BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3147935.2.1
(711 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AY099719.1| Arabidopsis thaliana unknown protein (At2g26... 42 0.13
emb|AX507108.1| Sequence 1803 from Patent WO0216655 42 0.13
gb|BT008433.1| Arabidopsis thaliana At2g26780 gene, complet... 42 0.13
gb|AC003105.3| Arabidopsis thaliana chromosome 2 clone F18A... 42 0.13
gb|AC005168.3| Arabidopsis thaliana chromosome 2 clone F12C... 42 0.13
gb|AC005623.3| Arabidopsis thaliana chromosome 2 clone T20P... 42 0.13
ref|NM_179755.1| Arabidopsis thaliana unknown protein AT2G2... 42 0.13
ref|NC_003071.3| Arabidopsis thaliana chromosome 2, complet... 42 0.13
>gb|AY099719.1| Arabidopsis thaliana unknown protein (At2g26780) mRNA, complete cds
Length = 3854
Score = 42.1 bits (21), Expect = 0.13
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 210 ttgttcttccttttttgcttt 230
|||||||||||||||||||||
Sbjct: 1885 ttgttcttccttttttgcttt 1905
>emb|AX507108.1| Sequence 1803 from Patent WO0216655
Length = 5129
Score = 42.1 bits (21), Expect = 0.13
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 210 ttgttcttccttttttgcttt 230
|||||||||||||||||||||
Sbjct: 3412 ttgttcttccttttttgcttt 3432
>gb|BT008433.1| Arabidopsis thaliana At2g26780 gene, complete cds
Length = 3627
Score = 42.1 bits (21), Expect = 0.13
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 210 ttgttcttccttttttgcttt 230
|||||||||||||||||||||
Sbjct: 1832 ttgttcttccttttttgcttt 1852
>gb|AC003105.3| Arabidopsis thaliana chromosome 2 clone F18A8 map B68, complete
sequence
Length = 95167
Score = 42.1 bits (21), Expect = 0.13
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 210 ttgttcttccttttttgcttt 230
|||||||||||||||||||||
Sbjct: 88765 ttgttcttccttttttgcttt 88785
>gb|AC005168.3| Arabidopsis thaliana chromosome 2 clone F12C20 map B68, complete
sequence
Length = 87978
Score = 42.1 bits (21), Expect = 0.13
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 210 ttgttcttccttttttgcttt 230
|||||||||||||||||||||
Sbjct: 85753 ttgttcttccttttttgcttt 85733
>gb|AC005623.3| Arabidopsis thaliana chromosome 2 clone T20P8 map B68, complete
sequence
Length = 99345
Score = 42.1 bits (21), Expect = 0.13
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 524 ctcgagttcatctcttccgat 544
|||||||||||||||||||||
Sbjct: 9092 ctcgagttcatctcttccgat 9072
>ref|NM_179755.1| Arabidopsis thaliana unknown protein AT2G26780 mRNA, complete cds
Length = 5824
Score = 42.1 bits (21), Expect = 0.13
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 210 ttgttcttccttttttgcttt 230
|||||||||||||||||||||
Sbjct: 3855 ttgttcttccttttttgcttt 3875
>ref|NC_003071.3| Arabidopsis thaliana chromosome 2, complete sequence
Length = 19705359
Score = 42.1 bits (21), Expect = 0.13
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 524 ctcgagttcatctcttccgat 544
|||||||||||||||||||||
Sbjct: 11516695 ctcgagttcatctcttccgat 11516675
Score = 42.1 bits (21), Expect = 0.13
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 210 ttgttcttccttttttgcttt 230
|||||||||||||||||||||
Sbjct: 11425851 ttgttcttccttttttgcttt 11425871
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 301,883
Number of Sequences: 1013581
Number of extensions: 301883
Number of successful extensions: 22289
Number of sequences better than 0.5: 8
Number of HSP's better than 0.5 without gapping: 8
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 22151
Number of HSP's gapped (non-prelim): 138
length of query: 711
length of database: 908,940,872
effective HSP length: 20
effective length of query: 691
effective length of database: 888,669,252
effective search space: 614070453132
effective search space used: 614070453132
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)