BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3115079.2.1
(636 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AV541193.1|AV541193 AV541193 Arabidopsis thaliana roots ... 44 0.029
gb|AY085918.1| Arabidopsis thaliana clone 19658 mRNA, compl... 44 0.029
emb|AJ270060.1| Arabidopsis thaliana DNA chromosome 4, long... 44 0.029
emb|AL079347.1|ATF11I11 Arabidopsis thaliana DNA chromosome... 44 0.029
emb|AL161586.2|ATCHRIV82 Arabidopsis thaliana DNA chromosom... 44 0.029
gb|DQ062353.1| Arabidopsis thaliana ecotype Ba-1 chalcone s... 44 0.029
gb|DQ062354.1| Arabidopsis thaliana ecotype Ag-0 chalcone s... 44 0.029
gb|DQ062355.1| Arabidopsis thaliana ecotype Bla-1 chalcone ... 44 0.029
gb|DQ062356.1| Arabidopsis thaliana ecotype Co-1 chalcone s... 44 0.029
gb|DQ062357.1| Arabidopsis thaliana ecotype Can-0 chalcone ... 44 0.029
gb|DQ062359.1| Arabidopsis thaliana ecotype Ita-0 chalcone ... 44 0.029
gb|DQ062360.1| Arabidopsis thaliana ecotype Mt-0 chalcone s... 44 0.029
gb|DQ062361.1| Arabidopsis thaliana ecotype Ak-1 chalcone s... 44 0.029
gb|DQ062362.1| Arabidopsis thaliana ecotype Lip-0 chalcone ... 44 0.029
gb|DQ062363.1| Arabidopsis thaliana ecotype Hau-0 chalcone ... 44 0.029
gb|DQ062364.1| Arabidopsis thaliana ecotype Hi-0 chalcone s... 44 0.029
gb|DQ062365.1| Arabidopsis thaliana ecotype Es-0 chalcone s... 44 0.029
gb|DQ062366.1| Arabidopsis thaliana ecotype St-0 chalcone s... 44 0.029
gb|DQ062367.1| Arabidopsis thaliana ecotype Oy-0 chalcone s... 44 0.029
gb|DQ062368.1| Arabidopsis thaliana ecotype Litva chalcone ... 44 0.029
gb|DQ062369.1| Arabidopsis thaliana ecotype Chi-0 chalcone ... 44 0.029
gb|DQ062370.1| Arabidopsis thaliana ecotype En-D chalcone s... 44 0.029
gb|DQ062371.1| Arabidopsis thaliana ecotype Rs-1 chalcone s... 44 0.029
gb|DQ062372.1| Arabidopsis thaliana ecotype Gr-1 chalcone s... 44 0.029
gb|DQ062373.1| Arabidopsis thaliana ecotype Bl-1 chalcone s... 44 0.029
gb|DQ062374.1| Arabidopsis thaliana ecotype Br-0 chalcone s... 44 0.029
gb|DQ062375.1| Arabidopsis thaliana ecotype En-T chalcone s... 44 0.029
gb|DQ062376.1| Arabidopsis thaliana ecotype Kas-1 chalcone ... 44 0.029
gb|DQ062377.1| Arabidopsis thaliana ecotype Pog-0 chalcone ... 44 0.029
gb|DQ062378.1| Arabidopsis thaliana ecotype Ri-0 chalcone s... 44 0.029
gb|DQ062379.1| Arabidopsis thaliana ecotype Van-0 chalcone ... 44 0.029
gb|DQ062380.1| Arabidopsis thaliana ecotype Gre-0 chalcone ... 44 0.029
gb|DQ062381.1| Arabidopsis thaliana ecotype Kin-0 chalcone ... 44 0.029
gb|DQ062382.1| Arabidopsis thaliana ecotype Yo-0 chalcone s... 44 0.029
gb|DQ062383.1| Arabidopsis thaliana ecotype Mv-0 chalcone s... 44 0.029
gb|DQ062384.1| Arabidopsis thaliana ecotype Tsu-0 chalcone ... 44 0.029
ref|NM_119651.2| Arabidopsis thaliana acyltransferase AT4G3... 44 0.029
ref|NM_119652.2| Arabidopsis thaliana beta-fructofuranosida... 44 0.029
