BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3713139.2.1
(487 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CW796426.1|CW796426 WiscDsLox436B7 Arabidopsis thaliana ... 52 9e-005
gb|AI099773.1|AI099773 33926 Lambda-PRL2 Arabidopsis thalia... 52 9e-005
gb|AI999756.1|AI999756 701557309 A. thaliana, Columbia Col-... 52 9e-005
gb|AV792950.1|AV792950 AV792950 RAFL7 Arabidopsis thaliana ... 52 9e-005
gb|AV802869.1|AV802869 AV802869 RAFL9 Arabidopsis thaliana ... 52 9e-005
gb|AV818722.1|AV818722 AV818722 RAFL9 Arabidopsis thaliana ... 52 9e-005
gb|AV819945.1|AV819945 AV819945 RAFL11 Arabidopsis thaliana... 52 9e-005
gb|AV536531.1|AV536531 AV536531 Arabidopsis thaliana liquid... 52 9e-005
gb|AV545118.1|AV545118 AV545118 Arabidopsis thaliana roots ... 52 9e-005
gb|AV545336.1|AV545336 AV545336 Arabidopsis thaliana roots ... 52 9e-005
gb|AV556752.1|AV556752 AV556752 Arabidopsis thaliana green ... 52 9e-005
gb|AV560648.1|AV560648 AV560648 Arabidopsis thaliana green ... 52 9e-005
gb|AV563562.1|AV563562 AV563562 Arabidopsis thaliana green ... 52 9e-005
gb|AV566403.1|AV566403 AV566403 Arabidopsis thaliana green ... 52 9e-005
gb|BP577030.1|BP577030 BP577030 RAFL14 Arabidopsis thaliana... 52 9e-005
gb|BP577402.1|BP577402 BP577402 RAFL14 Arabidopsis thaliana... 52 9e-005
gb|BP584642.1|BP584642 BP584642 RAFL14 Arabidopsis thaliana... 52 9e-005
gb|BP592566.1|BP592566 BP592566 RAFL15 Arabidopsis thaliana... 52 9e-005
gb|BP593947.1|BP593947 BP593947 RAFL15 Arabidopsis thaliana... 52 9e-005
gb|BP594499.1|BP594499 BP594499 RAFL15 Arabidopsis thaliana... 52 9e-005
gb|BP603949.1|BP603949 BP603949 RAFL16 Arabidopsis thaliana... 52 9e-005
gb|BP606879.1|BP606879 BP606879 RAFL16 Arabidopsis thaliana... 52 9e-005
gb|BP618854.1|BP618854 BP618854 RAFL16 Arabidopsis thaliana... 52 9e-005
gb|BP636679.1|BP636679 BP636679 RAFL19 Arabidopsis thaliana... 52 9e-005
gb|BP644152.1|BP644152 BP644152 RAFL19 Arabidopsis thaliana... 52 9e-005
gb|BP648172.1|BP648172 BP648172 RAFL19 Arabidopsis thaliana... 52 9e-005
gb|BP653101.1|BP653101 BP653101 RAFL19 Arabidopsis thaliana... 52 9e-005
gb|BP663427.1|BP663427 BP663427 RAFL21 Arabidopsis thaliana... 52 9e-005
gb|BP781110.1|BP781110 BP781110 RAFL7 Arabidopsis thaliana ... 52 9e-005
gb|BP781798.1|BP781798 BP781798 RAFL7 Arabidopsis thaliana ... 52 9e-005
gb|BP782998.1|BP782998 BP782998 RAFL7 Arabidopsis thaliana ... 52 9e-005
gb|BP785119.1|BP785119 BP785119 RAFL7 Arabidopsis thaliana ... 52 9e-005
gb|BP786038.1|BP786038 BP786038 RAFL7 Arabidopsis thaliana ... 52 9e-005
gb|BP787058.1|BP787058 BP787058 RAFL7 Arabidopsis thaliana ... 52 9e-005
gb|BP790002.1|BP790002 BP790002 RAFL7 Arabidopsis thaliana ... 52 9e-005
gb|BP792135.1|BP792135 BP792135 RAFL7 Arabidopsis thaliana ... 52 9e-005
gb|BP794766.1|BP794766 BP794766 RAFL7 Arabidopsis thaliana ... 52 9e-005
