BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3204317.2.1
(607 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AI999258.1|AI999258 701555179 A. thaliana, Columbia Col-... 56 7e-006
gb|BP789533.1|BP789533 BP789533 RAFL7 Arabidopsis thaliana ... 56 7e-006
gb|BP814594.1|BP814594 BP814594 RAFL19 Arabidopsis thaliana... 56 7e-006
gb|BP821120.1|BP821120 BP821120 RAFL19 Arabidopsis thaliana... 56 7e-006
emb|AJ270060.1| Arabidopsis thaliana DNA chromosome 4, long... 56 7e-006
emb|AL035527.1|ATF17L22 Arabidopsis thaliana DNA chromosome... 56 7e-006
emb|AL161555.2|ATCHRIV55 Arabidopsis thaliana DNA chromosom... 56 7e-006
dbj|AK220972.1| Arabidopsis thaliana mRNA for hypothetical ... 56 7e-006
ref|NM_118296.3| Arabidopsis thaliana hydrolase, hydrolyzin... 56 7e-006
ref|NM_118297.3| Arabidopsis thaliana RNA binding / pseudou... 56 7e-006
ref|NC_003075.3| Arabidopsis thaliana chromosome 4, complet... 56 7e-006
gb|BX836430.1|BX836430 BX836430 Arabidopsis thaliana Siliqu... 54 3e-005
gb|CL506354.1|CL506354 SAIL_765_F11.v1 SAIL Collection Arab... 48 0.002
gb|AV520200.1|AV520200 AV520200 Arabidopsis thaliana aboveg... 48 0.002
gb|BP649344.1|BP649344 BP649344 RAFL19 Arabidopsis thaliana... 48 0.002
gb|BP785598.1|BP785598 BP785598 RAFL7 Arabidopsis thaliana ... 48 0.002
gb|AF360240.1| Arabidopsis thaliana At3g18080 mRNA sequence 48 0.002
gb|AY084864.1| Arabidopsis thaliana clone 11984 mRNA, compl... 48 0.002
gb|BT010611.1| Arabidopsis thaliana At5g36890 gene, complet... 48 0.002
emb|BX823566.1|CNS0A5AM Arabidopsis thaliana Full-length cD... 48 0.002
emb|BX824102.1|CNS0A5R3 Arabidopsis thaliana Full-length cD... 48 0.002
dbj|AB016877.1| Arabidopsis thaliana genomic DNA, chromosom... 48 0.002
dbj|AK175760.1| Arabidopsis thaliana mRNA for beta-glucosid... 48 0.002
ref|NM_123047.2| Arabidopsis thaliana hydrolase, hydrolyzin... 48 0.002
ref|NM_112690.2| Arabidopsis thaliana hydrolase, hydrolyzin... 48 0.002
ref|NM_001036898.1| Arabidopsis thaliana hydrolase, hydroly... 48 0.002
ref|NC_003076.4| Arabidopsis thaliana chromosome 5, complet... 48 0.002
gb|CL515693.1|CL515693 SAIL_903_F03.v1 SAIL Collection Arab... 42 0.11
>gb|AI999258.1|AI999258 701555179 A. thaliana, Columbia Col-0, rosette-3 Arabidopsis
thaliana cDNA clone 701555179, mRNA sequence
Length = 613
Score = 56.0 bits (28), Expect = 7e-006
Identities = 37/40 (92%)
Strand = Plus / Plus
Query: 291 tccactcgaagttgtcgagcaacgaccaggcgaagtatcc 330
|||||||||||||||| || || |||||||||||||||||
Sbjct: 254 tccactcgaagttgtctagtaaagaccaggcgaagtatcc 293
>gb|BP789533.1|BP789533 BP789533 RAFL7 Arabidopsis thaliana cDNA clone RAFL07-39-G17 3',
mRNA sequence
Length = 421
Score = 56.0 bits (28), Expect = 7e-006
Identities = 37/40 (92%)
Strand = Plus / Minus
Query: 291 tccactcgaagttgtcgagcaacgaccaggcgaagtatcc 330
|||||||||||||||| || || |||||||||||||||||
Sbjct: 137 tccactcgaagttgtctagtaaagaccaggcgaagtatcc 98
>gb|BP814594.1|BP814594 BP814594 RAFL19 Arabidopsis thaliana cDNA clone RAFL22-36-D19 5',
mRNA sequence
Length = 379
Score = 56.0 bits (28), Expect = 7e-006
Identities = 37/40 (92%)
Strand = Plus / Plus
Query: 291 tccactcgaagttgtcgagcaacgaccaggcgaagtatcc 330
|||||||||||||||| || || |||||||||||||||||
Sbjct: 180 tccactcgaagttgtctagtaaagaccaggcgaagtatcc 219
>gb|BP821120.1|BP821120 BP821120 RAFL19 Arabidopsis thaliana cDNA clone RAFL22-56-O12 5',