ref|NM_001036713.1| Arabidopsis thaliana beta-fructofuranos... 44 0.029
ref|NC_003075.3| Arabidopsis thaliana chromosome 4, complet... 44 0.029
dbj|BA000014.8| Arabidopsis thaliana, chromosome 3, complet... 40 0.45
emb|AL358732.1|ATT27I15 Arabidopsis thaliana DNA chromosome... 40 0.45
ref|NC_003074.4| Arabidopsis thaliana chromosome 3, complet... 40 0.45
>gb|AV541193.1|AV541193 AV541193 Arabidopsis thaliana roots Columbia Arabidopsis thaliana
cDNA clone RZ160e06F 3', mRNA sequence
Length = 491
Score = 44.1 bits (22), Expect = 0.029
Identities = 40/46 (86%)
Strand = Plus / Plus
Query: 403 tactccagcacatagaagattgtattgctgctcacatttccatagt 448
|||||||||||||| | |||| |||||||||| |||| |||||||
Sbjct: 234 tactccagcacataaacaattgaattgctgctcgcattgccatagt 279
>gb|AY085918.1| Arabidopsis thaliana clone 19658 mRNA, complete sequence
Length = 1299
Score = 44.1 bits (22), Expect = 0.029
Identities = 40/46 (86%)
Strand = Plus / Minus
Query: 403 tactccagcacatagaagattgtattgctgctcacatttccatagt 448
|||||||||||||| | |||| |||||||||| |||| |||||||
Sbjct: 1091 tactccagcacataaacaattgaattgctgctcgcattgccatagt 1046
>emb|AJ270060.1| Arabidopsis thaliana DNA chromosome 4, long arm
Length = 14497843
Score = 44.1 bits (22), Expect = 0.029
Identities = 40/46 (86%)
Strand = Plus / Minus
Query: 403 tactccagcacatagaagattgtattgctgctcacatttccatagt 448
|||||||||||||| | |||| |||||||||| |||| |||||||
Sbjct: 12522386 tactccagcacataaacaattgaattgctgctcgcattgccatagt 12522341
>emb|AL079347.1|ATF11I11 Arabidopsis thaliana DNA chromosome 4, BAC clone F11I11 (ESSA project)
Length = 103150
Score = 44.1 bits (22), Expect = 0.029
Identities = 40/46 (86%)
Strand = Plus / Minus
Query: 403 tactccagcacatagaagattgtattgctgctcacatttccatagt 448
|||||||||||||| | |||| |||||||||| |||| |||||||
Sbjct: 34917 tactccagcacataaacaattgaattgctgctcgcattgccatagt 34872
>emb|AL161586.2|ATCHRIV82 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 82
Length = 195165
Score = 44.1 bits (22), Expect = 0.029
Identities = 40/46 (86%)
Strand = Plus / Minus
Query: 403 tactccagcacatagaagattgtattgctgctcacatttccatagt 448
|||||||||||||| | |||| |||||||||| |||| |||||||
Sbjct: 64375 tactccagcacataaacaattgaattgctgctcgcattgccatagt 64330
>gb|DQ062353.1| Arabidopsis thaliana ecotype Ba-1 chalcone synthase family protein
(At4g34850) mRNA, complete cds
Length = 1179
Score = 44.1 bits (22), Expect = 0.029
Identities = 40/46 (86%)
Strand = Plus / Minus
Query: 403 tactccagcacatagaagattgtattgctgctcacatttccatagt 448
|||||||||||||| | |||| |||||||||| |||| |||||||
Sbjct: 1055 tactccagcacataaacaattgaattgctgctcgcattgccatagt 1010
>gb|DQ062354.1| Arabidopsis thaliana ecotype Ag-0 chalcone synthase family protein
(At4g34850) mRNA, complete cds
Length = 1179
Score = 44.1 bits (22), Expect = 0.029
Identities = 40/46 (86%)
Strand = Plus / Minus
Query: 403 tactccagcacatagaagattgtattgctgctcacatttccatagt 448
