BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2950290.2.2
(867 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CA782071.1|CA782071 012A02AF Infected Arabidopsis Leaf A... 56 1e-005
gb|BU634881.1|BU634881 012C10 Infected Arabidopsis Leaf Ara... 54 4e-005
gb|CA782025.1|CA782025 011C03AF Infected Arabidopsis Leaf A... 54 4e-005
gb|CA782043.1|CA782043 011E02AF Infected Arabidopsis Leaf A... 54 4e-005
gb|BE038095.1|BE038095 AA08G10 AA Arabidopsis thaliana cDNA... 50 6e-004
gb|BU634868.1|BU634868 012B06 Infected Arabidopsis Leaf Ara... 50 6e-004
gb|BU634909.1|BU634909 012F05 Infected Arabidopsis Leaf Ara... 50 6e-004
gb|BU636634.1|BU636634 009C09 Infected Arabidopsis Leaf Ara... 48 0.003
gb|AI995548.1|AI995548 701674595 A. thaliana, Columbia Col-... 46 0.010
gb|BU634871.1|BU634871 012B10 Infected Arabidopsis Leaf Ara... 46 0.010
gb|BU634896.1|BU634896 012E03 Infected Arabidopsis Leaf Ara... 46 0.010
gb|BU634897.1|BU634897 012E04 Infected Arabidopsis Leaf Ara... 46 0.010
gb|BU635101.1|BU635101 015H01 Infected Arabidopsis Leaf Ara... 46 0.010
gb|BU636616.1|BU636616 009A07 Infected Arabidopsis Leaf Ara... 46 0.010
gb|BU636633.1|BU636633 009C08 Infected Arabidopsis Leaf Ara... 46 0.010
gb|BU636645.1|BU636645 009E07 Infected Arabidopsis Leaf Ara... 46 0.010
gb|BU636778.1|BU636778 011E06 Infected Arabidopsis Leaf Ara... 46 0.010
gb|CA781148.1|CA781148 012A10AF Infected Arabidopsis Leaf A... 46 0.010
gb|CA781152.1|CA781152 014D05AF Infected Arabidopsis Leaf A... 46 0.010
gb|CA781249.1|CA781249 012H03AF Infected Arabidopsis Leaf A... 46 0.010
gb|CA781256.1|CA781256 014A02AF Infected Arabidopsis Leaf A... 46 0.010
gb|CA781928.1|CA781928 007G10AF Infected Arabidopsis Leaf A... 46 0.010
gb|AV556099.1|AV556099 AV556099 Arabidopsis thaliana green ... 46 0.010
gb|CB252130.1|CB252130 34-E012994-019-004-D09-SP6r MPIZ-ADI... 46 0.010
gb|CB252133.1|CB252133 34-E012999-019-004-D09-T7R MPIZ-ADIS... 46 0.010
gb|AY050813.1| Arabidopsis thaliana putative P-protein: cho... 46 0.010
gb|AY113967.1| Arabidopsis thaliana putative P-protein (At3... 46 0.010
gb|AY084830.1| Arabidopsis thaliana clone 118932 mRNA, comp... 46 0.010
emb|BX822651.1|CNS0A5XJ Arabidopsis thaliana Full-length cD... 46 0.010
emb|BX822781.1|CNS0A64W Arabidopsis thaliana Full-length cD... 46 0.010
ref|NM_111642.2| Arabidopsis thaliana amino acid binding / ... 46 0.010
ref|NM_202520.1| Arabidopsis thaliana amino acid binding / ... 46 0.010
gb|CA781245.1|CA781245 012F07AF Infected Arabidopsis Leaf A... 44 0.040
emb|BX825513.1|CNS0A4ZF Arabidopsis thaliana Full-length cD... 44 0.040
gb|BE037619.1|BE037619 AA01H08 AA Arabidopsis thaliana cDNA... 42 0.16
gb|BU634552.1|BU634552 005A10 Infected Arabidopsis Leaf Ara... 42 0.16