gb|BP794950.1|BP794950 BP794950 RAFL7 Arabidopsis thaliana ... 52 9e-005
gb|BP795121.1|BP795121 BP795121 RAFL7 Arabidopsis thaliana ... 52 9e-005
gb|AF424576.1|AF424576 Arabidopsis thaliana AT3g29360/MUO10... 52 9e-005
gb|AY088902.1| Arabidopsis thaliana clone 9930 mRNA, comple... 52 9e-005
dbj|AP001309.1| Arabidopsis thaliana genomic DNA, chromosom... 52 9e-005
dbj|BA000014.8| Arabidopsis thaliana, chromosome 3, complet... 52 9e-005
gb|BT021126.1| Arabidopsis thaliana At3g29360 gene, complet... 52 9e-005
ref|NM_113861.2| Arabidopsis thaliana UDP-glucose 6-dehydro... 52 9e-005
ref|NM_001035715.1| Arabidopsis thaliana UDP-glucose 6-dehy... 52 9e-005
ref|NC_003074.4| Arabidopsis thaliana chromosome 3, complet... 52 9e-005
gb|AV791275.1|AV791275 AV791275 RAFL7 Arabidopsis thaliana ... 48 0.001
gb|BP586933.1|BP586933 BP586933 RAFL15 Arabidopsis thaliana... 48 0.001
gb|BP593999.1|BP593999 BP593999 RAFL15 Arabidopsis thaliana... 48 0.001
gb|BP627791.1|BP627791 BP627791 RAFL17 Arabidopsis thaliana... 48 0.001
gb|BP644036.1|BP644036 BP644036 RAFL19 Arabidopsis thaliana... 48 0.001
gb|BP659687.1|BP659687 BP659687 RAFL19 Arabidopsis thaliana... 48 0.001
gb|BP669236.1|BP669236 BP669236 RAFL21 Arabidopsis thaliana... 48 0.001
gb|AV544991.1|AV544991 AV544991 Arabidopsis thaliana roots ... 44 0.022
gb|AV561795.1|AV561795 AV561795 Arabidopsis thaliana green ... 44 0.022
gb|BP659112.1|BP659112 BP659112 RAFL19 Arabidopsis thaliana... 42 0.087
>gb|CW796426.1|CW796426 WiscDsLox436B7 Arabidopsis thaliana T-DNA insertion flanking
sequences Arabidopsis thaliana genomic, DNA sequence
Length = 597
Score = 52.0 bits (26), Expect = 9e-005
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 265 acggctggcatgtccttgagccaatcgtcgagcggctt 302
||||| ||||||||||||||||| |||||||| |||||
Sbjct: 181 acggcaggcatgtccttgagccagtcgtcgagaggctt 218
>gb|AI099773.1|AI099773 33926 Lambda-PRL2 Arabidopsis thaliana cDNA clone 123A3XP 3', mRNA
sequence
Length = 375
Score = 52.0 bits (26), Expect = 9e-005
Identities = 35/38 (92%)
Strand = Plus / Minus
Query: 265 acggctggcatgtccttgagccaatcgtcgagcggctt 302
||||| ||||||||||||||||| |||||||| |||||
Sbjct: 262 acggcaggcatgtccttgagccagtcgtcgagaggctt 225
>gb|AI999756.1|AI999756 701557309 A. thaliana, Columbia Col-0, rosette-3 Arabidopsis
thaliana cDNA clone 701557309, mRNA sequence
Length = 608
Score = 52.0 bits (26), Expect = 9e-005
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 265 acggctggcatgtccttgagccaatcgtcgagcggctt 302
||||| ||||||||||||||||| |||||||| |||||
Sbjct: 211 acggcaggcatgtccttgagccagtcgtcgagaggctt 248
>gb|AV792950.1|AV792950 AV792950 RAFL7 Arabidopsis thaliana cDNA clone RAFL07-17-H07 3',
mRNA sequence
Length = 438
Score = 52.0 bits (26), Expect = 9e-005
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 265 acggctggcatgtccttgagccaatcgtcgagcggctt 302
