BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3748535.2.1
(619 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AV823019.1|AV823019 AV823019 RAFL5 Arabidopsis thaliana ... 42 0.11
gb|CB261810.1|CB261810 86-E8974-008-017-K21-pBl2 MPIZ-ADIS-... 42 0.11
gb|AV526322.1|AV526322 AV526322 Arabidopsis thaliana aboveg... 42 0.11
gb|AV526630.1|AV526630 AV526630 Arabidopsis thaliana aboveg... 42 0.11
gb|AV540625.1|AV540625 AV540625 Arabidopsis thaliana roots ... 42 0.11
gb|CK119751.1|CK119751 201f11.p1 AtM1 Arabidopsis thaliana ... 42 0.11
gb|AF090372.1|AF090372 Arabidopsis thaliana SAM:cycloarteno... 42 0.11
gb|AY120716.1| Arabidopsis thaliana 24-sterol C-methyltrans... 42 0.11
gb|AF494289.1| Arabidopsis thaliana cephalopod (CPH) mRNA, ... 42 0.11
gb|BT000058.1| Arabidopsis thaliana 24-sterol C-methyltrans... 42 0.11
emb|BX830674.1|CNS0A0QH Arabidopsis thaliana Full-length cD... 42 0.11
emb|BX831439.1|CNS0A23U Arabidopsis thaliana Full-length cD... 42 0.11
emb|CQ804624.1| Sequence 1035 from Patent WO2004035798 42 0.11
gb|AF195648.1| Arabidopsis thaliana sterol methyltransferas... 42 0.11
gb|BT015538.1| Arabidopsis thaliana At5g13710 mRNA sequence 42 0.11
ref|NM_121374.2| Arabidopsis thaliana SMT1 (STEROL METHYLTR... 42 0.11
gb|BP848714.1|BP848714 BP848714 RAFL21 Arabidopsis thaliana... 40 0.44
gb|BP854436.1|BP854436 BP854436 RAFL21 Arabidopsis thaliana... 40 0.44
dbj|AB006704.1| Arabidopsis thaliana genomic DNA, chromosom... 40 0.44
dbj|BA000015.5| Arabidopsis thaliana DNA, chromosome 5, com... 40 0.44
ref|NC_003076.4| Arabidopsis thaliana chromosome 5, complet... 40 0.44
>gb|AV823019.1|AV823019 AV823019 RAFL5 Arabidopsis thaliana cDNA clone RAFL05-14-G19 5',
mRNA sequence
Length = 660
Score = 42.1 bits (21), Expect = 0.11
Identities = 45/53 (84%)
Strand = Plus / Plus
Query: 342 tggatgtgggatgtggaattgggggacctttaatagaaatcgccagattcagc 394
||||||| |||||||||||||| ||||| || | ||||| || |||||||||
Sbjct: 362 tggatgtaggatgtggaattggtggaccgttgagggaaattgcaagattcagc 414
>gb|CB261810.1|CB261810 86-E8974-008-017-K21-pBl2 MPIZ-ADIS-008 Arabidopsis thaliana cDNA
clone MPIZp767K2117Q 5-PRIME, mRNA sequence
Length = 547
Score = 42.1 bits (21), Expect = 0.11
Identities = 45/53 (84%)
Strand = Plus / Plus
Query: 342 tggatgtgggatgtggaattgggggacctttaatagaaatcgccagattcagc 394
||||||| |||||||||||||| ||||| || | ||||| || |||||||||
Sbjct: 282 tggatgtaggatgtggaattggtggaccgttgagggaaattgcaagattcagc 334
>gb|AV526322.1|AV526322 AV526322 Arabidopsis thaliana aboveground organs two to six-week
old Arabidopsis thaliana cDNA clone APZ10c01R 5', mRNA
sequence
Length = 553
Score = 42.1 bits (21), Expect = 0.11
Identities = 45/53 (84%)
Strand = Plus / Plus
Query: 342 tggatgtgggatgtggaattgggggacctttaatagaaatcgccagattcagc 394
||||||| |||||||||||||| ||||| || | ||||| || |||||||||
Sbjct: 362 tggatgtaggatgtggaattggtggaccgttgagggaaattgcaagattcagc 414
>gb|AV526630.1|AV526630 AV526630 Arabidopsis thaliana aboveground organs two to six-week
old Arabidopsis thaliana cDNA clone APZ17h10R 5', mRNA
sequence
Length = 491
Score = 42.1 bits (21), Expect = 0.11
Identities = 45/53 (84%)
Strand = Plus / Plus
Query: 342 tggatgtgggatgtggaattgggggacctttaatagaaatcgccagattcagc 394
||||||| |||||||||||||| ||||| || | ||||| || |||||||||
Sbjct: 362 tggatgtaggatgtggaattggtggaccgttgagggaaattgcaagattcagc 414
>gb|AV540625.1|AV540625 AV540625 Arabidopsis thaliana roots Columbia Arabidopsis thaliana