gb|BU634614.1|BU634614 011B07 Infected Arabidopsis Leaf Ara... 42 0.16
gb|CA781370.1|CA781370 016C02AF Infected Arabidopsis Leaf A... 42 0.16
gb|CA963918.1|CA963918 cATI014A01AF Infected Arabidopsis Le... 42 0.16
>gb|CA782071.1|CA782071 012A02AF Infected Arabidopsis Leaf Arabidopsis thaliana cDNA, mRNA
sequence
Length = 577
Score = 56.0 bits (28), Expect = 1e-005
Identities = 31/32 (96%)
Strand = Plus / Minus
Query: 836 acctggtgccgaatcctgcagcccgggggatc 867
|||| |||||||||||||||||||||||||||
Sbjct: 37 acctcgtgccgaatcctgcagcccgggggatc 6
>gb|BU634881.1|BU634881 012C10 Infected Arabidopsis Leaf Arabidopsis thaliana cDNA, mRNA
sequence
Length = 584
Score = 54.0 bits (27), Expect = 4e-005
Identities = 27/27 (100%)
Strand = Plus / Minus
Query: 841 gtgccgaatcctgcagcccgggggatc 867
|||||||||||||||||||||||||||
Sbjct: 28 gtgccgaatcctgcagcccgggggatc 2
>gb|CA782025.1|CA782025 011C03AF Infected Arabidopsis Leaf Arabidopsis thaliana cDNA, mRNA
sequence
Length = 391
Score = 54.0 bits (27), Expect = 4e-005
Identities = 27/27 (100%)
Strand = Plus / Minus
Query: 841 gtgccgaatcctgcagcccgggggatc 867
|||||||||||||||||||||||||||
Sbjct: 34 gtgccgaatcctgcagcccgggggatc 8
>gb|CA782043.1|CA782043 011E02AF Infected Arabidopsis Leaf Arabidopsis thaliana cDNA, mRNA
sequence
Length = 439
Score = 54.0 bits (27), Expect = 4e-005
Identities = 27/27 (100%)
Strand = Plus / Minus
Query: 841 gtgccgaatcctgcagcccgggggatc 867
|||||||||||||||||||||||||||
Sbjct: 30 gtgccgaatcctgcagcccgggggatc 4
>gb|BE038095.1|BE038095 AA08G10 AA Arabidopsis thaliana cDNA 5' similar to 60s ribosomal
protein l7, mRNA sequence
Length = 764
Score = 50.1 bits (25), Expect = 6e-004
Identities = 25/25 (100%)
Strand = Plus / Minus
Query: 843 gccgaatcctgcagcccgggggatc 867
|||||||||||||||||||||||||
Sbjct: 75 gccgaatcctgcagcccgggggatc 51
>gb|BU634868.1|BU634868 012B06 Infected Arabidopsis Leaf Arabidopsis thaliana cDNA, mRNA
sequence
Length = 415
Score = 50.1 bits (25), Expect = 6e-004
Identities = 31/33 (93%)
Strand = Plus / Minus
Query: 835 aacctggtgccgaatcctgcagcccgggggatc 867
||||| ||||||| |||||||||||||||||||
Sbjct: 43 aacctcgtgccgattcctgcagcccgggggatc 11
>gb|BU634909.1|BU634909 012F05 Infected Arabidopsis Leaf Arabidopsis thaliana cDNA, mRNA
sequence
Length = 677
Score = 50.1 bits (25), Expect = 6e-004
Identities = 31/33 (93%)
Strand = Plus / Minus
Query: 835 aacctggtgccgaatcctgcagcccgggggatc 867
||||| ||||||| |||||||||||||||||||
Sbjct: 54 aacctcgtgccgattcctgcagcccgggggatc 22
>gb|BU636634.1|BU636634 009C09 Infected Arabidopsis Leaf Arabidopsis thaliana cDNA, mRNA
sequence
Length = 602
Score = 48.1 bits (24), Expect = 0.003
Identities = 27/28 (96%)
Strand = Plus / Minus
Query: 835 aacctggtgccgaatcctgcagcccggg 862
||||| ||||||||||||||||||||||