|||||||||||||| | |||| |||||||||| |||| |||||||
Sbjct: 1055 tactccagcacataaacaattgaattgctgctcgcattgccatagt 1010
>gb|DQ062355.1| Arabidopsis thaliana ecotype Bla-1 chalcone synthase family protein
(At4g34850) mRNA, complete cds
Length = 1179
Score = 44.1 bits (22), Expect = 0.029
Identities = 40/46 (86%)
Strand = Plus / Minus
Query: 403 tactccagcacatagaagattgtattgctgctcacatttccatagt 448
|||||||||||||| | |||| |||||||||| |||| |||||||
Sbjct: 1055 tactccagcacataaacaattgaattgctgctcgcattgccatagt 1010
>gb|DQ062356.1| Arabidopsis thaliana ecotype Co-1 chalcone synthase family protein
(At4g34850) mRNA, complete cds
Length = 1179
Score = 44.1 bits (22), Expect = 0.029
Identities = 40/46 (86%)
Strand = Plus / Minus
Query: 403 tactccagcacatagaagattgtattgctgctcacatttccatagt 448
|||||||||||||| | |||| |||||||||| |||| |||||||
Sbjct: 1055 tactccagcacataaacaattgaattgctgctcgcattgccatagt 1010
>gb|DQ062357.1| Arabidopsis thaliana ecotype Can-0 chalcone synthase family protein
(At4g34850) mRNA, complete cds
Length = 1179
Score = 44.1 bits (22), Expect = 0.029
Identities = 40/46 (86%)
Strand = Plus / Minus
Query: 403 tactccagcacatagaagattgtattgctgctcacatttccatagt 448
|||||||||||||| | |||| |||||||||| |||| |||||||
Sbjct: 1055 tactccagcacataaacaattgaattgctgctcgcattgccatagt 1010
>gb|DQ062359.1| Arabidopsis thaliana ecotype Ita-0 chalcone synthase family protein
(At4g34850) mRNA, complete cds
Length = 1179
Score = 44.1 bits (22), Expect = 0.029
Identities = 40/46 (86%)
Strand = Plus / Minus
Query: 403 tactccagcacatagaagattgtattgctgctcacatttccatagt 448
|||||||||||||| | |||| |||||||||| |||| |||||||
Sbjct: 1055 tactccagcacataaacaattgaattgctgctcgcattgccatagt 1010
>gb|DQ062360.1| Arabidopsis thaliana ecotype Mt-0 chalcone synthase family protein
(At4g34850) mRNA, complete cds
Length = 1179
Score = 44.1 bits (22), Expect = 0.029
Identities = 40/46 (86%)
Strand = Plus / Minus
Query: 403 tactccagcacatagaagattgtattgctgctcacatttccatagt 448
|||||||||||||| | |||| |||||||||| |||| |||||||
Sbjct: 1055 tactccagcacataaacaattgaattgctgctcgcattgccatagt 1010
>gb|DQ062361.1| Arabidopsis thaliana ecotype Ak-1 chalcone synthase family protein
(At4g34850) mRNA, complete cds
Length = 1179
Score = 44.1 bits (22), Expect = 0.029
Identities = 40/46 (86%)
Strand = Plus / Minus
Query: 403 tactccagcacatagaagattgtattgctgctcacatttccatagt 448
|||||||||||||| | |||| |||||||||| |||| |||||||
Sbjct: 1055 tactccagcacataaacaattgaattgctgctcgcattgccatagt 1010
>gb|DQ062362.1| Arabidopsis thaliana ecotype Lip-0 chalcone synthase family protein
(At4g34850) mRNA, complete cds
Length = 1179
Score = 44.1 bits (22), Expect = 0.029
Identities = 40/46 (86%)
Strand = Plus / Minus
Query: 403 tactccagcacatagaagattgtattgctgctcacatttccatagt 448
|||||||||||||| | |||| |||||||||| |||| |||||||
Sbjct: 1055 tactccagcacataaacaattgaattgctgctcgcattgccatagt 1010
>gb|DQ062363.1| Arabidopsis thaliana ecotype Hau-0 chalcone synthase family protein