||||| ||||||||||||||||| |||||||| |||||
Sbjct: 245 acggcaggcatgtccttgagccagtcgtcgagaggctt 282
>gb|AV802869.1|AV802869 AV802869 RAFL9 Arabidopsis thaliana cDNA clone RAFL09-33-I02 3',
mRNA sequence
Length = 440
Score = 52.0 bits (26), Expect = 9e-005
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 265 acggctggcatgtccttgagccaatcgtcgagcggctt 302
||||| ||||||||||||||||| |||||||| |||||
Sbjct: 294 acggcaggcatgtccttgagccagtcgtcgagaggctt 331
>gb|AV818722.1|AV818722 AV818722 RAFL9 Arabidopsis thaliana cDNA clone RAFL09-99-H08 3',
mRNA sequence
Length = 419
Score = 52.0 bits (26), Expect = 9e-005
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 265 acggctggcatgtccttgagccaatcgtcgagcggctt 302
||||| ||||||||||||||||| |||||||| |||||
Sbjct: 268 acggcaggcatgtccttgagccagtcgtcgagaggctt 305
>gb|AV819945.1|AV819945 AV819945 RAFL11 Arabidopsis thaliana cDNA clone RAFL11-08-B22 3',
mRNA sequence
Length = 415
Score = 52.0 bits (26), Expect = 9e-005
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 265 acggctggcatgtccttgagccaatcgtcgagcggctt 302
||||| ||||||||||||||||| |||||||| |||||
Sbjct: 219 acggcaggcatgtccttgagccagtcgtcgagaggctt 256
>gb|AV536531.1|AV536531 AV536531 Arabidopsis thaliana liquid-cultured seedlings Columbia
Arabidopsis thaliana cDNA clone pAZNII0247R 5', mRNA
sequence
Length = 415
Score = 52.0 bits (26), Expect = 9e-005
Identities = 35/38 (92%)
Strand = Plus / Minus
Query: 265 acggctggcatgtccttgagccaatcgtcgagcggctt 302
||||| ||||||||||||||||| |||||||| |||||
Sbjct: 185 acggcaggcatgtccttgagccagtcgtcgagaggctt 148
>gb|AV545118.1|AV545118 AV545118 Arabidopsis thaliana roots Columbia Arabidopsis thaliana
cDNA clone RZ72d08F 3', mRNA sequence
Length = 618
Score = 52.0 bits (26), Expect = 9e-005
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 265 acggctggcatgtccttgagccaatcgtcgagcggctt 302
||||| ||||||||||||||||| |||||||| |||||
Sbjct: 178 acggcaggcatgtccttgagccagtcgtcgagaggctt 215
>gb|AV545336.1|AV545336 AV545336 Arabidopsis thaliana roots Columbia Arabidopsis thaliana
cDNA clone RZ80a12F 3', mRNA sequence
Length = 375
Score = 52.0 bits (26), Expect = 9e-005
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 265 acggctggcatgtccttgagccaatcgtcgagcggctt 302
||||| ||||||||||||||||| |||||||| |||||
Sbjct: 245 acggcaggcatgtccttgagccagtcgtcgagaggctt 282
>gb|AV556752.1|AV556752 AV556752 Arabidopsis thaliana green siliques Columbia Arabidopsis
thaliana cDNA clone SQ051d06F 3', mRNA sequence
Length = 494
Score = 52.0 bits (26), Expect = 9e-005
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 265 acggctggcatgtccttgagccaatcgtcgagcggctt 302
||||| ||||||||||||||||| |||||||| |||||
Sbjct: 165 acggcaggcatgtccttgagccagtcgtcgagaggctt 202
>gb|AV560648.1|AV560648 AV560648 Arabidopsis thaliana green siliques Columbia Arabidopsis
thaliana cDNA clone SQ138c03F 3', mRNA sequence
Length = 353
