BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3230260.2.1
(863 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
emb|AL948302.1| Arabidopsis thaliana T-DNA flanking sequenc... 42 0.16
emb|AL949260.1| Arabidopsis thaliana T-DNA flanking sequenc... 42 0.16
gb|Z33678.1|Z33678 ATTS2769 Strasbourg-A Arabidopsis thalia... 42 0.16
gb|AV825073.1|AV825073 AV825073 RAFL6 Arabidopsis thaliana ... 42 0.16
gb|AU235889.1|AU235889 AU235889 RAFL14 Arabidopsis thaliana... 42 0.16
gb|CB259727.1|CB259727 29-E011176-013-009-I07-T7R MPIZ-ADIS... 42 0.16
gb|CB261633.1|CB261633 92-E8977-008-017-H24-pBl2 MPIZ-ADIS-... 42 0.16
gb|CB265163.1|CB265163 05-E015021-035-004-I01-T7R MPIZ-ADIS... 42 0.16
gb|CF651522.1|CF651522 76-E009213w-013-001-G19-T7R MPIZ-ADI... 42 0.16
gb|AV440407.1|AV440407 AV440407 Arabidopsis thaliana above-... 42 0.16
gb|AV526639.1|AV526639 AV526639 Arabidopsis thaliana aboveg... 42 0.16
gb|AV554682.1|AV554682 AV554682 Arabidopsis thaliana roots ... 42 0.16
gb|BP632772.1|BP632772 BP632772 RAFL17 Arabidopsis thaliana... 42 0.16
gb|BT004610.1| Arabidopsis thaliana At4g18070 gene, complet... 42 0.16
gb|AY088217.1| Arabidopsis thaliana clone 4345 mRNA, comple... 42 0.16
gb|AY063879.1| Arabidopsis thaliana unknown protein (At4g18... 42 0.16
emb|BX827594.1|CNS0A2W1 Arabidopsis thaliana Full-length cD... 42 0.16
emb|BX828252.1|CNS0A2ZU Arabidopsis thaliana Full-length cD... 42 0.16
emb|AJ270060.1| Arabidopsis thaliana DNA chromosome 4, long... 42 0.16
emb|AL110123.1|ATF15J5 Arabidopsis thaliana DNA chromosome ... 42 0.16
emb|AL161547.2|ATCHRIV47 Arabidopsis thaliana DNA chromosom... 42 0.16
ref|NM_117917.1| Arabidopsis thaliana unknown protein AT4G1... 42 0.16
ref|NM_179074.2| Arabidopsis thaliana unknown protein AT4G1... 42 0.16
ref|NM_001036582.1| Arabidopsis thaliana unknown protein AT... 42 0.16
ref|NM_001036583.1| Arabidopsis thaliana unknown protein AT... 42 0.16
ref|NC_003075.3| Arabidopsis thaliana chromosome 4, complet... 42 0.16
>emb|AL948302.1| Arabidopsis thaliana T-DNA flanking sequence GK-311D07-015792,
genomic survey sequence
Length = 133
Score = 42.1 bits (21), Expect = 0.16
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 191 agtagtagcagcagcagcagc 211
|||||||||||||||||||||
Sbjct: 110 agtagtagcagcagcagcagc 90
>emb|AL949260.1| Arabidopsis thaliana T-DNA flanking sequence GK-319D07-015860,
genomic survey sequence
Length = 205
Score = 42.1 bits (21), Expect = 0.16
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 191 agtagtagcagcagcagcagc 211
|||||||||||||||||||||
Sbjct: 182 agtagtagcagcagcagcagc 162
>gb|Z33678.1|Z33678 ATTS2769 Strasbourg-A Arabidopsis thaliana cDNA clone FAFJ40, mRNA
sequence
Length = 413
Score = 42.1 bits (21), Expect = 0.16
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 191 agtagtagcagcagcagcagc 211
|||||||||||||||||||||
Sbjct: 257 agtagtagcagcagcagcagc 277
>gb|AV825073.1|AV825073 AV825073 RAFL6 Arabidopsis thaliana cDNA clone RAFL06-84-P20 5',
mRNA sequence
Length = 650
Score = 42.1 bits (21), Expect = 0.16
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 191 agtagtagcagcagcagcagc 211
|||||||||||||||||||||
Sbjct: 351 agtagtagcagcagcagcagc 371
>gb|AU235889.1|AU235889 AU235889 RAFL14 Arabidopsis thaliana cDNA clone RAFL14-51-I15 5',
mRNA sequence
Length = 455
Score = 42.1 bits (21), Expect = 0.16
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 191 agtagtagcagcagcagcagc 211
|||||||||||||||||||||
Sbjct: 342 agtagtagcagcagcagcagc 362
>gb|CB259727.1|CB259727 29-E011176-013-009-I07-T7R MPIZ-ADIS-013 Arabidopsis thaliana cDNA