(At4g34850) mRNA, complete cds
Length = 1179
Score = 44.1 bits (22), Expect = 0.029
Identities = 40/46 (86%)
Strand = Plus / Minus
Query: 403 tactccagcacatagaagattgtattgctgctcacatttccatagt 448
|||||||||||||| | |||| |||||||||| |||| |||||||
Sbjct: 1055 tactccagcacataaacaattgaattgctgctcgcattgccatagt 1010
>gb|DQ062364.1| Arabidopsis thaliana ecotype Hi-0 chalcone synthase family protein
(At4g34850) mRNA, complete cds
Length = 1179
Score = 44.1 bits (22), Expect = 0.029
Identities = 40/46 (86%)
Strand = Plus / Minus
Query: 403 tactccagcacatagaagattgtattgctgctcacatttccatagt 448
|||||||||||||| | |||| |||||||||| |||| |||||||
Sbjct: 1055 tactccagcacataaacaattgaattgctgctcgcattgccatagt 1010
>gb|DQ062365.1| Arabidopsis thaliana ecotype Es-0 chalcone synthase family protein
(At4g34850) mRNA, complete cds
Length = 1179
Score = 44.1 bits (22), Expect = 0.029
Identities = 40/46 (86%)
Strand = Plus / Minus
Query: 403 tactccagcacatagaagattgtattgctgctcacatttccatagt 448
|||||||||||||| | |||| |||||||||| |||| |||||||
Sbjct: 1055 tactccagcacataaacaattgaattgctgctcgcattgccatagt 1010
>gb|DQ062366.1| Arabidopsis thaliana ecotype St-0 chalcone synthase family protein
(At4g34850) mRNA, complete cds
Length = 1179
Score = 44.1 bits (22), Expect = 0.029
Identities = 40/46 (86%)
Strand = Plus / Minus
Query: 403 tactccagcacatagaagattgtattgctgctcacatttccatagt 448
|||||||||||||| | |||| |||||||||| |||| |||||||
Sbjct: 1055 tactccagcacataaacaattgaattgctgctcgcattgccatagt 1010
>gb|DQ062367.1| Arabidopsis thaliana ecotype Oy-0 chalcone synthase family protein
(At4g34850) mRNA, complete cds
Length = 1179
Score = 44.1 bits (22), Expect = 0.029
Identities = 40/46 (86%)
Strand = Plus / Minus
Query: 403 tactccagcacatagaagattgtattgctgctcacatttccatagt 448
|||||||||||||| | |||| |||||||||| |||| |||||||
Sbjct: 1055 tactccagcacataaacaattgaattgctgctcgcattgccatagt 1010
>gb|DQ062368.1| Arabidopsis thaliana ecotype Litva chalcone synthase family protein
(At4g34850) mRNA, complete cds
Length = 1179
Score = 44.1 bits (22), Expect = 0.029
Identities = 40/46 (86%)
Strand = Plus / Minus
Query: 403 tactccagcacatagaagattgtattgctgctcacatttccatagt 448
|||||||||||||| | |||| |||||||||| |||| |||||||
Sbjct: 1055 tactccagcacataaacaattgaattgctgctcgcattgccatagt 1010
>gb|DQ062369.1| Arabidopsis thaliana ecotype Chi-0 chalcone synthase family protein
(At4g34850) mRNA, complete cds
Length = 1179
Score = 44.1 bits (22), Expect = 0.029
Identities = 40/46 (86%)
Strand = Plus / Minus
Query: 403 tactccagcacatagaagattgtattgctgctcacatttccatagt 448
|||||||||||||| | |||| |||||||||| |||| |||||||
Sbjct: 1055 tactccagcacataaacaattgaattgctgctcgcattgccatagt 1010
>gb|DQ062370.1| Arabidopsis thaliana ecotype En-D chalcone synthase family protein
(At4g34850) mRNA, complete cds
Length = 1179
Score = 44.1 bits (22), Expect = 0.029
Identities = 40/46 (86%)