Sbjct: 28 aacctcgtgccgaatcctgcagcccggg 1
>gb|AI995548.1|AI995548 701674595 A. thaliana, Columbia Col-0, inflorescence-1 Arabidopsis
thaliana cDNA clone 701674595, mRNA sequence
Length = 603
Score = 46.1 bits (23), Expect = 0.010
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 609 ctttcaatctttgtgaggttgat 631
|||||||||||||||||||||||
Sbjct: 496 ctttcaatctttgtgaggttgat 518
>gb|BU634871.1|BU634871 012B10 Infected Arabidopsis Leaf Arabidopsis thaliana cDNA, mRNA
sequence
Length = 646
Score = 46.1 bits (23), Expect = 0.010
Identities = 26/27 (96%)
Strand = Plus / Minus
Query: 841 gtgccgaatcctgcagcccgggggatc 867
||||||| |||||||||||||||||||
Sbjct: 34 gtgccgattcctgcagcccgggggatc 8
>gb|BU634896.1|BU634896 012E03 Infected Arabidopsis Leaf Arabidopsis thaliana cDNA, mRNA
sequence
Length = 678
Score = 46.1 bits (23), Expect = 0.010
Identities = 26/27 (96%)
Strand = Plus / Minus
Query: 841 gtgccgaatcctgcagcccgggggatc 867
||||||| |||||||||||||||||||
Sbjct: 36 gtgccgattcctgcagcccgggggatc 10
>gb|BU634897.1|BU634897 012E04 Infected Arabidopsis Leaf Arabidopsis thaliana cDNA, mRNA
sequence
Length = 682
Score = 46.1 bits (23), Expect = 0.010
Identities = 26/27 (96%)
Strand = Plus / Minus
Query: 841 gtgccgaatcctgcagcccgggggatc 867
||||||| |||||||||||||||||||
Sbjct: 32 gtgccgattcctgcagcccgggggatc 6
>gb|BU635101.1|BU635101 015H01 Infected Arabidopsis Leaf Arabidopsis thaliana cDNA, mRNA
sequence
Length = 743
Score = 46.1 bits (23), Expect = 0.010
Identities = 26/27 (96%)
Strand = Plus / Minus
Query: 841 gtgccgaatcctgcagcccgggggatc 867
||||||| |||||||||||||||||||
Sbjct: 29 gtgccgattcctgcagcccgggggatc 3
>gb|BU636616.1|BU636616 009A07 Infected Arabidopsis Leaf Arabidopsis thaliana cDNA, mRNA
sequence
Length = 651
Score = 46.1 bits (23), Expect = 0.010
Identities = 26/27 (96%)
Strand = Plus / Minus
Query: 841 gtgccgaatcctgcagcccgggggatc 867
||||||| |||||||||||||||||||
Sbjct: 33 gtgccgattcctgcagcccgggggatc 7
>gb|BU636633.1|BU636633 009C08 Infected Arabidopsis Leaf Arabidopsis thaliana cDNA, mRNA
sequence
Length = 522
Score = 46.1 bits (23), Expect = 0.010
Identities = 26/27 (96%)
Strand = Plus / Minus
Query: 841 gtgccgaatcctgcagcccgggggatc 867
||||||| |||||||||||||||||||
Sbjct: 28 gtgccgattcctgcagcccgggggatc 2
>gb|BU636645.1|BU636645 009E07 Infected Arabidopsis Leaf Arabidopsis thaliana cDNA, mRNA
sequence
Length = 578
Score = 46.1 bits (23), Expect = 0.010
Identities = 26/27 (96%)
Strand = Plus / Minus
Query: 841 gtgccgaatcctgcagcccgggggatc 867
||||||| |||||||||||||||||||
Sbjct: 29 gtgccgattcctgcagcccgggggatc 3
>gb|BU636778.1|BU636778 011E06 Infected Arabidopsis Leaf Arabidopsis thaliana cDNA, mRNA
sequence
Length = 574
Score = 46.1 bits (23), Expect = 0.010
Identities = 33/35 (94%), Gaps = 1/35 (2%)
