BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 3064721.2.1
         (689 letters)

Database: At_nucl_with_EST.fasta 
           1,013,581 sequences; 908,940,872 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|AY039515.1|  Arabidopsis thaliana AT3g61130/T20K12_30 mRN...    44   0.031
gb|BT000630.1|  Arabidopsis thaliana unknown protein  (At3g6...    44   0.031
emb|AJ243015.1|ATH243015  Arabidopsis thaliana LGT1 gene, an...    44   0.031
emb|BX824243.1|CNS0A7GQ  Arabidopsis thaliana Full-length cD...    44   0.031
dbj|BA000014.8|  Arabidopsis thaliana, chromosome 3, complet...    44   0.031
emb|AL137898.1|ATT20K12  Arabidopsis thaliana DNA chromosome...    44   0.031
ref|NM_115977.2|  Arabidopsis thaliana transferase, transfer...    44   0.031
ref|NC_003074.4|  Arabidopsis thaliana chromosome 3, complet...    44   0.031
>gb|AY039515.1| Arabidopsis thaliana AT3g61130/T20K12_30 mRNA, complete cds
          Length = 2542

 Score = 44.1 bits (22), Expect = 0.031
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                              
Query: 3    atgcttgtggttgggcatatggcatgaacatgtt 36
            |||||||||| ||||| ||||| |||||||||||
Sbjct: 1974 atgcttgtggatgggcttatggaatgaacatgtt 2007
>gb|BT000630.1| Arabidopsis thaliana unknown protein  (At3g61130/T20K12_30) mRNA,
            complete cds
          Length = 1920

 Score = 44.1 bits (22), Expect = 0.031
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                              
Query: 3    atgcttgtggttgggcatatggcatgaacatgtt 36
            |||||||||| ||||| ||||| |||||||||||
Sbjct: 1652 atgcttgtggatgggcttatggaatgaacatgtt 1685
>emb|AJ243015.1|ATH243015 Arabidopsis thaliana LGT1 gene, and partial FUSCA6 gene
          Length = 5000

 Score = 44.1 bits (22), Expect = 0.031
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                              
Query: 3    atgcttgtggttgggcatatggcatgaacatgtt 36
            |||||||||| ||||| ||||| |||||||||||
Sbjct: 3280 atgcttgtggatgggcttatggaatgaacatgtt 3313
>emb|BX824243.1|CNS0A7GQ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTPGH32ZE03 of Hormone Treated Callus of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 2452

 Score = 44.1 bits (22), Expect = 0.031
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                              
Query: 3    atgcttgtggttgggcatatggcatgaacatgtt 36
            |||||||||| ||||| ||||| |||||||||||
Sbjct: 1925 atgcttgtggatgggcttatggaatgaacatgtt 1958
>dbj|BA000014.8| Arabidopsis thaliana, chromosome 3, complete sequence
          Length = 23403063

 Score = 44.1 bits (22), Expect = 0.031
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                                  
Query: 3        atgcttgtggttgggcatatggcatgaacatgtt 36
                |||||||||| ||||| ||||| |||||||||||
Sbjct: 22583324 atgcttgtggatgggcttatggaatgaacatgtt 22583357
>emb|AL137898.1|ATT20K12 Arabidopsis thaliana DNA chromosome 3, BAC clone T20K12
          Length = 109155

 Score = 44.1 bits (22), Expect = 0.031
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                               
Query: 3     atgcttgtggttgggcatatggcatgaacatgtt 36
             |||||||||| ||||| ||||| |||||||||||
Sbjct: 13185 atgcttgtggatgggcttatggaatgaacatgtt 13218
>ref|NM_115977.2| Arabidopsis thaliana transferase, transferring glycosyl groups
            AT3G61130 mRNA, complete cds
          Length = 2546

 Score = 44.1 bits (22), Expect = 0.031
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                              
Query: 3    atgcttgtggttgggcatatggcatgaacatgtt 36
            |||||||||| ||||| ||||| |||||||||||
Sbjct: 1974 atgcttgtggatgggcttatggaatgaacatgtt 2007
>ref|NC_003074.4| Arabidopsis thaliana chromosome 3, complete sequence
          Length = 23470805

 Score = 44.1 bits (22), Expect = 0.031
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                                  
Query: 3        atgcttgtggttgggcatatggcatgaacatgtt 36
                |||||||||| ||||| ||||| |||||||||||
Sbjct: 22636025 atgcttgtggatgggcttatggaatgaacatgtt 22636058
  Database: At_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:09 PM
  Number of letters in database: 908,940,872
  Number of sequences in database:  1,013,581
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 310,638
Number of Sequences: 1013581
Number of extensions: 310638
Number of successful extensions: 20973
Number of sequences better than  0.5: 8
Number of HSP's better than  0.5 without gapping: 8
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 20783
Number of HSP's gapped (non-prelim): 190
length of query: 689
length of database: 908,940,872
effective HSP length: 20
effective length of query: 669
effective length of database: 888,669,252
effective search space: 594519729588
effective search space used: 594519729588
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)