Score = 52.0 bits (26), Expect = 9e-005
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 265 acggctggcatgtccttgagccaatcgtcgagcggctt 302
||||| ||||||||||||||||| |||||||| |||||
Sbjct: 245 acggcaggcatgtccttgagccagtcgtcgagaggctt 282
>gb|AV563562.1|AV563562 AV563562 Arabidopsis thaliana green siliques Columbia Arabidopsis
thaliana cDNA clone SQ189d12F 3', mRNA sequence
Length = 561
Score = 52.0 bits (26), Expect = 9e-005
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 265 acggctggcatgtccttgagccaatcgtcgagcggctt 302
||||| ||||||||||||||||| |||||||| |||||
Sbjct: 269 acggcaggcatgtccttgagccagtcgtcgagaggctt 306
>gb|AV566403.1|AV566403 AV566403 Arabidopsis thaliana green siliques Columbia Arabidopsis
thaliana cDNA clone SQ242g05F 3', mRNA sequence
Length = 386
Score = 52.0 bits (26), Expect = 9e-005
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 265 acggctggcatgtccttgagccaatcgtcgagcggctt 302
||||| ||||||||||||||||| |||||||| |||||
Sbjct: 245 acggcaggcatgtccttgagccagtcgtcgagaggctt 282
>gb|BP577030.1|BP577030 BP577030 RAFL14 Arabidopsis thaliana cDNA clone RAFL14-95-B07 3',
mRNA sequence
Length = 409
Score = 52.0 bits (26), Expect = 9e-005
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 265 acggctggcatgtccttgagccaatcgtcgagcggctt 302
||||| ||||||||||||||||| |||||||| |||||
Sbjct: 245 acggcaggcatgtccttgagccagtcgtcgagaggctt 282
>gb|BP577402.1|BP577402 BP577402 RAFL14 Arabidopsis thaliana cDNA clone RAFL14-96-J05 3',
mRNA sequence
Length = 386
Score = 52.0 bits (26), Expect = 9e-005
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 265 acggctggcatgtccttgagccaatcgtcgagcggctt 302
||||| ||||||||||||||||| |||||||| |||||
Sbjct: 245 acggcaggcatgtccttgagccagtcgtcgagaggctt 282
>gb|BP584642.1|BP584642 BP584642 RAFL14 Arabidopsis thaliana cDNA clone RAFL14-47-E06 3',
mRNA sequence
Length = 436
Score = 52.0 bits (26), Expect = 9e-005
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 265 acggctggcatgtccttgagccaatcgtcgagcggctt 302
||||| ||||||||||||||||| |||||||| |||||
Sbjct: 245 acggcaggcatgtccttgagccagtcgtcgagaggctt 282
>gb|BP592566.1|BP592566 BP592566 RAFL15 Arabidopsis thaliana cDNA clone RAFL15-18-M23 3',
mRNA sequence
Length = 463
Score = 52.0 bits (26), Expect = 9e-005
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 265 acggctggcatgtccttgagccaatcgtcgagcggctt 302
||||| ||||||||||||||||| |||||||| |||||
Sbjct: 246 acggcaggcatgtccttgagccagtcgtcgagaggctt 283
>gb|BP593947.1|BP593947 BP593947 RAFL15 Arabidopsis thaliana cDNA clone RAFL15-24-A19 3',
mRNA sequence
Length = 427
Score = 52.0 bits (26), Expect = 9e-005
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 265 acggctggcatgtccttgagccaatcgtcgagcggctt 302
||||| ||||||||||||||||| |||||||| |||||
Sbjct: 268 acggcaggcatgtccttgagccagtcgtcgagaggctt 305
>gb|BP594499.1|BP594499 BP594499 RAFL15 Arabidopsis thaliana cDNA clone RAFL15-26-C10 3',