Strand = Plus / Minus
Query: 834 gaacctggtgccgaat-cctgcagcccgggggatc 867
|||||| ||||||||| ||||||||||||||||||
Sbjct: 40 gaacctcgtgccgaattcctgcagcccgggggatc 6
>gb|CA781148.1|CA781148 012A10AF Infected Arabidopsis Leaf Arabidopsis thaliana cDNA, mRNA
sequence
Length = 55
Score = 46.1 bits (23), Expect = 0.010
Identities = 26/27 (96%)
Strand = Plus / Minus
Query: 841 gtgccgaatcctgcagcccgggggatc 867
||||||| |||||||||||||||||||
Sbjct: 53 gtgccgattcctgcagcccgggggatc 27
>gb|CA781152.1|CA781152 014D05AF Infected Arabidopsis Leaf Arabidopsis thaliana cDNA, mRNA
sequence
Length = 293
Score = 46.1 bits (23), Expect = 0.010
Identities = 23/23 (100%)
Strand = Plus / Minus
Query: 841 gtgccgaatcctgcagcccgggg 863
|||||||||||||||||||||||
Sbjct: 25 gtgccgaatcctgcagcccgggg 3
>gb|CA781249.1|CA781249 012H03AF Infected Arabidopsis Leaf Arabidopsis thaliana cDNA, mRNA
sequence
Length = 648
Score = 46.1 bits (23), Expect = 0.010
Identities = 26/27 (96%)
Strand = Plus / Minus
Query: 841 gtgccgaatcctgcagcccgggggatc 867
||||||| |||||||||||||||||||
Sbjct: 34 gtgccgattcctgcagcccgggggatc 8
>gb|CA781256.1|CA781256 014A02AF Infected Arabidopsis Leaf Arabidopsis thaliana cDNA, mRNA
sequence
Length = 121
Score = 46.1 bits (23), Expect = 0.010
Identities = 26/27 (96%)
Strand = Plus / Minus
Query: 841 gtgccgaatcctgcagcccgggggatc 867
||||||| |||||||||||||||||||
Sbjct: 27 gtgccgattcctgcagcccgggggatc 1
>gb|CA781928.1|CA781928 007G10AF Infected Arabidopsis Leaf Arabidopsis thaliana cDNA, mRNA
sequence
Length = 315
Score = 46.1 bits (23), Expect = 0.010
Identities = 23/23 (100%)
Strand = Plus / Minus
Query: 841 gtgccgaatcctgcagcccgggg 863
|||||||||||||||||||||||
Sbjct: 25 gtgccgaatcctgcagcccgggg 3
>gb|AV556099.1|AV556099 AV556099 Arabidopsis thaliana green siliques Columbia Arabidopsis
thaliana cDNA clone SQ034d11F 3', mRNA sequence
Length = 560
Score = 46.1 bits (23), Expect = 0.010
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 609 ctttcaatctttgtgaggttgat 631
|||||||||||||||||||||||
Sbjct: 458 ctttcaatctttgtgaggttgat 480
>gb|CB252130.1|CB252130 34-E012994-019-004-D09-SP6r MPIZ-ADIS-019 Arabidopsis thaliana cDNA
clone MPIZp768D094Q 3-PRIME, mRNA sequence
Length = 635
Score = 46.1 bits (23), Expect = 0.010
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 609 ctttcaatctttgtgaggttgat 631
|||||||||||||||||||||||
Sbjct: 482 ctttcaatctttgtgaggttgat 504
>gb|CB252133.1|CB252133 34-E012999-019-004-D09-T7R MPIZ-ADIS-019 Arabidopsis thaliana cDNA
clone MPIZp768D094Q 5-PRIME, mRNA sequence
Length = 625
Score = 46.1 bits (23), Expect = 0.010
Identities = 23/23 (100%)
Strand = Plus / Minus
Query: 609 ctttcaatctttgtgaggttgat 631
|||||||||||||||||||||||
Sbjct: 415 ctttcaatctttgtgaggttgat 393
