BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3204272.2.1
(739 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AC011708.8|ATAC011708 Arabidopsis thaliana chromosome II... 44 0.034
dbj|BA000014.8| Arabidopsis thaliana, chromosome 3, complet... 44 0.034
ref|NC_003074.4| Arabidopsis thaliana chromosome 3, complet... 44 0.034
gb|H37473.1|H37473 15602 Lambda-PRL2 Arabidopsis thaliana c... 42 0.13
gb|BX836814.1|BX836814 BX836814 Arabidopsis thaliana Flower... 42 0.13
gb|BP837657.1|BP837657 BP837657 RAFL19 Arabidopsis thaliana... 42 0.13
gb|AF372949.1|AF372949 Arabidopsis thaliana AT3g10740/T7M13... 42 0.13
gb|AY143944.1| Arabidopsis thaliana At3g10740/T7M13_18 mRNA... 42 0.13
gb|AY243509.1| Arabidopsis thaliana alpha-L-arabinofuranosi... 42 0.13
emb|BX824011.1|CNS0A4VB Arabidopsis thaliana Full-length cD... 42 0.13
dbj|AK220766.1| Arabidopsis thaliana mRNA for putative alph... 42 0.13
dbj|AK222175.1| Arabidopsis thaliana mRNA for putative alph... 42 0.13
ref|NM_111911.3| Arabidopsis thaliana ASD1; hydrolase, acti... 42 0.13
>gb|AC011708.8|ATAC011708 Arabidopsis thaliana chromosome III BAC T7M13 genomic sequence,
complete sequence
Length = 80379
Score = 44.1 bits (22), Expect = 0.034
Identities = 31/34 (91%)
Strand = Plus / Minus
Query: 620 aggagttgaagacgattgcgtctgggttccacct 653
||||||||||||| ||||| || |||||||||||
Sbjct: 54756 aggagttgaagactattgcatcagggttccacct 54723
>dbj|BA000014.8| Arabidopsis thaliana, chromosome 3, complete sequence
Length = 23403063
Score = 44.1 bits (22), Expect = 0.034
Identities = 31/34 (91%)
Strand = Plus / Minus
Query: 620 aggagttgaagacgattgcgtctgggttccacct 653
||||||||||||| ||||| || |||||||||||
Sbjct: 3386763 aggagttgaagactattgcatcagggttccacct 3386730
>ref|NC_003074.4| Arabidopsis thaliana chromosome 3, complete sequence
Length = 23470805
Score = 44.1 bits (22), Expect = 0.034
Identities = 31/34 (91%)
Strand = Plus / Plus
Query: 620 aggagttgaagacgattgcgtctgggttccacct 653
||||||||||||| ||||| || |||||||||||
Sbjct: 3361657 aggagttgaagactattgcatcagggttccacct 3361690
>gb|H37473.1|H37473 15602 Lambda-PRL2 Arabidopsis thaliana cDNA clone 182B24T7, mRNA
sequence
Length = 481
Score = 42.1 bits (21), Expect = 0.13
Identities = 30/33 (90%)
Strand = Plus / Minus
Query: 620 aggagttgaagacgattgcgtctgggttccacc 652
||||||||||||| ||||| || ||||||||||
Sbjct: 148 aggagttgaagactattgcatcagggttccacc 116
>gb|BX836814.1|BX836814 BX836814 Arabidopsis thaliana Flowers and buds Col-0 Arabidopsis
thaliana cDNA clone GSLTFB91ZE06 3PRIM, mRNA sequence
Length = 1096
Score = 42.1 bits (21), Expect = 0.13
Identities = 30/33 (90%)
Strand = Plus / Plus
Query: 620 aggagttgaagacgattgcgtctgggttccacc 652
||||||||||||| ||||| || ||||||||||
Sbjct: 569 aggagttgaagactattgcatcagggttccacc 601
>gb|BP837657.1|BP837657 BP837657 RAFL19 Arabidopsis thaliana cDNA clone RAFL22-21-H07 5',
mRNA sequence
Length = 379
Score = 42.1 bits (21), Expect = 0.13
Identities = 30/33 (90%)
Strand = Plus / Minus
Query: 620 aggagttgaagacgattgcgtctgggttccacc 652
||||||||||||| ||||| || ||||||||||
Sbjct: 378 aggagttgaagactattgcatcagggttccacc 346