mRNA sequence
Length = 451
Score = 52.0 bits (26), Expect = 9e-005
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 265 acggctggcatgtccttgagccaatcgtcgagcggctt 302
||||| ||||||||||||||||| |||||||| |||||
Sbjct: 245 acggcaggcatgtccttgagccagtcgtcgagaggctt 282
>gb|BP603949.1|BP603949 BP603949 RAFL16 Arabidopsis thaliana cDNA clone RAFL16-60-M01 3',
mRNA sequence
Length = 397
Score = 52.0 bits (26), Expect = 9e-005
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 265 acggctggcatgtccttgagccaatcgtcgagcggctt 302
||||| ||||||||||||||||| |||||||| |||||
Sbjct: 242 acggcaggcatgtccttgagccagtcgtcgagaggctt 279
>gb|BP606879.1|BP606879 BP606879 RAFL16 Arabidopsis thaliana cDNA clone RAFL16-72-K04 3',
mRNA sequence
Length = 436
Score = 52.0 bits (26), Expect = 9e-005
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 265 acggctggcatgtccttgagccaatcgtcgagcggctt 302
||||| ||||||||||||||||| |||||||| |||||
Sbjct: 244 acggcaggcatgtccttgagccagtcgtcgagaggctt 281
>gb|BP618854.1|BP618854 BP618854 RAFL16 Arabidopsis thaliana cDNA clone RAFL16-30-A09 3',
mRNA sequence
Length = 457
Score = 52.0 bits (26), Expect = 9e-005
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 265 acggctggcatgtccttgagccaatcgtcgagcggctt 302
||||| ||||||||||||||||| |||||||| |||||
Sbjct: 242 acggcaggcatgtccttgagccagtcgtcgagaggctt 279
>gb|BP636679.1|BP636679 BP636679 RAFL19 Arabidopsis thaliana cDNA clone RAFL19-01-J04 3',
mRNA sequence
Length = 404
Score = 52.0 bits (26), Expect = 9e-005
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 265 acggctggcatgtccttgagccaatcgtcgagcggctt 302
||||| ||||||||||||||||| |||||||| |||||
Sbjct: 270 acggcaggcatgtccttgagccagtcgtcgagaggctt 307
>gb|BP644152.1|BP644152 BP644152 RAFL19 Arabidopsis thaliana cDNA clone RAFL19-64-H14 3',
mRNA sequence
Length = 382
Score = 52.0 bits (26), Expect = 9e-005
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 265 acggctggcatgtccttgagccaatcgtcgagcggctt 302
||||| ||||||||||||||||| |||||||| |||||
Sbjct: 269 acggcaggcatgtccttgagccagtcgtcgagaggctt 306
>gb|BP648172.1|BP648172 BP648172 RAFL19 Arabidopsis thaliana cDNA clone RAFL19-77-N01 3',
mRNA sequence
Length = 334
Score = 52.0 bits (26), Expect = 9e-005
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 265 acggctggcatgtccttgagccaatcgtcgagcggctt 302
||||| ||||||||||||||||| |||||||| |||||
Sbjct: 175 acggcaggcatgtccttgagccagtcgtcgagaggctt 212
>gb|BP653101.1|BP653101 BP653101 RAFL19 Arabidopsis thaliana cDNA clone RAFL19-95-N13 3',
mRNA sequence
Length = 421
Score = 52.0 bits (26), Expect = 9e-005
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 265 acggctggcatgtccttgagccaatcgtcgagcggctt 302
||||| ||||||||||||||||| |||||||| |||||
Sbjct: 278 acggcaggcatgtccttgagccagtcgtcgagaggctt 315
>gb|BP663427.1|BP663427 BP663427 RAFL21 Arabidopsis thaliana cDNA clone RAFL21-48-A04 3',