clone MPIZp770I079Q 5-PRIME, mRNA sequence
Length = 547
Score = 42.1 bits (21), Expect = 0.16
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 191 agtagtagcagcagcagcagc 211
|||||||||||||||||||||
Sbjct: 351 agtagtagcagcagcagcagc 371
>gb|CB261633.1|CB261633 92-E8977-008-017-H24-pBl2 MPIZ-ADIS-008 Arabidopsis thaliana cDNA
clone MPIZp767H2417Q 5-PRIME, mRNA sequence
Length = 531
Score = 42.1 bits (21), Expect = 0.16
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 191 agtagtagcagcagcagcagc 211
|||||||||||||||||||||
Sbjct: 248 agtagtagcagcagcagcagc 268
>gb|CB265163.1|CB265163 05-E015021-035-004-I01-T7R MPIZ-ADIS-035 Arabidopsis thaliana cDNA
clone MPIZp2000I014Q 5-PRIME, mRNA sequence
Length = 640
Score = 42.1 bits (21), Expect = 0.16
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 191 agtagtagcagcagcagcagc 211
|||||||||||||||||||||
Sbjct: 318 agtagtagcagcagcagcagc 338
>gb|CF651522.1|CF651522 76-E009213w-013-001-G19-T7R MPIZ-ADIS-013 Arabidopsis thaliana cDNA
clone MPIZp770G191Q 5-PRIME, mRNA sequence
Length = 971
Score = 42.1 bits (21), Expect = 0.16
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 191 agtagtagcagcagcagcagc 211
|||||||||||||||||||||
Sbjct: 255 agtagtagcagcagcagcagc 275
>gb|AV440407.1|AV440407 AV440407 Arabidopsis thaliana above-ground organ two to six-week
old Arabidopsis thaliana cDNA clone APD61g01_f 3', mRNA
sequence
Length = 520
Score = 42.1 bits (21), Expect = 0.16
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 191 agtagtagcagcagcagcagc 211
|||||||||||||||||||||
Sbjct: 351 agtagtagcagcagcagcagc 371
>gb|AV526639.1|AV526639 AV526639 Arabidopsis thaliana aboveground organs two to six-week
old Arabidopsis thaliana cDNA clone APZ18b06R 5', mRNA
sequence
Length = 496
Score = 42.1 bits (21), Expect = 0.16
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 191 agtagtagcagcagcagcagc 211
|||||||||||||||||||||
Sbjct: 315 agtagtagcagcagcagcagc 335
>gb|AV554682.1|AV554682 AV554682 Arabidopsis thaliana roots Columbia Arabidopsis thaliana
cDNA clone RZ98f02R 5', mRNA sequence
Length = 519
Score = 42.1 bits (21), Expect = 0.16
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 191 agtagtagcagcagcagcagc 211
|||||||||||||||||||||
Sbjct: 333 agtagtagcagcagcagcagc 353
>gb|BP632772.1|BP632772 BP632772 RAFL17 Arabidopsis thaliana cDNA clone RAFL17-28-G04 3',
mRNA sequence
Length = 394
Score = 42.1 bits (21), Expect = 0.16
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 191 agtagtagcagcagcagcagc 211
|||||||||||||||||||||
Sbjct: 387 agtagtagcagcagcagcagc 367
>gb|BT004610.1| Arabidopsis thaliana At4g18070 gene, complete cds
Length = 789
Score = 42.1 bits (21), Expect = 0.16
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 191 agtagtagcagcagcagcagc 211
|||||||||||||||||||||
Sbjct: 211 agtagtagcagcagcagcagc 231
>gb|AY088217.1| Arabidopsis thaliana clone 4345 mRNA, complete sequence
Length = 1095
Score = 42.1 bits (21), Expect = 0.16
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 191 agtagtagcagcagcagcagc 211
|||||||||||||||||||||
Sbjct: 178 agtagtagcagcagcagcagc 198
>gb|AY063879.1| Arabidopsis thaliana unknown protein (At4g18070) mRNA, complete cds
Length = 1305
Score = 42.1 bits (21), Expect = 0.16
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 191 agtagtagcagcagcagcagc 211
|||||||||||||||||||||
Sbjct: 350 agtagtagcagcagcagcagc 370
>emb|BX827594.1|CNS0A2W1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTLS80ZB11 of Adult vegetative tissue of strain col-0
of Arabidopsis thaliana (thale cress)
Length = 1314