Strand = Plus / Minus
Query: 403 tactccagcacatagaagattgtattgctgctcacatttccatagt 448
|||||||||||||| | |||| |||||||||| |||| |||||||
Sbjct: 1055 tactccagcacataaacaattgaattgctgctcgcattgccatagt 1010
>gb|DQ062371.1| Arabidopsis thaliana ecotype Rs-1 chalcone synthase family protein
(At4g34850) mRNA, complete cds
Length = 1179
Score = 44.1 bits (22), Expect = 0.029
Identities = 40/46 (86%)
Strand = Plus / Minus
Query: 403 tactccagcacatagaagattgtattgctgctcacatttccatagt 448
|||||||||||||| | |||| |||||||||| |||| |||||||
Sbjct: 1055 tactccagcacataaacaattgaattgctgctcgcattgccatagt 1010
>gb|DQ062372.1| Arabidopsis thaliana ecotype Gr-1 chalcone synthase family protein
(At4g34850) mRNA, complete cds
Length = 1179
Score = 44.1 bits (22), Expect = 0.029
Identities = 40/46 (86%)
Strand = Plus / Minus
Query: 403 tactccagcacatagaagattgtattgctgctcacatttccatagt 448
|||||||||||||| | |||| |||||||||| |||| |||||||
Sbjct: 1055 tactccagcacataaacaattgaattgctgctcgcattgccatagt 1010
>gb|DQ062373.1| Arabidopsis thaliana ecotype Bl-1 chalcone synthase family protein
(At4g34850) mRNA, complete cds
Length = 1179
Score = 44.1 bits (22), Expect = 0.029
Identities = 40/46 (86%)
Strand = Plus / Minus
Query: 403 tactccagcacatagaagattgtattgctgctcacatttccatagt 448
|||||||||||||| | |||| |||||||||| |||| |||||||
Sbjct: 1055 tactccagcacataaacaattgaattgctgctcgcattgccatagt 1010
>gb|DQ062374.1| Arabidopsis thaliana ecotype Br-0 chalcone synthase family protein
(At4g34850) mRNA, complete cds
Length = 1179
Score = 44.1 bits (22), Expect = 0.029
Identities = 40/46 (86%)
Strand = Plus / Minus
Query: 403 tactccagcacatagaagattgtattgctgctcacatttccatagt 448
|||||||||||||| | |||| |||||||||| |||| |||||||
Sbjct: 1055 tactccagcacataaacaattgaattgctgctcgcattgccatagt 1010
>gb|DQ062375.1| Arabidopsis thaliana ecotype En-T chalcone synthase family protein
(At4g34850) mRNA, complete cds
Length = 1179
Score = 44.1 bits (22), Expect = 0.029
Identities = 40/46 (86%)
Strand = Plus / Minus
Query: 403 tactccagcacatagaagattgtattgctgctcacatttccatagt 448
|||||||||||||| | |||| |||||||||| |||| |||||||
Sbjct: 1055 tactccagcacataaacaattgaattgctgctcgcattgccatagt 1010
>gb|DQ062376.1| Arabidopsis thaliana ecotype Kas-1 chalcone synthase family protein
(At4g34850) mRNA, complete cds
Length = 1179
Score = 44.1 bits (22), Expect = 0.029
Identities = 40/46 (86%)
Strand = Plus / Minus
Query: 403 tactccagcacatagaagattgtattgctgctcacatttccatagt 448
|||||||||||||| | |||| |||||||||| |||| |||||||
Sbjct: 1055 tactccagcacataaacaattgaattgctgctcgcattgccatagt 1010
>gb|DQ062377.1| Arabidopsis thaliana ecotype Pog-0 chalcone synthase family protein
(At4g34850) mRNA, complete cds
Length = 1179
Score = 44.1 bits (22), Expect = 0.029
Identities = 40/46 (86%)
Strand = Plus / Minus
Query: 403 tactccagcacatagaagattgtattgctgctcacatttccatagt 448
|||||||||||||| | |||| |||||||||| |||| |||||||