mRNA sequence
Length = 367
Score = 52.0 bits (26), Expect = 9e-005
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 265 acggctggcatgtccttgagccaatcgtcgagcggctt 302
||||| ||||||||||||||||| |||||||| |||||
Sbjct: 268 acggcaggcatgtccttgagccagtcgtcgagaggctt 305
>gb|BP781110.1|BP781110 BP781110 RAFL7 Arabidopsis thaliana cDNA clone RAFL07-76-I12 3',
mRNA sequence
Length = 406
Score = 52.0 bits (26), Expect = 9e-005
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 265 acggctggcatgtccttgagccaatcgtcgagcggctt 302
||||| ||||||||||||||||| |||||||| |||||
Sbjct: 269 acggcaggcatgtccttgagccagtcgtcgagaggctt 306
>gb|BP781798.1|BP781798 BP781798 RAFL7 Arabidopsis thaliana cDNA clone RAFL07-79-J05 3',
mRNA sequence
Length = 398
Score = 52.0 bits (26), Expect = 9e-005
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 265 acggctggcatgtccttgagccaatcgtcgagcggctt 302
||||| ||||||||||||||||| |||||||| |||||
Sbjct: 246 acggcaggcatgtccttgagccagtcgtcgagaggctt 283
>gb|BP782998.1|BP782998 BP782998 RAFL7 Arabidopsis thaliana cDNA clone RAFL07-84-F17 3',
mRNA sequence
Length = 423
Score = 52.0 bits (26), Expect = 9e-005
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 265 acggctggcatgtccttgagccaatcgtcgagcggctt 302
||||| ||||||||||||||||| |||||||| |||||
Sbjct: 246 acggcaggcatgtccttgagccagtcgtcgagaggctt 283
>gb|BP785119.1|BP785119 BP785119 RAFL7 Arabidopsis thaliana cDNA clone RAFL07-93-I15 3',
mRNA sequence
Length = 436
Score = 52.0 bits (26), Expect = 9e-005
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 265 acggctggcatgtccttgagccaatcgtcgagcggctt 302
||||| ||||||||||||||||| |||||||| |||||
Sbjct: 242 acggcaggcatgtccttgagccagtcgtcgagaggctt 279
>gb|BP786038.1|BP786038 BP786038 RAFL7 Arabidopsis thaliana cDNA clone RAFL07-97-G10 3',
mRNA sequence
Length = 409
Score = 52.0 bits (26), Expect = 9e-005
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 265 acggctggcatgtccttgagccaatcgtcgagcggctt 302
||||| ||||||||||||||||| |||||||| |||||
Sbjct: 269 acggcaggcatgtccttgagccagtcgtcgagaggctt 306
>gb|BP787058.1|BP787058 BP787058 RAFL7 Arabidopsis thaliana cDNA clone RAFL26-02-N05 3',
mRNA sequence
Length = 436
Score = 52.0 bits (26), Expect = 9e-005
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 265 acggctggcatgtccttgagccaatcgtcgagcggctt 302
||||| ||||||||||||||||| |||||||| |||||
Sbjct: 245 acggcaggcatgtccttgagccagtcgtcgagaggctt 282
>gb|BP790002.1|BP790002 BP790002 RAFL7 Arabidopsis thaliana cDNA clone RAFL07-41-G18 3',
mRNA sequence
Length = 421
Score = 52.0 bits (26), Expect = 9e-005
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 265 acggctggcatgtccttgagccaatcgtcgagcggctt 302
||||| ||||||||||||||||| |||||||| |||||
Sbjct: 248 acggcaggcatgtccttgagccagtcgtcgagaggctt 285
>gb|BP792135.1|BP792135 BP792135 RAFL7 Arabidopsis thaliana cDNA clone RAFL07-50-I22 3',
mRNA sequence