cDNA clone RZ152g09F 3', mRNA sequence
Length = 603
Score = 42.1 bits (21), Expect = 0.11
Identities = 45/53 (84%)
Strand = Plus / Plus
Query: 342 tggatgtgggatgtggaattgggggacctttaatagaaatcgccagattcagc 394
||||||| |||||||||||||| ||||| || | ||||| || |||||||||
Sbjct: 334 tggatgtaggatgtggaattggtggaccgttgagggaaattgcaagattcagc 386
>gb|CK119751.1|CK119751 201f11.p1 AtM1 Arabidopsis thaliana cDNA clone MPMGp2011F11201
5-PRIME, mRNA sequence
Length = 831
Score = 42.1 bits (21), Expect = 0.11
Identities = 45/53 (84%)
Strand = Plus / Plus
Query: 342 tggatgtgggatgtggaattgggggacctttaatagaaatcgccagattcagc 394
||||||| |||||||||||||| ||||| || | ||||| || |||||||||
Sbjct: 349 tggatgtaggatgtggaattggtggaccgttgagggaaattgcaagattcagc 401
>gb|AF090372.1|AF090372 Arabidopsis thaliana SAM:cycloartenol-C24-methyltransferase (SMT1)
mRNA, complete cds
Length = 1269
Score = 42.1 bits (21), Expect = 0.11
Identities = 45/53 (84%)
Strand = Plus / Plus
Query: 342 tggatgtgggatgtggaattgggggacctttaatagaaatcgccagattcagc 394
||||||| |||||||||||||| ||||| || | ||||| || |||||||||
Sbjct: 338 tggatgtaggatgtggaattggtggaccgttgagggaaattgcaagattcagc 390
>gb|AY120716.1| Arabidopsis thaliana 24-sterol C-methyltransferase (At5g13710)
mRNA, complete cds
Length = 1245
Score = 42.1 bits (21), Expect = 0.11
Identities = 45/53 (84%)
Strand = Plus / Plus
Query: 342 tggatgtgggatgtggaattgggggacctttaatagaaatcgccagattcagc 394
||||||| |||||||||||||| ||||| || | ||||| || |||||||||
Sbjct: 363 tggatgtaggatgtggaattggtggaccgttgagggaaattgcaagattcagc 415
>gb|AF494289.1| Arabidopsis thaliana cephalopod (CPH) mRNA, complete cds
Length = 1080
Score = 42.1 bits (21), Expect = 0.11
Identities = 45/53 (84%)
Strand = Plus / Plus
Query: 342 tggatgtgggatgtggaattgggggacctttaatagaaatcgccagattcagc 394
||||||| |||||||||||||| ||||| || | ||||| || |||||||||
Sbjct: 365 tggatgtaggatgtggaattggtggaccgttgagggaaattgcaagattcagc 417
>gb|BT000058.1| Arabidopsis thaliana 24-sterol C-methyltransferase (At5g13710)
mRNA, complete cds
Length = 1108
Score = 42.1 bits (21), Expect = 0.11
Identities = 45/53 (84%)
Strand = Plus / Plus
Query: 342 tggatgtgggatgtggaattgggggacctttaatagaaatcgccagattcagc 394
||||||| |||||||||||||| ||||| || | ||||| || |||||||||
Sbjct: 296 tggatgtaggatgtggaattggtggaccgttgagggaaattgcaagattcagc 348
>emb|BX830674.1|CNS0A0QH Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTLS13ZC03 of Adult vegetative tissue of strain col-0
of Arabidopsis thaliana (thale cress)
Length = 1283
Score = 42.1 bits (21), Expect = 0.11
Identities = 45/53 (84%)
Strand = Plus / Plus
Query: 342 tggatgtgggatgtggaattgggggacctttaatagaaatcgccagattcagc 394
||||||| |||||||||||||| ||||| || | ||||| || |||||||||
Sbjct: 347 tggatgtaggatgtggaattggtggaccgttgagggaaattgcaagattcagc 399
>emb|BX831439.1|CNS0A23U Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTLS90ZE01 of Adult vegetative tissue of strain col-0
of Arabidopsis thaliana (thale cress)
Length = 1198
Score = 42.1 bits (21), Expect = 0.11
Identities = 45/53 (84%)
Strand = Plus / Plus
Query: 342 tggatgtgggatgtggaattgggggacctttaatagaaatcgccagattcagc 394
||||||| |||||||||||||| ||||| || | ||||| || |||||||||
Sbjct: 322 tggatgtaggatgtggaattggtggaccgttgagggaaattgcaagattcagc 374
>emb|CQ804624.1| Sequence 1035 from Patent WO2004035798
Length = 1011
Score = 42.1 bits (21), Expect = 0.11
Identities = 45/53 (84%)
Strand = Plus / Plus
Query: 342 tggatgtgggatgtggaattgggggacctttaatagaaatcgccagattcagc 394
