.1|AV802365 AV802365 RAFL9 Arabidopsis thaliana ... 44 0.045
gb|BP594029.1|BP594029 BP594029 RAFL15 Arabidopsis thaliana... 44 0.045
gb|BP608365.1|BP608365 BP608365 RAFL16 Arabidopsis thaliana... 44 0.045
gb|BP614110.1|BP614110 BP614110 RAFL16 Arabidopsis thaliana... 44 0.045
gb|BP624748.1|BP624748 BP624748 RAFL17 Arabidopsis thaliana... 44 0.045
gb|AY058092.1| Arabidopsis thaliana At1g63170/F16M19_7 mRNA... 44 0.045
gb|AY086095.1| Arabidopsis thaliana clone 21249 mRNA, compl... 44 0.045
gb|AC010795.5|AC010795 Arabidopsis thaliana chromosome 1 BA... 44 0.045
gb|AE005173.1| Arabidopsis thaliana chromosome 1, bottom ar... 44 0.045
ref|NM_104995.2| Arabidopsis thaliana protein binding / ubi... 44 0.045
ref|NC_003070.5| Arabidopsis thaliana chromosome 1, complet... 44 0.045
gb|BP626201.1|BP626201 BP626201 RAFL17 Arabidopsis thaliana... 38 2.8
gb|AY057103.1| Arabidopsis thaliana flavin-containing monoo... 38 2.8
gb|AY133691.1| Arabidopsis thaliana clone C103154 unknown p... 38 2.8
emb|BX826411.1|CNS0A416 Arabidopsis thaliana Full-length cD... 38 2.8
emb|AJ270060.1| Arabidopsis thaliana DNA chromosome 4, long... 38 2.8
emb|AL049751.1|ATF17N18 Arabidopsis thaliana DNA chromosome... 38 2.8
emb|AL161536.2|ATCHRIV36 Arabidopsis thaliana DNA chromosom... 38 2.8
ref|NM_117399.3| Arabidopsis thaliana disulfide oxidoreduct... 38 2.8
ref|NC_003075.3| Arabidopsis thaliana chromosome 4, complet... 38 2.8
>gb|AV802365.1|AV802365 AV802365 RAFL9 Arabidopsis thaliana cDNA clone RAFL09-31-K08 3',
mRNA sequence
Length = 411
Score = 44.1 bits (22), Expect = 0.045
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 944 gtaagaagaggaaacttgcaaa 965
||||||||||||||||||||||
Sbjct: 212 gtaagaagaggaaacttgcaaa 191
>gb|BP594029.1|BP594029 BP594029 RAFL15 Arabidopsis thaliana cDNA clone RAFL15-24-G10 3',
mRNA sequence
Length = 409
Score = 44.1 bits (22), Expect = 0.045
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 944 gtaagaagaggaaacttgcaaa 965
||||||||||||||||||||||
Sbjct: 226 gtaagaagaggaaacttgcaaa 205
>gb|BP608365.1|BP608365 BP608365 RAFL16 Arabidopsis thaliana cDNA clone RAFL16-78-F17 3',
mRNA sequence
Length = 409
Score = 44.1 bits (22), Expect = 0.045
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 944 gtaagaagaggaaacttgcaaa 965
||||||||||||||||||||||
Sbjct: 226 gtaagaagaggaaacttgcaaa 205
>gb|BP614110.1|BP614110 BP614110 RAFL16 Arabidopsis thaliana cDNA clone RAFL16-95-J21 3',
mRNA sequence
Length = 418
Score = 44.1 bits (22), Expect = 0.045
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 944 gtaagaagaggaaacttgcaaa 965
||||||||||||||||||||||
Sbjct: 254 gtaagaagaggaaacttgcaaa 233
>gb|BP624748.1|BP624748 BP624748 RAFL17 Arabidopsis thaliana cDNA clone RAFL17-41-G03 3',
mRNA sequence
Length = 427
Score = 44.1 bits (22), Expect = 0.045
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 944 gtaagaagaggaaacttgcaaa 965
||||||||||||||||||||||
Sbjct: 309 gtaagaagaggaaacttgcaaa 288
>gb|AY058092.1| Arabidopsis thaliana At1g63170/F16M19_7 mRNA, complete cds
Length = 1592
Score = 44.1 bits (22), Expect = 0.045
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 944 gtaagaagaggaaacttgcaaa 965
||||||||||||||||||||||
Sbjct: 1381 gtaagaagaggaaacttgcaaa 1402
>gb|AY086095.1| Arabidopsis thaliana clone 21249 mRNA, complete sequence
Length = 1589
Score = 44.1 bits (22), Expect = 0.045
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 944 gtaagaagaggaaacttgcaaa 965
||||||||||||||||||||||
Sbjct: 1365 gtaagaagaggaaacttgcaaa 1386
>gb|AC010795.5|AC010795 Arabidopsis thaliana chromosome 1 BAC F16M19 genomic sequence, complete
sequence
Length = 100512
Score = 44.1 bits (22), Expect = 0.045
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 944 gtaagaagaggaaacttgcaaa 965
||||||||||||||||||||||
Sbjct: 78313 gtaagaagaggaaacttgcaaa 78334
>gb|AE005173.1| Arabidopsis thaliana chromosome 1, bottom arm complete sequence
Length = 14668883
Score = 44.1 bits (22), Expect = 0.045
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 944 gtaagaagaggaaacttgcaaa 965
