BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3071761.2.1
(638 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AC005957.3| Arabidopsis thaliana chromosome 2 clone T15J... 40 0.45
emb|BX819827.1|CNS0A9GP Arabidopsis thaliana Full-length cD... 40 0.45
ref|NC_003071.3| Arabidopsis thaliana chromosome 2, complet... 40 0.45
>gb|AC005957.3| Arabidopsis thaliana chromosome 2 clone T15J14 map mi398, complete
sequence
Length = 114041
Score = 40.1 bits (20), Expect = 0.45
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 128 gaccttgctggtgaaatccc 147
||||||||||||||||||||
Sbjct: 53502 gaccttgctggtgaaatccc 53521
>emb|BX819827.1|CNS0A9GP Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTLS32ZH08 of Adult vegetative tissue of strain col-0
of Arabidopsis thaliana (thale cress)
Length = 1374
Score = 40.1 bits (20), Expect = 0.45
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 128 gaccttgctggtgaaatccc 147
||||||||||||||||||||
Sbjct: 618 gaccttgctggtgaaatccc 599
>ref|NC_003071.3| Arabidopsis thaliana chromosome 2, complete sequence
Length = 19705359
Score = 40.1 bits (20), Expect = 0.45
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 128 gaccttgctggtgaaatccc 147
||||||||||||||||||||
Sbjct: 6515261 gaccttgctggtgaaatccc 6515280
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 265,836
Number of Sequences: 1013581
Number of extensions: 265836
Number of successful extensions: 18798
Number of sequences better than 0.5: 3
Number of HSP's better than 0.5 without gapping: 3
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 18679
Number of HSP's gapped (non-prelim): 119
length of query: 638
length of database: 908,940,872
effective HSP length: 20
effective length of query: 618
effective length of database: 888,669,252
effective search space: 549197597736
effective search space used: 549197597736
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)