mRNA sequence
Length = 391
Score = 56.0 bits (28), Expect = 7e-006
Identities = 37/40 (92%)
Strand = Plus / Plus
Query: 291 tccactcgaagttgtcgagcaacgaccaggcgaagtatcc 330
|||||||||||||||| || || |||||||||||||||||
Sbjct: 182 tccactcgaagttgtctagtaaagaccaggcgaagtatcc 221
>emb|AJ270060.1| Arabidopsis thaliana DNA chromosome 4, long arm
Length = 14497843
Score = 56.0 bits (28), Expect = 7e-006
Identities = 37/40 (92%)
Strand = Plus / Minus
Query: 291 tccactcgaagttgtcgagcaacgaccaggcgaagtatcc 330
|||||||||||||||| || || |||||||||||||||||
Sbjct: 7476463 tccactcgaagttgtctagtaaagaccaggcgaagtatcc 7476424
>emb|AL035527.1|ATF17L22 Arabidopsis thaliana DNA chromosome 4, BAC clone F17L22 (ESSAII
project)
Length = 107702
Score = 56.0 bits (28), Expect = 7e-006
Identities = 37/40 (92%)
Strand = Plus / Minus
Query: 291 tccactcgaagttgtcgagcaacgaccaggcgaagtatcc 330
|||||||||||||||| || || |||||||||||||||||
Sbjct: 95507 tccactcgaagttgtctagtaaagaccaggcgaagtatcc 95468
>emb|AL161555.2|ATCHRIV55 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 55
Length = 194916
Score = 56.0 bits (28), Expect = 7e-006
Identities = 37/40 (92%)
Strand = Plus / Minus
Query: 291 tccactcgaagttgtcgagcaacgaccaggcgaagtatcc 330
|||||||||||||||| || || |||||||||||||||||
Sbjct: 181565 tccactcgaagttgtctagtaaagaccaggcgaagtatcc 181526
>dbj|AK220972.1| Arabidopsis thaliana mRNA for hypothetical protein, complete cds,
clone: RAFL22-56-O12
Length = 372
Score = 56.0 bits (28), Expect = 7e-006
Identities = 37/40 (92%)
Strand = Plus / Plus
Query: 291 tccactcgaagttgtcgagcaacgaccaggcgaagtatcc 330
|||||||||||||||| || || |||||||||||||||||
Sbjct: 181 tccactcgaagttgtctagtaaagaccaggcgaagtatcc 220
>ref|NM_118296.3| Arabidopsis thaliana hydrolase, hydrolyzing O-glycosyl compounds
AT4G21760 mRNA, complete cds
Length = 1687
Score = 56.0 bits (28), Expect = 7e-006
Identities = 37/40 (92%)
Strand = Plus / Minus
Query: 291 tccactcgaagttgtcgagcaacgaccaggcgaagtatcc 330
|||||||||||||||| || || |||||||||||||||||
Sbjct: 1435 tccactcgaagttgtctagtaaagaccaggcgaagtatcc 1396
>ref|NM_118297.3| Arabidopsis thaliana RNA binding / pseudouridine synthase/
pseudouridylate synthase AT4G21770 mRNA, complete cds
Length = 1693
Score = 56.0 bits (28), Expect = 7e-006
Identities = 37/40 (92%)
Strand = Plus / Plus
Query: 291 tccactcgaagttgtcgagcaacgaccaggcgaagtatcc 330
|||||||||||||||| || || |||||||||||||||||
Sbjct: 1608 tccactcgaagttgtctagtaaagaccaggcgaagtatcc 1647
>ref|NC_003075.3| Arabidopsis thaliana chromosome 4, complete sequence
Length = 18585042
Score = 56.0 bits (28), Expect = 7e-006
Identities = 37/40 (92%)
Strand = Plus / Minus
Query: 291 tccactcgaagttgtcgagcaacgaccaggcgaagtatcc 330
|||||||||||||||| || || |||||||||||||||||
Sbjct: 11563710 tccactcgaagttgtctagtaaagaccaggcgaagtatcc 11563671
>gb|BX836430.1|BX836430 BX836430 Arabidopsis thaliana Silique Col-0 Arabidopsis thaliana
cDNA clone GSLTSIL83ZH06 3PRIM, mRNA sequence
Length = 593
Score = 54.0 bits (27), Expect = 3e-005
Identities = 36/39 (92%)
Strand = Plus / Minus
Query: 291 tccactcgaagttgtcgagcaacgaccaggcgaagtatc 329
|||||||||||||||| || || ||||||||||||||||
Sbjct: 86 tccactcgaagttgtctagtaaagaccaggcgaagtatc 48
>gb|CL506354.1|CL506354 SAIL_765_F11.v1 SAIL Collection Arabidopsis thaliana genomic clone
SAIL_765_F11.v1, DNA sequence
Length = 939
Score = 48.1 bits (24), Expect = 0.002