Sbjct: 1055 tactccagcacataaacaattgaattgctgctcgcattgccatagt 1010
>gb|DQ062378.1| Arabidopsis thaliana ecotype Ri-0 chalcone synthase family protein
(At4g34850) mRNA, complete cds
Length = 1179
Score = 44.1 bits (22), Expect = 0.029
Identities = 40/46 (86%)
Strand = Plus / Minus
Query: 403 tactccagcacatagaagattgtattgctgctcacatttccatagt 448
|||||||||||||| | |||| |||||||||| |||| |||||||
Sbjct: 1055 tactccagcacataaacaattgaattgctgctcgcattgccatagt 1010
>gb|DQ062379.1| Arabidopsis thaliana ecotype Van-0 chalcone synthase family protein
(At4g34850) mRNA, complete cds
Length = 1179
Score = 44.1 bits (22), Expect = 0.029
Identities = 40/46 (86%)
Strand = Plus / Minus
Query: 403 tactccagcacatagaagattgtattgctgctcacatttccatagt 448
|||||||||||||| | |||| |||||||||| |||| |||||||
Sbjct: 1055 tactccagcacataaacaattgaattgctgctcgcattgccatagt 1010
>gb|DQ062380.1| Arabidopsis thaliana ecotype Gre-0 chalcone synthase family protein
(At4g34850) mRNA, complete cds
Length = 1179
Score = 44.1 bits (22), Expect = 0.029
Identities = 40/46 (86%)
Strand = Plus / Minus
Query: 403 tactccagcacatagaagattgtattgctgctcacatttccatagt 448
|||||||||||||| | |||| |||||||||| |||| |||||||
Sbjct: 1055 tactccagcacataaacaattgaattgctgctcgcattgccatagt 1010
>gb|DQ062381.1| Arabidopsis thaliana ecotype Kin-0 chalcone synthase family protein
(At4g34850) mRNA, complete cds
Length = 1179
Score = 44.1 bits (22), Expect = 0.029
Identities = 40/46 (86%)
Strand = Plus / Minus
Query: 403 tactccagcacatagaagattgtattgctgctcacatttccatagt 448
|||||||||||||| | |||| |||||||||| |||| |||||||
Sbjct: 1055 tactccagcacataaacaattgaattgctgctcgcattgccatagt 1010
>gb|DQ062382.1| Arabidopsis thaliana ecotype Yo-0 chalcone synthase family protein
(At4g34850) mRNA, complete cds
Length = 1179
Score = 44.1 bits (22), Expect = 0.029
Identities = 40/46 (86%)
Strand = Plus / Minus
Query: 403 tactccagcacatagaagattgtattgctgctcacatttccatagt 448
|||||||||||||| | |||| |||||||||| |||| |||||||
Sbjct: 1055 tactccagcacataaacaattgaattgctgctcgcattgccatagt 1010
>gb|DQ062383.1| Arabidopsis thaliana ecotype Mv-0 chalcone synthase family protein
(At4g34850) mRNA, complete cds
Length = 1179
Score = 44.1 bits (22), Expect = 0.029
Identities = 40/46 (86%)
Strand = Plus / Minus
Query: 403 tactccagcacatagaagattgtattgctgctcacatttccatagt 448
|||||||||||||| | |||| |||||||||| |||| |||||||
Sbjct: 1055 tactccagcacataaacaattgaattgctgctcgcattgccatagt 1010
>gb|DQ062384.1| Arabidopsis thaliana ecotype Tsu-0 chalcone synthase family protein
(At4g34850) mRNA, complete cds
Length = 1179
Score = 44.1 bits (22), Expect = 0.029
Identities = 40/46 (86%)
Strand = Plus / Minus
Query: 403 tactccagcacatagaagattgtattgctgctcacatttccatagt 448
|||||||||||||| | |||| |||||||||| |||| |||||||
Sbjct: 1055 tactccagcacataaacaattgaattgctgctcgcattgccatagt 1010
>ref|NM_119651.2| Arabidopsis thaliana acyltransferase AT4G34850 mRNA, complete cds
Length = 1743