>gb|AY050813.1| Arabidopsis thaliana putative P-protein: chorismate mutase,
prephenate dehydratase (At3g07630) mRNA, complete cds
Length = 1514
Score = 46.1 bits (23), Expect = 0.010
Identities = 23/23 (100%)
Strand = Plus / Minus
Query: 609 ctttcaatctttgtgaggttgat 631
|||||||||||||||||||||||
Sbjct: 966 ctttcaatctttgtgaggttgat 944
>gb|AY113967.1| Arabidopsis thaliana putative P-protein (At3g07630) mRNA, complete
cds
Length = 1177
Score = 46.1 bits (23), Expect = 0.010
Identities = 23/23 (100%)
Strand = Plus / Minus
Query: 609 ctttcaatctttgtgaggttgat 631
|||||||||||||||||||||||
Sbjct: 959 ctttcaatctttgtgaggttgat 937
>gb|AY084830.1| Arabidopsis thaliana clone 118932 mRNA, complete sequence
Length = 1486
Score = 46.1 bits (23), Expect = 0.010
Identities = 23/23 (100%)
Strand = Plus / Minus
Query: 609 ctttcaatctttgtgaggttgat 631
|||||||||||||||||||||||
Sbjct: 971 ctttcaatctttgtgaggttgat 949
>emb|BX822651.1|CNS0A5XJ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTFB56ZE11 of Flowers and buds of strain col-0 of
Arabidopsis thaliana (thale cress)
Length = 1353
Score = 46.1 bits (23), Expect = 0.010
Identities = 23/23 (100%)
Strand = Plus / Minus
Query: 609 ctttcaatctttgtgaggttgat 631
|||||||||||||||||||||||
Sbjct: 952 ctttcaatctttgtgaggttgat 930
>emb|BX822781.1|CNS0A64W Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTFB63ZG10 of Flowers and buds of strain col-0 of
Arabidopsis thaliana (thale cress)
Length = 1436
Score = 46.1 bits (23), Expect = 0.010
Identities = 23/23 (100%)
Strand = Plus / Minus
Query: 609 ctttcaatctttgtgaggttgat 631
|||||||||||||||||||||||
Sbjct: 956 ctttcaatctttgtgaggttgat 934
>ref|NM_111642.2| Arabidopsis thaliana amino acid binding / prephenate dehydratase
AT3G07630 transcript variant AT3G07630.1 mRNA, complete
cds
Length = 1518
Score = 46.1 bits (23), Expect = 0.010
Identities = 23/23 (100%)
Strand = Plus / Minus
Query: 609 ctttcaatctttgtgaggttgat 631
|||||||||||||||||||||||
Sbjct: 971 ctttcaatctttgtgaggttgat 949
>ref|NM_202520.1| Arabidopsis thaliana amino acid binding / prephenate dehydratase
AT3G07630 transcript variant AT3G07630.2 mRNA, complete
cds
Length = 1503
Score = 46.1 bits (23), Expect = 0.010
Identities = 23/23 (100%)
Strand = Plus / Minus
Query: 609 ctttcaatctttgtgaggttgat 631
|||||||||||||||||||||||
Sbjct: 966 ctttcaatctttgtgaggttgat 944
>gb|CA781245.1|CA781245 012F07AF Infected Arabidopsis Leaf Arabidopsis thaliana cDNA, mRNA
sequence
Length = 522
Score = 44.1 bits (22), Expect = 0.040
Identities = 32/34 (94%), Gaps = 1/34 (2%)
Strand = Plus / Minus
Query: 835 aacctggtgccgaat-cctgcagcccgggggatc 867
||||| ||||||||| ||||||||||||||||||
Sbjct: 37 aacctcgtgccgaattcctgcagcccgggggatc 4
