BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3064721.2.1
(689 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AY039515.1| Arabidopsis thaliana AT3g61130/T20K12_30 mRN... 44 0.031
gb|BT000630.1| Arabidopsis thaliana unknown protein (At3g6... 44 0.031
emb|AJ243015.1|ATH243015 Arabidopsis thaliana LGT1 gene, an... 44 0.031
emb|BX824243.1|CNS0A7GQ Arabidopsis thaliana Full-length cD... 44 0.031
dbj|BA000014.8| Arabidopsis thaliana, chromosome 3, complet... 44 0.031
emb|AL137898.1|ATT20K12 Arabidopsis thaliana DNA chromosome... 44 0.031
ref|NM_115977.2| Arabidopsis thaliana transferase, transfer... 44 0.031
ref|NC_003074.4| Arabidopsis thaliana chromosome 3, complet... 44 0.031
>gb|AY039515.1| Arabidopsis thaliana AT3g61130/T20K12_30 mRNA, complete cds
Length = 2542
Score = 44.1 bits (22), Expect = 0.031
Identities = 31/34 (91%)
Strand = Plus / Plus
Query: 3 atgcttgtggttgggcatatggcatgaacatgtt 36
|||||||||| ||||| ||||| |||||||||||
Sbjct: 1974 atgcttgtggatgggcttatggaatgaacatgtt 2007
>gb|BT000630.1| Arabidopsis thaliana unknown protein (At3g61130/T20K12_30) mRNA,
complete cds
Length = 1920
Score = 44.1 bits (22), Expect = 0.031
Identities = 31/34 (91%)
Strand = Plus / Plus
Query: 3 atgcttgtggttgggcatatggcatgaacatgtt 36
|||||||||| ||||| ||||| |||||||||||
Sbjct: 1652 atgcttgtggatgggcttatggaatgaacatgtt 1685
>emb|AJ243015.1|ATH243015 Arabidopsis thaliana LGT1 gene, and partial FUSCA6 gene
Length = 5000
Score = 44.1 bits (22), Expect = 0.031
Identities = 31/34 (91%)
Strand = Plus / Plus
Query: 3 atgcttgtggttgggcatatggcatgaacatgtt 36
|||||||||| ||||| ||||| |||||||||||
Sbjct: 3280 atgcttgtggatgggcttatggaatgaacatgtt 3313
>emb|BX824243.1|CNS0A7GQ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTPGH32ZE03 of Hormone Treated Callus of strain col-0
of Arabidopsis thaliana (thale cress)
Length = 2452
Score = 44.1 bits (22), Expect = 0.031
Identities = 31/34 (91%)
Strand = Plus / Plus
Query: 3 atgcttgtggttgggcatatggcatgaacatgtt 36
|||||||||| ||||| ||||| |||||||||||
Sbjct: 1925 atgcttgtggatgggcttatggaatgaacatgtt 1958
>dbj|BA000014.8| Arabidopsis thaliana, chromosome 3, complete sequence
Length = 23403063
Score = 44.1 bits (22), Expect = 0.031
Identities = 31/34 (91%)
Strand = Plus / Plus
Query: 3 atgcttgtggttgggcatatggcatgaacatgtt 36
|||||||||| ||||| ||||| |||||||||||
Sbjct: 22583324 atgcttgtggatgggcttatggaatgaacatgtt 22583357
>emb|AL137898.1|ATT20K12 Arabidopsis thaliana DNA chromosome 3, BAC clone T20K12
Length = 109155
Score = 44.1 bits (22), Expect = 0.031
Identities = 31/34 (91%)
Strand = Plus / Plus
Query: 3 atgcttgtggttgggcatatggcatgaacatgtt 36
|||||||||| ||||| ||||| |||||||||||
Sbjct: 13185 atgcttgtggatgggcttatggaatgaacatgtt 13218
>ref|NM_115977.2| Arabidopsis thaliana transferase, transferring glycosyl groups
AT3G61130 mRNA, complete cds
Length = 2546
Score = 44.1 bits (22), Expect = 0.031
Identities = 31/34 (91%)
Strand = Plus / Plus
Query: 3 atgcttgtggttgggcatatggcatgaacatgtt 36
|||||||||| ||||| ||||| |||||||||||
Sbjct: 1974 atgcttgtggatgggcttatggaatgaacatgtt 2007
>ref|NC_003074.4| Arabidopsis thaliana chromosome 3, complete sequence
Length = 23470805
Score = 44.1 bits (22), Expect = 0.031
Identities = 31/34 (91%)
Strand = Plus / Plus
Query: 3 atgcttgtggttgggcatatggcatgaacatgtt 36
|||||||||| ||||| ||||| |||||||||||
Sbjct: 22636025 atgcttgtggatgggcttatggaatgaacatgtt 22636058
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 310,638
Number of Sequences: 1013581
Number of extensions: 310638
Number of successful extensions: 20973
Number of sequences better than 0.5: 8
Number of HSP's better than 0.5 without gapping: 8
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 20783
Number of HSP's gapped (non-prelim): 190
length of query: 689
length of database: 908,940,872
effective HSP length: 20
effective length of query: 669
effective length of database: 888,669,252
effective search space: 594519729588
effective search space used: 594519729588
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)