Identities = 36/40 (90%)
Strand = Plus / Plus
Query: 292 ccactcgaagttgtcgagcaacgaccaggcgaagtatccc 331
||||||||||||||| |||| |||||| || |||||||||
Sbjct: 418 ccactcgaagttgtccagcagcgaccacgcaaagtatccc 457
>gb|AV520200.1|AV520200 AV520200 Arabidopsis thaliana aboveground organs two to six-week
old Arabidopsis thaliana cDNA clone APZ10f11F 3', mRNA
sequence
Length = 602
Score = 48.1 bits (24), Expect = 0.002
Identities = 48/56 (85%)
Strand = Plus / Plus
Query: 431 acgttgcccgggtcgtccataccgttctctgacaggagcatcgtggggttgccgta 486
||||| |||||||| ||||||||||| || || |||| ||| || |||||||||||
Sbjct: 381 acgtttcccgggtcatccataccgttttcagagaggatcatagtagggttgccgta 436
>gb|BP649344.1|BP649344 BP649344 RAFL19 Arabidopsis thaliana cDNA clone RAFL19-13-E11 3',
mRNA sequence
Length = 362
Score = 48.1 bits (24), Expect = 0.002
Identities = 36/40 (90%)
Strand = Plus / Plus
Query: 292 ccactcgaagttgtcgagcaacgaccaggcgaagtatccc 331
||||||||||||||| |||| |||||| || |||||||||
Sbjct: 271 ccactcgaagttgtccagcagcgaccacgcaaagtatccc 310
>gb|BP785598.1|BP785598 BP785598 RAFL7 Arabidopsis thaliana cDNA clone RAFL07-95-I24 3',
mRNA sequence
Length = 406
Score = 48.1 bits (24), Expect = 0.002
Identities = 36/40 (90%)
Strand = Plus / Plus
Query: 292 ccactcgaagttgtcgagcaacgaccaggcgaagtatccc 331
||||||||||||||| |||| |||||| || |||||||||
Sbjct: 307 ccactcgaagttgtccagcagcgaccacgcaaagtatccc 346
>gb|AF360240.1| Arabidopsis thaliana At3g18080 mRNA sequence
Length = 1845
Score = 48.1 bits (24), Expect = 0.002
Identities = 48/56 (85%)
Strand = Plus / Minus
Query: 431 acgttgcccgggtcgtccataccgttctctgacaggagcatcgtggggttgccgta 486
||||| |||||||| ||||||||||| || || |||| ||| || |||||||||||
Sbjct: 1383 acgtttcccgggtcatccataccgttttcagagaggatcatagtagggttgccgta 1328
>gb|AY084864.1| Arabidopsis thaliana clone 11984 mRNA, complete sequence
Length = 1739
Score = 48.1 bits (24), Expect = 0.002
Identities = 48/56 (85%)
Strand = Plus / Minus
Query: 431 acgttgcccgggtcgtccataccgttctctgacaggagcatcgtggggttgccgta 486
||||| |||||||| ||||||||||| || || |||| ||| || |||||||||||
Sbjct: 1310 acgtttcccgggtcatccataccgttttcagagaggatcatagtagggttgccgta 1255
>gb|BT010611.1| Arabidopsis thaliana At5g36890 gene, complete cds
Length = 1473
Score = 48.1 bits (24), Expect = 0.002
Identities = 36/40 (90%)
Strand = Plus / Minus
Query: 292 ccactcgaagttgtcgagcaacgaccaggcgaagtatccc 331
||||||||||||||| |||| |||||| || |||||||||
Sbjct: 1335 ccactcgaagttgtccagcagcgaccacgcaaagtatccc 1296
>emb|BX823566.1|CNS0A5AM Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTLS51ZD02 of Adult vegetative tissue of strain col-0
of Arabidopsis thaliana (thale cress)
Length = 1737
Score = 48.1 bits (24), Expect = 0.002
Identities = 48/56 (85%)
Strand = Plus / Minus
Query: 431 acgttgcccgggtcgtccataccgttctctgacaggagcatcgtggggttgccgta 486
||||| |||||||| ||||||||||| || || |||| ||| || |||||||||||
Sbjct: 1301 acgtttcccgggtcatccataccgttttcagagaggatcatagtagggttgccgta 1246
>emb|BX824102.1|CNS0A5R3 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTPGH22ZC05 of Hormone Treated Callus of strain col-0
of Arabidopsis thaliana (thale cress)
Length = 1704
Score = 48.1 bits (24), Expect = 0.002
Identities = 48/56 (85%)
Strand = Plus / Minus
Query: 431 acgttgcccgggtcgtccataccgttctctgacaggagcatcgtggggttgccgta 486
||||| |||||||| ||||||||||| || || |||| ||| || |||||||||||
