BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 5351892.2.1
(466 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
emb|AL759786.1| Arabidopsis thaliana T-DNA flanking sequenc... 42 0.083
gb|AC007519.2|F16N3 Sequence of BAC F16N3 from Arabidopsis ... 42 0.083
gb|AC012463.4|AC012463 Genomic sequence for Arabidopsis tha... 42 0.083
gb|AE005173.1| Arabidopsis thaliana chromosome 1, bottom ar... 42 0.083
ref|NM_103666.1| Arabidopsis thaliana unknown protein AT1G4... 42 0.083
ref|NC_003070.5| Arabidopsis thaliana chromosome 1, complet... 42 0.083
gb|B61165.1|B61165 T20P7TF TAMU Arabidopsis thaliana genomi... 40 0.33
gb|CL506591.1|CL506591 SAIL_76_D06.v1 SAIL Collection Arabi... 40 0.33
gb|BP599808.1|BP599808 BP599808 RAFL16 Arabidopsis thaliana... 40 0.33
gb|BP843736.1|BP843736 BP843736 RAFL21 Arabidopsis thaliana... 40 0.33
gb|BP848487.1|BP848487 BP848487 RAFL21 Arabidopsis thaliana... 40 0.33
gb|BP867079.1|BP867079 BP867079 RAFL21 Arabidopsis thaliana... 40 0.33
gb|AY093078.1| Arabidopsis thaliana unknown protein (At5g62... 40 0.33
gb|AY128766.1| Arabidopsis thaliana unknown protein (At5g62... 40 0.33
gb|AC010718.5|AC010718 Arabidopsis thaliana chromosome 1 BA... 40 0.33
dbj|AB019235.1| Arabidopsis thaliana genomic DNA, chromosom... 40 0.33
dbj|BA000015.5| Arabidopsis thaliana DNA, chromosome 5, com... 40 0.33
ref|NM_125633.3| Arabidopsis thaliana calmodulin binding AT... 40 0.33
ref|NM_106322.2| Arabidopsis thaliana GTP binding / transla... 40 0.33
ref|NC_003076.4| Arabidopsis thaliana chromosome 5, complet... 40 0.33
>emb|AL759786.1| Arabidopsis thaliana T-DNA flanking sequence GK-190F12-014641,
genomic survey sequence
Length = 251
Score = 42.1 bits (21), Expect = 0.083
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 286 attgttatgcttattcttattcttcttct 314
||||| || ||||||||||||||||||||
Sbjct: 177 attgtgattcttattcttattcttcttct 205
>gb|AC007519.2|F16N3 Sequence of BAC F16N3 from Arabidopsis thaliana chromosome 1,
complete sequence
Length = 171769
Score = 42.1 bits (21), Expect = 0.083
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 295 cttattcttattcttcttctg 315
|||||||||||||||||||||
Sbjct: 1430 cttattcttattcttcttctg 1450
>gb|AC012463.4|AC012463 Genomic sequence for Arabidopsis thaliana BAC T2E6 from chromosome I,
complete sequence
Length = 95816
Score = 42.1 bits (21), Expect = 0.083
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 295 cttattcttattcttcttctg 315
|||||||||||||||||||||
Sbjct: 78579 cttattcttattcttcttctg 78599
>gb|AE005173.1| Arabidopsis thaliana chromosome 1, bottom arm complete sequence
Length = 14668883
Score = 42.1 bits (21), Expect = 0.083
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 295 cttattcttattcttcttctg 315
|||||||||||||||||||||
Sbjct: 1924191 cttattcttattcttcttctg 1924171
Score = 40.1 bits (20), Expect = 0.33
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 295 cttattcttattcttcttct 314
||||||||||||||||||||
Sbjct: 13039225 cttattcttattcttcttct 13039244
>ref|NM_103666.1| Arabidopsis thaliana unknown protein AT1G47730 mRNA, complete cds
Length = 1176
Score = 42.1 bits (21), Expect = 0.083
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 295 cttattcttattcttcttctg 315
|||||||||||||||||||||
Sbjct: 287 cttattcttattcttcttctg 307
>ref|NC_003070.5| Arabidopsis thaliana chromosome 1, complete sequence
Length = 30432563
Score = 42.1 bits (21), Expect = 0.083
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 295 cttattcttattcttcttctg 315
|||||||||||||||||||||
Sbjct: 17567260 cttattcttattcttcttctg 17567240
Score = 40.1 bits (20), Expect = 0.33
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 295 cttattcttattcttcttct 314
||||||||||||||||||||
Sbjct: 28802907 cttattcttattcttcttct 28802926
>gb|B61165.1|B61165 T20P7TF TAMU Arabidopsis thaliana genomic clone T20P7, DNA sequence
Length = 318
Score = 40.1 bits (20), Expect = 0.33
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 295 cttattcttattcttcttct 314
||||||||||||||||||||
Sbjct: 144 cttattcttattcttcttct 125
>gb|CL506591.1|CL506591 SAIL_76_D06.v1 SAIL Collection Arabidopsis thaliana genomic clone
SAIL_76_D06.v1, DNA sequence
Length = 924
Score = 40.1 bits (20), Expect = 0.33