Score = 44.1 bits (22), Expect = 0.029
Identities = 40/46 (86%)
Strand = Plus / Minus
Query: 403 tactccagcacatagaagattgtattgctgctcacatttccatagt 448
|||||||||||||| | |||| |||||||||| |||| |||||||
Sbjct: 1091 tactccagcacataaacaattgaattgctgctcgcattgccatagt 1046
>ref|NM_119652.2| Arabidopsis thaliana beta-fructofuranosidase AT4G34860 transcript
variant AT4G34860.1 mRNA, complete cds
Length = 2737
Score = 44.1 bits (22), Expect = 0.029
Identities = 40/46 (86%)
Strand = Plus / Plus
Query: 403 tactccagcacatagaagattgtattgctgctcacatttccatagt 448
|||||||||||||| | |||| |||||||||| |||| |||||||
Sbjct: 2480 tactccagcacataaacaattgaattgctgctcgcattgccatagt 2525
>ref|NM_001036713.1| Arabidopsis thaliana beta-fructofuranosidase AT4G34860 transcript
variant AT4G34860.2 mRNA, complete cds
Length = 2618
Score = 44.1 bits (22), Expect = 0.029
Identities = 40/46 (86%)
Strand = Plus / Plus
Query: 403 tactccagcacatagaagattgtattgctgctcacatttccatagt 448
|||||||||||||| | |||| |||||||||| |||| |||||||
Sbjct: 2361 tactccagcacataaacaattgaattgctgctcgcattgccatagt 2406
>ref|NC_003075.3| Arabidopsis thaliana chromosome 4, complete sequence
Length = 18585042
Score = 44.1 bits (22), Expect = 0.029
Identities = 40/46 (86%)
Strand = Plus / Minus
Query: 403 tactccagcacatagaagattgtattgctgctcacatttccatagt 448
|||||||||||||| | |||| |||||||||| |||| |||||||
Sbjct: 16609601 tactccagcacataaacaattgaattgctgctcgcattgccatagt 16609556
>dbj|BA000014.8| Arabidopsis thaliana, chromosome 3, complete sequence
Length = 23403063
Score = 40.1 bits (20), Expect = 0.45
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 188 tgctcagcttccaccgagac 207
||||||||||||||||||||
Sbjct: 22501383 tgctcagcttccaccgagac 22501364
>emb|AL358732.1|ATT27I15 Arabidopsis thaliana DNA chromosome 3, BAC clone T27I15
Length = 112584
Score = 40.1 bits (20), Expect = 0.45
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 188 tgctcagcttccaccgagac 207
||||||||||||||||||||
Sbjct: 40905 tgctcagcttccaccgagac 40886
>ref|NC_003074.4| Arabidopsis thaliana chromosome 3, complete sequence
Length = 23470805
Score = 40.1 bits (20), Expect = 0.45
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 188 tgctcagcttccaccgagac 207
||||||||||||||||||||
Sbjct: 22554084 tgctcagcttccaccgagac 22554065
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 342,559
Number of Sequences: 1013581
Number of extensions: 342559
Number of successful extensions: 25561
Number of sequences better than 0.5: 43
Number of HSP's better than 0.5 without gapping: 43
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 24968
Number of HSP's gapped (non-prelim): 593
length of query: 636
length of database: 908,940,872
effective HSP length: 20
effective length of query: 616
effective length of database: 888,669,252
effective search space: 547420259232
effective search space used: 547420259232
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)