Length = 407
Score = 52.0 bits (26), Expect = 9e-005
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 265 acggctggcatgtccttgagccaatcgtcgagcggctt 302
||||| ||||||||||||||||| |||||||| |||||
Sbjct: 246 acggcaggcatgtccttgagccagtcgtcgagaggctt 283
>gb|BP794766.1|BP794766 BP794766 RAFL7 Arabidopsis thaliana cDNA clone RAFL07-61-P09 3',
mRNA sequence
Length = 413
Score = 52.0 bits (26), Expect = 9e-005
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 265 acggctggcatgtccttgagccaatcgtcgagcggctt 302
||||| ||||||||||||||||| |||||||| |||||
Sbjct: 242 acggcaggcatgtccttgagccagtcgtcgagaggctt 279
>gb|BP794950.1|BP794950 BP794950 RAFL7 Arabidopsis thaliana cDNA clone RAFL07-62-M07 3',
mRNA sequence
Length = 414
Score = 52.0 bits (26), Expect = 9e-005
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 265 acggctggcatgtccttgagccaatcgtcgagcggctt 302
||||| ||||||||||||||||| |||||||| |||||
Sbjct: 246 acggcaggcatgtccttgagccagtcgtcgagaggctt 283
>gb|BP795121.1|BP795121 BP795121 RAFL7 Arabidopsis thaliana cDNA clone RAFL07-63-J20 3',
mRNA sequence
Length = 406
Score = 52.0 bits (26), Expect = 9e-005
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 265 acggctggcatgtccttgagccaatcgtcgagcggctt 302
||||| ||||||||||||||||| |||||||| |||||
Sbjct: 245 acggcaggcatgtccttgagccagtcgtcgagaggctt 282
>gb|AF424576.1|AF424576 Arabidopsis thaliana AT3g29360/MUO10_6 mRNA, complete cds
Length = 1793
Score = 52.0 bits (26), Expect = 9e-005
Identities = 35/38 (92%)
Strand = Plus / Minus
Query: 265 acggctggcatgtccttgagccaatcgtcgagcggctt 302
||||| ||||||||||||||||| |||||||| |||||
Sbjct: 1502 acggcaggcatgtccttgagccagtcgtcgagaggctt 1465
>gb|AY088902.1| Arabidopsis thaliana clone 9930 mRNA, complete sequence
Length = 1746
Score = 52.0 bits (26), Expect = 9e-005
Identities = 35/38 (92%)
Strand = Plus / Minus
Query: 265 acggctggcatgtccttgagccaatcgtcgagcggctt 302
||||| ||||||||||||||||| |||||||| |||||
Sbjct: 1502 acggcaggcatgtccttgagccagtcgtcgagaggctt 1465
>dbj|AP001309.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MUO10
Length = 77589
Score = 52.0 bits (26), Expect = 9e-005
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 265 acggctggcatgtccttgagccaatcgtcgagcggctt 302
||||| ||||||||||||||||| |||||||| |||||
Sbjct: 17023 acggcaggcatgtccttgagccagtcgtcgagaggctt 17060
>dbj|BA000014.8| Arabidopsis thaliana, chromosome 3, complete sequence
Length = 23403063
Score = 52.0 bits (26), Expect = 9e-005
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 265 acggctggcatgtccttgagccaatcgtcgagcggctt 302
||||| ||||||||||||||||| |||||||| |||||
Sbjct: 11188519 acggcaggcatgtccttgagccagtcgtcgagaggctt 11188556
>gb|BT021126.1| Arabidopsis thaliana At3g29360 gene, complete cds
Length = 1486
Score = 52.0 bits (26), Expect = 9e-005
Identities = 35/38 (92%)
Strand = Plus / Minus
Query: 265 acggctggcatgtccttgagccaatcgtcgagcggctt 302
