BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 3071418.2.1
         (1432 letters)

Database: At_nucl_with_EST.fasta 
           1,013,581 sequences; 908,940,872 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|BH244364.1|BH244364  ATZEE57TR ATZE Arabidopsis thaliana ...    42   0.26 
gb|BH244495.1|BH244495  ATZEE03TR ATZE Arabidopsis thaliana ...    42   0.26 
gb|BH244662.1|BH244662  ATZEC36TF ATZE Arabidopsis thaliana ...    42   0.26 

>gb|BH244364.1|BH244364 ATZEE57TR ATZE Arabidopsis thaliana genomic clone ATZEE57, DNA
           sequence
          Length = 588

 Score = 42.1 bits (21), Expect = 0.26
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 647 ggcggcggcgatggtggcggcggcg 671
           |||||||||||||| ||||||||||
Sbjct: 138 ggcggcggcgatggcggcggcggcg 162



>gb|BH244495.1|BH244495 ATZEE03TR ATZE Arabidopsis thaliana genomic clone ATZEE03, DNA
           sequence
          Length = 411

 Score = 42.1 bits (21), Expect = 0.26
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 647 ggcggcggcgatggtggcggcggcg 671
           |||||||||||||| ||||||||||
Sbjct: 191 ggcggcggcgatggcggcggcggcg 167



>gb|BH244662.1|BH244662 ATZEC36TF ATZE Arabidopsis thaliana genomic clone ATZEC36, DNA
           sequence
          Length = 669

 Score = 42.1 bits (21), Expect = 0.26
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 647 ggcggcggcgatggtggcggcggcg 671
           |||||||||||||| ||||||||||
Sbjct: 32  ggcggcggcgatggcggcggcggcg 56



  Database: At_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:09 PM
  Number of letters in database: 908,940,872
  Number of sequences in database:  1,013,581
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 559,880
Number of Sequences: 1013581
Number of extensions: 559880
Number of successful extensions: 43726
Number of sequences better than  0.5: 3
Number of HSP's better than  0.5 without gapping: 3
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 43723
Number of HSP's gapped (non-prelim): 3
length of query: 1432
length of database: 908,940,872
effective HSP length: 21
effective length of query: 1411
effective length of database: 887,655,671
effective search space: 1252482151781
effective search space used: 1252482151781
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)