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 299 ttcttattcttcttctgcga 318
||||||||||||||||||||
Sbjct: 297 ttcttattcttcttctgcga 316
>gb|BP599808.1|BP599808 BP599808 RAFL16 Arabidopsis thaliana cDNA clone RAFL16-43-H05 3',
mRNA sequence
Length = 428
Score = 40.1 bits (20), Expect = 0.33
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 295 cttattcttattcttcttct 314
||||||||||||||||||||
Sbjct: 197 cttattcttattcttcttct 216
>gb|BP843736.1|BP843736 BP843736 RAFL21 Arabidopsis thaliana cDNA clone RAFL21-87-N18 5',
mRNA sequence
Length = 388
Score = 40.1 bits (20), Expect = 0.33
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 295 cttattcttattcttcttct 314
||||||||||||||||||||
Sbjct: 86 cttattcttattcttcttct 67
>gb|BP848487.1|BP848487 BP848487 RAFL21 Arabidopsis thaliana cDNA clone RAFL25-05-J04 5',
mRNA sequence
Length = 379
Score = 40.1 bits (20), Expect = 0.33
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 295 cttattcttattcttcttct 314
||||||||||||||||||||
Sbjct: 86 cttattcttattcttcttct 67
>gb|BP867079.1|BP867079 BP867079 RAFL21 Arabidopsis thaliana cDNA clone RAFL21-79-N19 5',
mRNA sequence
Length = 388
Score = 40.1 bits (20), Expect = 0.33
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 295 cttattcttattcttcttct 314
||||||||||||||||||||
Sbjct: 86 cttattcttattcttcttct 67
>gb|AY093078.1| Arabidopsis thaliana unknown protein (At5g62390) mRNA, complete cds
Length = 1684
Score = 40.1 bits (20), Expect = 0.33
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 295 cttattcttattcttcttct 314
||||||||||||||||||||
Sbjct: 647 cttattcttattcttcttct 628
>gb|AY128766.1| Arabidopsis thaliana unknown protein (At5g62390) mRNA, complete cds
Length = 1505
Score = 40.1 bits (20), Expect = 0.33
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 295 cttattcttattcttcttct 314
||||||||||||||||||||
Sbjct: 603 cttattcttattcttcttct 584
>gb|AC010718.5|AC010718 Arabidopsis thaliana chromosome 1 BAC F28O16 genomic sequence, complete
sequence
Length = 87684
Score = 40.1 bits (20), Expect = 0.33
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 295 cttattcttattcttcttct 314
||||||||||||||||||||
Sbjct: 34785 cttattcttattcttcttct 34804
>dbj|AB019235.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MMI9
Length = 81736
Score = 40.1 bits (20), Expect = 0.33
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 295 cttattcttattcttcttct 314
||||||||||||||||||||
Sbjct: 75018 cttattcttattcttcttct 75037
>dbj|BA000015.5| Arabidopsis thaliana DNA, chromosome 5, complete sequence
Length = 23810767
Score = 40.1 bits (20), Expect = 0.33
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 295 cttattcttattcttcttct 314
||||||||||||||||||||
Sbjct: 22228881 cttattcttattcttcttct 22228900
>ref|NM_125633.3| Arabidopsis thaliana calmodulin binding AT5G62390 mRNA, complete
cds
Length = 1788
Score = 40.1 bits (20), Expect = 0.33
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 295 cttattcttattcttcttct 314
||||||||||||||||||||
Sbjct: 722 cttattcttattcttcttct 703
>ref|NM_106322.2| Arabidopsis thaliana GTP binding / translation initiation factor
AT1G76720 mRNA, complete cds
Length = 3606
Score = 40.1 bits (20), Expect = 0.33
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 295 cttattcttattcttcttct 314
||||||||||||||||||||
Sbjct: 729 cttattcttattcttcttct 710
>ref|NC_003076.4| Arabidopsis thaliana chromosome 5, complete sequence
Length = 26992728
Score = 40.1 bits (20), Expect = 0.33
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 295 cttattcttattcttcttct 314
||||||||||||||||||||
Sbjct: 25070794 cttattcttattcttcttct 25070813
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 238,511
Number of Sequences: 1013581
Number of extensions: 238511
Number of successful extensions: 19427
Number of sequences better than 0.5: 20
Number of HSP's better than 0.5 without gapping: 22
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 18809
Number of HSP's gapped (non-prelim): 615
length of query: 466
length of database: 908,940,872
effective HSP length: 20
effective length of query: 446
effective length of database: 888,669,252
effective search space: 396346486392
effective search space used: 396346486392
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)