>gb|AF372949.1|AF372949 Arabidopsis thaliana AT3g10740/T7M13_18 mRNA, complete cds
Length = 2254
Score = 42.1 bits (21), Expect = 0.13
Identities = 30/33 (90%)
Strand = Plus / Minus
Query: 620 aggagttgaagacgattgcgtctgggttccacc 652
||||||||||||| ||||| || ||||||||||
Sbjct: 1647 aggagttgaagactattgcatcagggttccacc 1615
>gb|AY143944.1| Arabidopsis thaliana At3g10740/T7M13_18 mRNA, complete cds
Length = 2037
Score = 42.1 bits (21), Expect = 0.13
Identities = 30/33 (90%)
Strand = Plus / Minus
Query: 620 aggagttgaagacgattgcgtctgggttccacc 652
||||||||||||| ||||| || ||||||||||
Sbjct: 1573 aggagttgaagactattgcatcagggttccacc 1541
>gb|AY243509.1| Arabidopsis thaliana alpha-L-arabinofuranosidase (ASD1) mRNA,
complete cds
Length = 2312
Score = 42.1 bits (21), Expect = 0.13
Identities = 30/33 (90%)
Strand = Plus / Minus
Query: 620 aggagttgaagacgattgcgtctgggttccacc 652
||||||||||||| ||||| || ||||||||||
Sbjct: 1781 aggagttgaagactattgcatcagggttccacc 1749
>emb|BX824011.1|CNS0A4VB Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTPGH14ZD10 of Hormone Treated Callus of strain col-0
of Arabidopsis thaliana (thale cress)
Length = 2351
Score = 42.1 bits (21), Expect = 0.13
Identities = 30/33 (90%)
Strand = Plus / Minus
Query: 620 aggagttgaagacgattgcgtctgggttccacc 652
||||||||||||| ||||| || ||||||||||
Sbjct: 1822 aggagttgaagactattgcatcagggttccacc 1790
>dbj|AK220766.1| Arabidopsis thaliana mRNA for putative alpha-L-arabinofuranosidase,
partial cds, clone: RAFL22-21-H07
Length = 993
Score = 42.1 bits (21), Expect = 0.13
Identities = 30/33 (90%)
Strand = Plus / Minus
Query: 620 aggagttgaagacgattgcgtctgggttccacc 652
||||||||||||| ||||| || ||||||||||
Sbjct: 380 aggagttgaagactattgcatcagggttccacc 348
>dbj|AK222175.1| Arabidopsis thaliana mRNA for putative alpha-L-arabinofuranosidase,
partial cds, clone: RAFL24-02-J05
Length = 1328
Score = 42.1 bits (21), Expect = 0.13
Identities = 30/33 (90%)
Strand = Plus / Minus
Query: 620 aggagttgaagacgattgcgtctgggttccacc 652
||||||||||||| ||||| || ||||||||||
Sbjct: 715 aggagttgaagactattgcatcagggttccacc 683
>ref|NM_111911.3| Arabidopsis thaliana ASD1; hydrolase, acting on glycosyl bonds
AT3G10740 (ASD1) mRNA, complete cds
Length = 2427
Score = 42.1 bits (21), Expect = 0.13
Identities = 30/33 (90%)
Strand = Plus / Minus
Query: 620 aggagttgaagacgattgcgtctgggttccacc 652
||||||||||||| ||||| || ||||||||||
Sbjct: 1820 aggagttgaagactattgcatcagggttccacc 1788
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 290,873
Number of Sequences: 1013581
Number of extensions: 290873
Number of successful extensions: 17941
Number of sequences better than 0.5: 13
Number of HSP's better than 0.5 without gapping: 13
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 17701
Number of HSP's gapped (non-prelim): 240
length of query: 739
length of database: 908,940,872
effective HSP length: 20
effective length of query: 719
effective length of database: 888,669,252
effective search space: 638953192188
effective search space used: 638953192188
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)