Score = 42.1 bits (21), Expect = 0.16
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 191 agtagtagcagcagcagcagc 211
|||||||||||||||||||||
Sbjct: 418 agtagtagcagcagcagcagc 438
>emb|BX828252.1|CNS0A2ZU Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTPGH67ZF03 of Hormone Treated Callus of strain col-0
of Arabidopsis thaliana (thale cress)
Length = 1741
Score = 42.1 bits (21), Expect = 0.16
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 191 agtagtagcagcagcagcagc 211
|||||||||||||||||||||
Sbjct: 519 agtagtagcagcagcagcagc 539
>emb|AJ270060.1| Arabidopsis thaliana DNA chromosome 4, long arm
Length = 14497843
Score = 42.1 bits (21), Expect = 0.16
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 191 agtagtagcagcagcagcagc 211
|||||||||||||||||||||
Sbjct: 5944429 agtagtagcagcagcagcagc 5944449
>emb|AL110123.1|ATF15J5 Arabidopsis thaliana DNA chromosome 4, BAC clone F15J5 (ESSA project)
Length = 58427
Score = 42.1 bits (21), Expect = 0.16
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 191 agtagtagcagcagcagcagc 211
|||||||||||||||||||||
Sbjct: 18546 agtagtagcagcagcagcagc 18566
>emb|AL161547.2|ATCHRIV47 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 47
Length = 198067
Score = 42.1 bits (21), Expect = 0.16
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 191 agtagtagcagcagcagcagc 211
|||||||||||||||||||||
Sbjct: 192022 agtagtagcagcagcagcagc 192042
>ref|NM_117917.1| Arabidopsis thaliana unknown protein AT4G18070 transcript variant
AT4G18070.2 mRNA, complete cds
Length = 1094
Score = 42.1 bits (21), Expect = 0.16
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 191 agtagtagcagcagcagcagc 211
|||||||||||||||||||||
Sbjct: 177 agtagtagcagcagcagcagc 197
>ref|NM_179074.2| Arabidopsis thaliana unknown protein AT4G18070 transcript variant
AT4G18070.1 mRNA, complete cds
Length = 1337
Score = 42.1 bits (21), Expect = 0.16
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 191 agtagtagcagcagcagcagc 211
|||||||||||||||||||||
Sbjct: 418 agtagtagcagcagcagcagc 438
>ref|NM_001036582.1| Arabidopsis thaliana unknown protein AT4G18070 transcript variant
AT4G18070.3 mRNA, complete cds
Length = 1345
Score = 42.1 bits (21), Expect = 0.16
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 191 agtagtagcagcagcagcagc 211
|||||||||||||||||||||
Sbjct: 353 agtagtagcagcagcagcagc 373
>ref|NM_001036583.1| Arabidopsis thaliana unknown protein AT4G18070 transcript variant
AT4G18070.4 mRNA, complete cds
Length = 1278
Score = 42.1 bits (21), Expect = 0.16
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 191 agtagtagcagcagcagcagc 211
|||||||||||||||||||||
Sbjct: 353 agtagtagcagcagcagcagc 373
>ref|NC_003075.3| Arabidopsis thaliana chromosome 4, complete sequence
Length = 18585042
Score = 42.1 bits (21), Expect = 0.16
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 191 agtagtagcagcagcagcagc 211
|||||||||||||||||||||
Sbjct: 10031685 agtagtagcagcagcagcagc 10031705
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 527,294
Number of Sequences: 1013581
Number of extensions: 527294
Number of successful extensions: 48917
Number of sequences better than 0.5: 26
Number of HSP's better than 0.5 without gapping: 26
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 48251
Number of HSP's gapped (non-prelim): 664
length of query: 863
length of database: 908,940,872
effective HSP length: 20
effective length of query: 843
effective length of database: 888,669,252
effective search space: 749148179436
effective search space used: 749148179436
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)