>emb|BX825513.1|CNS0A4ZF Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTSIL41ZD10 of Silique of strain col-0 of Arabidopsis
thaliana (thale cress)
Length = 1330
Score = 44.1 bits (22), Expect = 0.040
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 609 ctttcaatctttgtgaggttga 630
||||||||||||||||||||||
Sbjct: 950 ctttcaatctttgtgaggttga 929
>gb|BE037619.1|BE037619 AA01H08 AA Arabidopsis thaliana cDNA 5' similar to
ubiquitin-conjugating enzyme e2-17 kd 10
(ubiquitin-protein ligase 10) (ubiquitin carrier protein
10), mRNA sequence
Length = 878
Score = 42.1 bits (21), Expect = 0.16
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 841 gtgccgaatcctgcagcccgg 861
|||||||||||||||||||||
Sbjct: 26 gtgccgaatcctgcagcccgg 6
>gb|BU634552.1|BU634552 005A10 Infected Arabidopsis Leaf Arabidopsis thaliana cDNA, mRNA
sequence
Length = 584
Score = 42.1 bits (21), Expect = 0.16
Identities = 31/33 (93%), Gaps = 1/33 (3%)
Strand = Plus / Minus
Query: 835 aacctggtgccgaat-cctgcagcccgggggat 866
||||| ||||||||| |||||||||||||||||
Sbjct: 33 aacctcgtgccgaattcctgcagcccgggggat 1
>gb|BU634614.1|BU634614 011B07 Infected Arabidopsis Leaf Arabidopsis thaliana cDNA, mRNA
sequence
Length = 127
Score = 42.1 bits (21), Expect = 0.16
Identities = 31/33 (93%), Gaps = 1/33 (3%)
Strand = Plus / Minus
Query: 836 acctggtgccgaat-cctgcagcccgggggatc 867
|||| ||||||||| ||||||||||||||||||
Sbjct: 41 acctcgtgccgaattcctgcagcccgggggatc 9
>gb|CA781370.1|CA781370 016C02AF Infected Arabidopsis Leaf Arabidopsis thaliana cDNA, mRNA
sequence
Length = 730
Score = 42.1 bits (21), Expect = 0.16
Identities = 31/33 (93%), Gaps = 1/33 (3%)
Strand = Plus / Minus
Query: 836 acctggtgccgaat-cctgcagcccgggggatc 867
|||| ||||||||| ||||||||||||||||||
Sbjct: 38 acctcgtgccgaattcctgcagcccgggggatc 6
>gb|CA963918.1|CA963918 cATI014A01AF Infected Arabidopsis Leaf Arabidopsis thaliana cDNA,
mRNA sequence
Length = 567
Score = 42.1 bits (21), Expect = 0.16
Identities = 24/25 (96%)
Strand = Plus / Minus
Query: 841 gtgccgaatcctgcagcccggggga 865
||||||| |||||||||||||||||
Sbjct: 25 gtgccgattcctgcagcccggggga 1
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 490,008
Number of Sequences: 1013581
Number of extensions: 490008
Number of successful extensions: 34074
Number of sequences better than 0.5: 39
Number of HSP's better than 0.5 without gapping: 34
Number of HSP's successfully gapped in prelim test: 5
Number of HSP's that attempted gapping in prelim test: 34028
Number of HSP's gapped (non-prelim): 51
length of query: 867
length of database: 908,940,872
effective HSP length: 20
effective length of query: 847
effective length of database: 888,669,252
effective search space: 752702856444
effective search space used: 752702856444
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)