BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 2921788.2.1
         (606 letters)

Database: At_nucl_with_EST.fasta 
           1,013,581 sequences; 908,940,872 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|CL515742.1|CL515742  SAIL_904_D06.v1 SAIL Collection Arab...    40   0.43 
gb|CL517113.1|CL517113  SAIL_9_G10.v1 SAIL Collection Arabid...    40   0.43 

>gb|CL515742.1|CL515742 SAIL_904_D06.v1 SAIL Collection Arabidopsis thaliana genomic clone
           SAIL_904_D06.v1, DNA sequence
          Length = 805

 Score = 40.1 bits (20), Expect = 0.43
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 148 aggggcggcgggggaggggtgggg 171
           |||||||||||| |||||||||||
Sbjct: 496 aggggcggcgggtgaggggtgggg 473



>gb|CL517113.1|CL517113 SAIL_9_G10.v1 SAIL Collection Arabidopsis thaliana genomic clone
           SAIL_9_G10.v1, DNA sequence
          Length = 995

 Score = 40.1 bits (20), Expect = 0.43
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 152 gcggcgggggaggggtgggg 171
           ||||||||||||||||||||
Sbjct: 699 gcggcgggggaggggtgggg 718



  Database: At_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:09 PM
  Number of letters in database: 908,940,872
  Number of sequences in database:  1,013,581
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 252,369
Number of Sequences: 1013581
Number of extensions: 252369
Number of successful extensions: 21753
Number of sequences better than  0.5: 2
Number of HSP's better than  0.5 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 21751
Number of HSP's gapped (non-prelim): 2
length of query: 606
length of database: 908,940,872
effective HSP length: 20
effective length of query: 586
effective length of database: 888,669,252
effective search space: 520760181672
effective search space used: 520760181672
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)