||||||||||||||||||||||
Sbjct: 7668402 gtaagaagaggaaacttgcaaa 7668423
>ref|NM_104995.2| Arabidopsis thaliana protein binding / ubiquitin-protein ligase/ zinc
ion binding AT1G63170 mRNA, complete cds
Length = 1604
Score = 44.1 bits (22), Expect = 0.045
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 944 gtaagaagaggaaacttgcaaa 965
||||||||||||||||||||||
Sbjct: 1381 gtaagaagaggaaacttgcaaa 1402
>ref|NC_003070.5| Arabidopsis thaliana chromosome 1, complete sequence
Length = 30432563
Score = 44.1 bits (22), Expect = 0.045
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 944 gtaagaagaggaaacttgcaaa 965
||||||||||||||||||||||
Sbjct: 23430751 gtaagaagaggaaacttgcaaa 23430772
>gb|BP626201.1|BP626201 BP626201 RAFL17 Arabidopsis thaliana cDNA clone RAFL17-46-L19 3',
mRNA sequence
Length = 442
Score = 38.2 bits (19), Expect = 2.8
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 944 gtaagaagaggaaacttgc 962
|||||||||||||||||||
Sbjct: 310 gtaagaagaggaaacttgc 292
>gb|AY057103.1| Arabidopsis thaliana flavin-containing monooxygenase YUCCA2
(YUCCA2) gene, complete cds
Length = 1777
Score = 38.2 bits (19), Expect = 2.8
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 788 gtggtttccagtgcacgtg 806
|||||||||||||||||||
Sbjct: 737 gtggtttccagtgcacgtg 719
>gb|AY133691.1| Arabidopsis thaliana clone C103154 unknown protein (At4g13260)
mRNA, complete cds
Length = 1279
Score = 38.2 bits (19), Expect = 2.8
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 788 gtggtttccagtgcacgtg 806
|||||||||||||||||||
Sbjct: 744 gtggtttccagtgcacgtg 762
>emb|BX826411.1|CNS0A416 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTFB23ZD12 of Flowers and buds of strain col-0 of
Arabidopsis thaliana (thale cress)
Length = 1844
Score = 38.2 bits (19), Expect = 2.8
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 788 gtggtttccagtgcacgtg 806
|||||||||||||||||||
Sbjct: 1118 gtggtttccagtgcacgtg 1136
>emb|AJ270060.1| Arabidopsis thaliana DNA chromosome 4, long arm
Length = 14497843
Score = 38.2 bits (19), Expect = 2.8
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 788 gtggtttccagtgcacgtg 806
|||||||||||||||||||
Sbjct: 3635314 gtggtttccagtgcacgtg 3635296
>emb|AL049751.1|ATF17N18 Arabidopsis thaliana DNA chromosome 4, BAC clone F17N18 (ESSA project)
Length = 86377
Score = 38.2 bits (19), Expect = 2.8
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 788 gtggtttccagtgcacgtg 806
|||||||||||||||||||
Sbjct: 79712 gtggtttccagtgcacgtg 79694
>emb|AL161536.2|ATCHRIV36 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 36
Length = 199634
Score = 38.2 bits (19), Expect = 2.8
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 788 gtggtttccagtgcacgtg 806
|||||||||||||||||||
Sbjct: 9317 gtggtttccagtgcacgtg 9299
>ref|NM_117399.3| Arabidopsis thaliana disulfide oxidoreductase/ monooxygenase/
oxidoreductase AT4G13260 mRNA, complete cds
Length = 1843
Score = 38.2 bits (19), Expect = 2.8
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 788 gtggtttccagtgcacgtg 806
|||||||||||||||||||
Sbjct: 1117 gtggtttccagtgcacgtg 1135
>ref|NC_003075.3| Arabidopsis thaliana chromosome 4, complete sequence
Length = 18585042
Score = 38.2 bits (19), Expect = 2.8
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 788 gtggtttccagtgcacgtg 806
|||||||||||||||||||
Sbjct: 7722572 gtggtttccagtgcacgtg 7722554
Database: At_nucl_with_EST.fasta
Posted date: May 2, 2006 2:53 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 409,217
Number of Sequences: 1013581
Number of extensions: 409217
Number of successful extensions: 29780
Number of sequences better than 10.0: 20
Number of HSP's better than 10.0 without gapping: 20
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 29143
Number of HSP's gapped (non-prelim): 637
length of query: 980
length of database: 908,940,872
effective HSP length: 20
effective length of query: 960
effective length of database: 888,669,252
effective search space: 853122481920
effective search space used: 853122481920
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)