BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 3713002.2.1
         (923 letters)

Database: At_nucl_with_EST.fasta 
           1,013,581 sequences; 908,940,872 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|AE005172.1|  Arabidopsis thaliana chromosome 1, top arm c...    42   0.17 
gb|AC069160.7|AC069160  Arabidopsis thaliana chromosome 1 BA...    42   0.17 
ref|NC_003070.5|  Arabidopsis thaliana chromosome 1, complet...    42   0.17 

>gb|AE005172.1| Arabidopsis thaliana chromosome 1, top arm complete sequence
          Length = 14221815

 Score = 42.1 bits (21), Expect = 0.17
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 589      atgtatatatatggtatatgt 609
                |||||||||||||||||||||
Sbjct: 12931355 atgtatatatatggtatatgt 12931335



>gb|AC069160.7|AC069160 Arabidopsis thaliana chromosome 1 BAC T9I1 genomic sequence, complete
             sequence
          Length = 99241

 Score = 42.1 bits (21), Expect = 0.17
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 589   atgtatatatatggtatatgt 609
             |||||||||||||||||||||
Sbjct: 14360 atgtatatatatggtatatgt 14340



>ref|NC_003070.5| Arabidopsis thaliana chromosome 1, complete sequence
          Length = 30432563

 Score = 42.1 bits (21), Expect = 0.17
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 589      atgtatatatatggtatatgt 609
                |||||||||||||||||||||
Sbjct: 12922559 atgtatatatatggtatatgt 12922539



  Database: At_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:09 PM
  Number of letters in database: 908,940,872
  Number of sequences in database:  1,013,581
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 310,251
Number of Sequences: 1013581
Number of extensions: 310251
Number of successful extensions: 25716
Number of sequences better than  0.5: 3
Number of HSP's better than  0.5 without gapping: 3
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 25415
Number of HSP's gapped (non-prelim): 301
length of query: 923
length of database: 908,940,872
effective HSP length: 20
effective length of query: 903
effective length of database: 888,669,252
effective search space: 802468334556
effective search space used: 802468334556
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)