||||||| |||||||||||||| ||||| || | ||||| || |||||||||
Sbjct: 296 tggatgtaggatgtggaattggtggaccgttgagggaaattgcaagattcagc 348
>gb|AF195648.1| Arabidopsis thaliana sterol methyltransferase SMT1 (SMT1) mRNA,
complete cds
Length = 1257
Score = 42.1 bits (21), Expect = 0.11
Identities = 45/53 (84%)
Strand = Plus / Plus
Query: 342 tggatgtgggatgtggaattgggggacctttaatagaaatcgccagattcagc 394
||||||| |||||||||||||| ||||| || | ||||| || |||||||||
Sbjct: 349 tggatgtaggatgtggaattggtggaccgttgagggaaattgcaagattcagc 401
>gb|BT015538.1| Arabidopsis thaliana At5g13710 mRNA sequence
Length = 1008
Score = 42.1 bits (21), Expect = 0.11
Identities = 45/53 (84%)
Strand = Plus / Plus
Query: 342 tggatgtgggatgtggaattgggggacctttaatagaaatcgccagattcagc 394
||||||| |||||||||||||| ||||| || | ||||| || |||||||||
Sbjct: 293 tggatgtaggatgtggaattggtggaccgttgagggaaattgcaagattcagc 345
>ref|NM_121374.2| Arabidopsis thaliana SMT1 (STEROL METHYLTRANSFERASE 1) AT5G13710
(SMT1) mRNA, complete cds
Length = 1462
Score = 42.1 bits (21), Expect = 0.11
Identities = 45/53 (84%)
Strand = Plus / Plus
Query: 342 tggatgtgggatgtggaattgggggacctttaatagaaatcgccagattcagc 394
||||||| |||||||||||||| ||||| || | ||||| || |||||||||
Sbjct: 394 tggatgtaggatgtggaattggtggaccgttgagggaaattgcaagattcagc 446
>gb|BP848714.1|BP848714 BP848714 RAFL21 Arabidopsis thaliana cDNA clone RAFL25-06-G16 5',
mRNA sequence
Length = 414
Score = 40.1 bits (20), Expect = 0.44
Identities = 26/28 (92%)
Strand = Plus / Plus
Query: 342 tggatgtgggatgtggaattgggggacc 369
||||||| |||||||||||||| |||||
Sbjct: 370 tggatgtaggatgtggaattggtggacc 397
>gb|BP854436.1|BP854436 BP854436 RAFL21 Arabidopsis thaliana cDNA clone RAFL21-61-K16 5',
mRNA sequence
Length = 304
Score = 40.1 bits (20), Expect = 0.44
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 36 gctgctccgggaagaacaag 55
||||||||||||||||||||
Sbjct: 78 gctgctccgggaagaacaag 97
>dbj|AB006704.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MSH12
Length = 79259
Score = 40.1 bits (20), Expect = 0.44
Identities = 26/28 (92%)
Strand = Plus / Minus
Query: 342 tggatgtgggatgtggaattgggggacc 369
||||||| |||||||||||||| |||||
Sbjct: 68755 tggatgtaggatgtggaattggtggacc 68728
>dbj|BA000015.5| Arabidopsis thaliana DNA, chromosome 5, complete sequence
Length = 23810767
Score = 40.1 bits (20), Expect = 0.44
Identities = 26/28 (92%)
Strand = Plus / Minus
Query: 342 tggatgtgggatgtggaattgggggacc 369
||||||| |||||||||||||| |||||
Sbjct: 4238525 tggatgtaggatgtggaattggtggacc 4238498
>ref|NC_003076.4| Arabidopsis thaliana chromosome 5, complete sequence
Length = 26992728
Score = 40.1 bits (20), Expect = 0.44
Identities = 26/28 (92%)
Strand = Plus / Minus
Query: 342 tggatgtgggatgtggaattgggggacc 369
||||||| |||||||||||||| |||||
Sbjct: 4425552 tggatgtaggatgtggaattggtggacc 4425525
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 270,318
Number of Sequences: 1013581
Number of extensions: 270318
Number of successful extensions: 17931
Number of sequences better than 0.5: 21
Number of HSP's better than 0.5 without gapping: 21
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 17737
Number of HSP's gapped (non-prelim): 194
length of query: 619
length of database: 908,940,872
effective HSP length: 20
effective length of query: 599
effective length of database: 888,669,252
effective search space: 532312881948
effective search space used: 532312881948
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)