BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2750929.2.1
(583 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|DR749730.1|DR749730 94-L021131-065-005-F12-SeLB MPIZ-ADI... 42 0.10
dbj|AB022213.1| Arabidopsis thaliana genomic DNA, chromosom... 42 0.10
gb|BT012003.1| Arabidopsis thaliana At5g45580 mRNA sequence 42 0.10
dbj|BA000015.5| Arabidopsis thaliana DNA, chromosome 5, com... 42 0.10
ref|NM_123926.2| Arabidopsis thaliana transcription factor ... 42 0.10
ref|NC_003076.4| Arabidopsis thaliana chromosome 5, complet... 42 0.10
gb|CL470718.1|CL470718 SAIL_147_B01.v1 SAIL Collection Arab... 40 0.41
gb|CL509238.1|CL509238 SAIL_810_H09.v1 SAIL Collection Arab... 40 0.41
gb|AC022520.2|AC022520 Arabidopsis thaliana chromosome I BA... 40 0.41
gb|AC019018.9|AC019018 Arabidopsis thaliana chromosome 1 BA... 40 0.41
gb|AE005173.1| Arabidopsis thaliana chromosome 1, bottom ar... 40 0.41
ref|NC_003070.5| Arabidopsis thaliana chromosome 1, complet... 40 0.41
>gb|DR749730.1|DR749730 94-L021131-065-005-F12-SeLB MPIZ-ADIS-065d Arabidopsis thaliana
cDNA clone 005-F12, mRNA sequence
Length = 835
Score = 42.1 bits (21), Expect = 0.10
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 562 ctgtaccatctcaagagccat 582
|||||||||||||||||||||
Sbjct: 694 ctgtaccatctcaagagccat 674
>dbj|AB022213.1| Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K2N11
Length = 30340
Score = 42.1 bits (21), Expect = 0.10
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 562 ctgtaccatctcaagagccat 582
|||||||||||||||||||||
Sbjct: 16527 ctgtaccatctcaagagccat 16507
>gb|BT012003.1| Arabidopsis thaliana At5g45580 mRNA sequence
Length = 840
Score = 42.1 bits (21), Expect = 0.10
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 562 ctgtaccatctcaagagccat 582
|||||||||||||||||||||
Sbjct: 190 ctgtaccatctcaagagccat 210
>dbj|BA000015.5| Arabidopsis thaliana DNA, chromosome 5, complete sequence
Length = 23810767
Score = 42.1 bits (21), Expect = 0.10
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 562 ctgtaccatctcaagagccat 582
|||||||||||||||||||||
Sbjct: 16764862 ctgtaccatctcaagagccat 16764842
>ref|NM_123926.2| Arabidopsis thaliana transcription factor AT5G45580 mRNA, complete
cds
Length = 840
Score = 42.1 bits (21), Expect = 0.10
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 562 ctgtaccatctcaagagccat 582
|||||||||||||||||||||
Sbjct: 190 ctgtaccatctcaagagccat 210
>ref|NC_003076.4| Arabidopsis thaliana chromosome 5, complete sequence
Length = 26992728
Score = 42.1 bits (21), Expect = 0.10
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 562 ctgtaccatctcaagagccat 582
|||||||||||||||||||||
Sbjct: 18499368 ctgtaccatctcaagagccat 18499348
>gb|CL470718.1|CL470718 SAIL_147_B01.v1 SAIL Collection Arabidopsis thaliana genomic clone
SAIL_147_B01.v1, DNA sequence
Length = 980
Score = 40.1 bits (20), Expect = 0.41
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 110 cacaccacacaaacaaacac 129
||||||||||||||||||||
Sbjct: 315 cacaccacacaaacaaacac 334
>gb|CL509238.1|CL509238 SAIL_810_H09.v1 SAIL Collection Arabidopsis thaliana genomic clone
SAIL_810_H09.v1, DNA sequence
Length = 947
Score = 40.1 bits (20), Expect = 0.41
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 111 acaccacacaaacaaacacc 130
||||||||||||||||||||
Sbjct: 688 acaccacacaaacaaacacc 707
>gb|AC022520.2|AC022520 Arabidopsis thaliana chromosome I BAC F8L10 genomic sequence, complete
sequence
Length = 110611
Score = 40.1 bits (20), Expect = 0.41
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 70 tctgtctcactcactcactcactc 93
|||||||||||| |||||||||||
Sbjct: 78770 tctgtctcactctctcactcactc 78793
>gb|AC019018.9|AC019018 Arabidopsis thaliana chromosome 1 BAC F14G24 genomic sequence, complete
sequence
Length = 126253
Score = 40.1 bits (20), Expect = 0.41
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 70 tctgtctcactcactcactcactc 93
|||||||||||| |||||||||||
Sbjct: 116233 tctgtctcactctctcactcactc 116210
>gb|AE005173.1| Arabidopsis thaliana chromosome 1, bottom arm complete sequence
Length = 14668883
Score = 40.1 bits (20), Expect = 0.41
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 70 tctgtctcactcactcactcactc 93
|||||||||||| |||||||||||
Sbjct: 4106434 tctgtctcactctctcactcactc 4106411
>ref|NC_003070.5| Arabidopsis thaliana chromosome 1, complete sequence
Length = 30432563
Score = 40.1 bits (20), Expect = 0.41
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 70 tctgtctcactcactcactcactc 93
|||||||||||| |||||||||||
Sbjct: 19750839 tctgtctcactctctcactcactc 19750816
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 267,014
Number of Sequences: 1013581
Number of extensions: 267014
Number of successful extensions: 22112
Number of sequences better than 0.5: 12
Number of HSP's better than 0.5 without gapping: 12
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 21597
Number of HSP's gapped (non-prelim): 515
length of query: 583
length of database: 908,940,872
effective HSP length: 20
effective length of query: 563
effective length of database: 888,669,252
effective search space: 500320788876
effective search space used: 500320788876
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)