||||| ||||||||||||||||| |||||||| |||||
Sbjct: 1449 acggcaggcatgtccttgagccagtcgtcgagaggctt 1412
>ref|NM_113861.2| Arabidopsis thaliana UDP-glucose 6-dehydrogenase AT3G29360 transcript
variant AT3G29360.1 mRNA, complete cds
Length = 1793
Score = 52.0 bits (26), Expect = 9e-005
Identities = 35/38 (92%)
Strand = Plus / Minus
Query: 265 acggctggcatgtccttgagccaatcgtcgagcggctt 302
||||| ||||||||||||||||| |||||||| |||||
Sbjct: 1502 acggcaggcatgtccttgagccagtcgtcgagaggctt 1465
>ref|NM_001035715.1| Arabidopsis thaliana UDP-glucose 6-dehydrogenase AT3G29360 transcript
variant AT3G29360.2 mRNA, complete cds
Length = 1790
Score = 52.0 bits (26), Expect = 9e-005
Identities = 35/38 (92%)
Strand = Plus / Minus
Query: 265 acggctggcatgtccttgagccaatcgtcgagcggctt 302
||||| ||||||||||||||||| |||||||| |||||
Sbjct: 1499 acggcaggcatgtccttgagccagtcgtcgagaggctt 1462
>ref|NC_003074.4| Arabidopsis thaliana chromosome 3, complete sequence
Length = 23470805
Score = 52.0 bits (26), Expect = 9e-005
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 265 acggctggcatgtccttgagccaatcgtcgagcggctt 302
||||| ||||||||||||||||| |||||||| |||||
Sbjct: 11268619 acggcaggcatgtccttgagccagtcgtcgagaggctt 11268656
>gb|AV791275.1|AV791275 AV791275 RAFL7 Arabidopsis thaliana cDNA clone RAFL07-09-M15 3',
mRNA sequence
Length = 462
Score = 48.1 bits (24), Expect = 0.001
Identities = 30/32 (93%)
Strand = Plus / Plus
Query: 271 ggcatgtccttgagccaatcgtcgagcggctt 302
||||||||||||||||| |||||||| |||||
Sbjct: 248 ggcatgtccttgagccagtcgtcgagaggctt 279
>gb|BP586933.1|BP586933 BP586933 RAFL15 Arabidopsis thaliana cDNA clone RAFL15-08-C20 3',
mRNA sequence
Length = 403
Score = 48.1 bits (24), Expect = 0.001
Identities = 30/32 (93%)
Strand = Plus / Plus
Query: 271 ggcatgtccttgagccaatcgtcgagcggctt 302
||||||||||||||||| |||||||| |||||
Sbjct: 252 ggcatgtccttgagccagtcgtcgagaggctt 283
>gb|BP593999.1|BP593999 BP593999 RAFL15 Arabidopsis thaliana cDNA clone RAFL15-24-E14 3',
mRNA sequence
Length = 433
Score = 48.1 bits (24), Expect = 0.001
Identities = 30/32 (93%)
Strand = Plus / Plus
Query: 271 ggcatgtccttgagccaatcgtcgagcggctt 302
||||||||||||||||| |||||||| |||||
Sbjct: 251 ggcatgtccttgagccagtcgtcgagaggctt 282
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 198,679
Number of Sequences: 1013581
Number of extensions: 198679
Number of successful extensions: 15158
Number of sequences better than 0.5: 57
Number of HSP's better than 0.5 without gapping: 57
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 14931
Number of HSP's gapped (non-prelim): 227
length of query: 487
length of database: 908,940,872
effective HSP length: 20
effective length of query: 467
effective length of database: 888,669,252
effective search space: 415008540684
effective search space used: 415008540684
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)