Sbjct: 1297 acgtttcccgggtcatccataccgttttcagagaggatcatagtagggttgccgta 1242
>dbj|AB016877.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MLF18
Length = 74842
Score = 48.1 bits (24), Expect = 0.002
Identities = 36/40 (90%)
Strand = Plus / Plus
Query: 292 ccactcgaagttgtcgagcaacgaccaggcgaagtatccc 331
||||||||||||||| |||| |||||| || |||||||||
Sbjct: 2020 ccactcgaagttgtccagcagcgaccacgcaaagtatccc 2059
>dbj|AK175760.1| Arabidopsis thaliana mRNA for beta-glucosidase -like protein,
complete cds, clone: RAFL22-32-D12
Length = 1760
Score = 48.1 bits (24), Expect = 0.002
Identities = 36/40 (90%)
Strand = Plus / Minus
Query: 292 ccactcgaagttgtcgagcaacgaccaggcgaagtatccc 331
||||||||||||||| |||| |||||| || |||||||||
Sbjct: 1475 ccactcgaagttgtccagcagcgaccacgcaaagtatccc 1436
>ref|NM_123047.2| Arabidopsis thaliana hydrolase, hydrolyzing O-glycosyl compounds
AT5G36890 transcript variant AT5G36890.1 mRNA, complete
cds
Length = 1473
Score = 48.1 bits (24), Expect = 0.002
Identities = 36/40 (90%)
Strand = Plus / Minus
Query: 292 ccactcgaagttgtcgagcaacgaccaggcgaagtatccc 331
||||||||||||||| |||| |||||| || |||||||||
Sbjct: 1335 ccactcgaagttgtccagcagcgaccacgcaaagtatccc 1296
>ref|NM_112690.2| Arabidopsis thaliana hydrolase, hydrolyzing O-glycosyl compounds
AT3G18080 mRNA, complete cds
Length = 1894
Score = 48.1 bits (24), Expect = 0.002
Identities = 48/56 (85%)
Strand = Plus / Minus
Query: 431 acgttgcccgggtcgtccataccgttctctgacaggagcatcgtggggttgccgta 486
||||| |||||||| ||||||||||| || || |||| ||| || |||||||||||
Sbjct: 1310 acgtttcccgggtcatccataccgttttcagagaggatcatagtagggttgccgta 1255
>ref|NM_001036898.1| Arabidopsis thaliana hydrolase, hydrolyzing O-glycosyl compounds
AT5G36890 transcript variant AT5G36890.2 mRNA, complete
cds
Length = 1780
Score = 48.1 bits (24), Expect = 0.002
Identities = 36/40 (90%)
Strand = Plus / Minus
Query: 292 ccactcgaagttgtcgagcaacgaccaggcgaagtatccc 331
||||||||||||||| |||| |||||| || |||||||||
Sbjct: 1474 ccactcgaagttgtccagcagcgaccacgcaaagtatccc 1435
>ref|NC_003076.4| Arabidopsis thaliana chromosome 5, complete sequence
Length = 26992728
Score = 48.1 bits (24), Expect = 0.002
Identities = 36/40 (90%)
Strand = Plus / Plus
Query: 292 ccactcgaagttgtcgagcaacgaccaggcgaagtatccc 331
||||||||||||||| |||| |||||| || |||||||||
Sbjct: 14559532 ccactcgaagttgtccagcagcgaccacgcaaagtatccc 14559571
>gb|CL515693.1|CL515693 SAIL_903_F03.v1 SAIL Collection Arabidopsis thaliana genomic clone
SAIL_903_F03.v1, DNA sequence
Length = 907
Score = 42.1 bits (21), Expect = 0.11
Identities = 35/40 (87%)
Strand = Plus / Plus
Query: 292 ccactcgaagttgtcgagcaacgaccaggcgaagtatccc 331
||||||||||||||| |||| |||||| || ||||||||
Sbjct: 714 ccactcgaagttgtccagcagcgaccacgcanagtatccc 753
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 140,280
Number of Sequences: 1013581
Number of extensions: 140280
Number of successful extensions: 8816
Number of sequences better than 0.5: 28
Number of HSP's better than 0.5 without gapping: 28
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 8676
Number of HSP's gapped (non-prelim): 140
length of query: 607
length of database: 908,940,872
effective HSP length: 20
effective length of query: 587
effective length of database: 888,669,252
effective search space: 521648850924
effective search space used: 521648850924
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)