BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2647917.2.1
(3189 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
dbj|AB074762.1| Arabidopsis thaliana mRNA for putative rece... 131 8e-028
dbj|BA000014.8| Arabidopsis thaliana, chromosome 3, complet... 131 8e-028
emb|AL356014.1|ATF25L23 Arabidopsis thaliana DNA chromosome... 131 8e-028
ref|NM_115804.3| Arabidopsis thaliana ACR4; kinase AT3G5942... 131 8e-028
ref|NC_003074.4| Arabidopsis thaliana chromosome 3, complet... 131 8e-028
emb|AL082002.1|CNS00NJO Arabidopsis thaliana genome survey ... 60 3e-006
gb|AV561141.1|AV561141 AV561141 Arabidopsis thaliana green ... 60 3e-006
gb|AV562142.1|AV562142 AV562142 Arabidopsis thaliana green ... 60 3e-006
gb|AV565071.1|AV565071 AV565071 Arabidopsis thaliana green ... 60 3e-006
emb|BX660697.1| Arabidopsis thaliana T-DNA flanking sequenc... 52 6e-004
gb|AY085517.1| Arabidopsis thaliana clone 15535 mRNA, compl... 48 0.010
gb|AY087491.1| Arabidopsis thaliana clone 36000 mRNA, compl... 48 0.010
gb|AC051626.5|AC051626 Genomic Sequence For Arabidopsis tha... 48 0.010
gb|AC069328.1|AC069328 Genomic Sequence For Arabidopsis tha... 48 0.010
emb|BX830642.1|CNS09ZZZ Arabidopsis thaliana Full-length cD... 48 0.010
dbj|BA000015.5| Arabidopsis thaliana DNA, chromosome 5, com... 48 0.010
ref|NM_121855.2| Arabidopsis thaliana ATP binding / kinase/... 48 0.010
ref|NM_001036821.1| Arabidopsis thaliana ATP binding / kina... 48 0.010
ref|NC_003076.4| Arabidopsis thaliana chromosome 5, complet... 48 0.010
gb|AF370509.1|AF370509 Arabidopsis thaliana protein kinase-... 46 0.038
gb|AY056788.1| Arabidopsis thaliana AT3g24550/MOB24_8 mRNA,... 46 0.038
gb|AY059901.1| Arabidopsis thaliana protein kinase-like pro... 46 0.038
gb|AY093065.1| Arabidopsis thaliana unknown protein (At3g24... 46 0.038
gb|AY128792.1| Arabidopsis thaliana protein kinase-like pro... 46 0.038
gb|AY089024.1| Arabidopsis thaliana clone 17909 mRNA, compl... 46 0.038
gb|BT008400.1| Arabidopsis thaliana At3g24550 gene, complet... 46 0.038
gb|BT008409.1| Arabidopsis thaliana At3g24600 gene, complet... 46 0.038
emb|AX825738.1| Sequence 36 from Patent WO03072763 46 0.038
emb|BX823746.1|CNS0A4QX Arabidopsis thaliana Full-length cD... 46 0.038
dbj|AB020746.1| Arabidopsis thaliana genomic DNA, chromosom... 46 0.038
dbj|AP000382.1| Arabidopsis thaliana genomic DNA, chromosom... 46 0.038
emb|AL162508.1|ATT7H20 Arabidopsis thaliana DNA chromosome ... 46 0.038
ref|NM_120285.1| Arabidopsis thaliana kinase AT5G02070 mRNA... 46 0.038
ref|NM_113366.2| Arabidopsis thaliana ATP binding / protein... 46 0.038
gb|AE005172.1| Arabidopsis thaliana chromosome 1, top arm c... 44 0.15
gb|BT004055.1| Arabidopsis thaliana clone RAFL15-21-H23 (R2... 44 0.15
gb|BT005112.1| Arabidopsis thaliana clone U20468 putative p... 44 0.15
dbj|BD248390.1| Gene participating in tolerance against env... 44 0.15
gb|AC022464.4|AC022464 Genomic sequence for Arabidopsis tha... 44 0.15
emb|BX815753.1|CNS0ACU6 Arabidopsis thaliana Full-length cD... 44 0.15
emb|BX816653.1|CNS0ADBU Arabidopsis thaliana Full-length cD... 44 0.15
dbj|D12522.1|ATHAPK1A Arabidopsis thaliana APK1 gene for pr... 44 0.15
ref|NM_100631.3| Arabidopsis thaliana APK1A; kinase AT1G075... 44 0.15
ref|NM_202049.1| Arabidopsis thaliana APK1A; kinase AT1G075... 44 0.15
ref|NC_003070.5| Arabidopsis thaliana chromosome 1, complet... 44 0.15
>dbj|AB074762.1| Arabidopsis thaliana mRNA for putative receptor protein kinase ACR4,
complete cds
Length = 3424
Score = 131 bits (66), Expect = 8e-028
Identities = 288/362 (79%)
Strand = Plus / Minus
Query: 842 cctgctttgatcagaggtactgcccattcaacaatgttcccctcctcgaactgcatgtcg 901
||||||||||||| ||| ||||||||||| || |||||||| || ||| | ||||||||
Sbjct: 2696 cctgctttgatcaaaggaactgcccattctactatgttcccttcttcgtagtgcatgtca 2637
Query: 902 atcgctttcctgccacttagtatctccaggagaacaaccccgaagctgtagacatcagat 961
|| ||||| || || ||||| ||||| || || | || || |||||||||||||| |||
Sbjct: 2636 atggcttttcttccgcttaggatctcgagaagcaggactccaaagctgtagacatcggat 2577
Query: 962 tttgtagtcaagtagtggagacggtagtactcagggtcaaggtagccaagagtccctgct 1021
|| || || | ||||| || || |||||||| || |||||||| || ||||| ||||||
Sbjct: 2576 ttggttgtgagatagtgaagtcgatagtactcgggatcaaggtaaccgagagttcctgct 2517
Query: 1022 ggcagctcagacagtggggtaccgctatctgcaggacccaatatagacagaccaaagtca 1081
|| || || | || || | |||||||| ||||||| | || || |||||||| |||
Sbjct: 2516 ggtagttctgccaaaggagagccgctatcgacaggaccaagtaaggagagaccaaaatca 2457
Query: 1082 gcaacacgggcattgtgatcctcatcaatcaatatgtttgacgacttgatgtcccggtga 1141
|| || || |||||||| || ||||| || | |||||||| || || || |||||||||
Sbjct: 2456 gctactcgagcattgtgttcttcatctataagaatgtttgatgatttaatatcccggtga 2397
Query: 1142 attacaggagggcaagcatagccatgcaagtactcaattcccctagcagcctgtacagca 1201
|| || ||||||||||| || ||||||||||| || ||||| |||||||| || ||||||
Sbjct: 2396 atcacgggagggcaagcgtaaccatgcaagtattcgattcctctagcagcttggacagca 2337
Query: 1202 at 1203
||
Sbjct: 2336 at 2335
Score = 60.0 bits (30), Expect = 3e-006
Identities = 51/58 (87%)
Strand = Plus / Minus
Query: 462 cttcggatgcagatgatttcctcctctgtgatgaggtcacgctaggaaaagttatcca 519
|||| ||||| ||||||||||||||||| ||||| |||||||| || || ||||||||
Sbjct: 3052 cttcagatgccgatgatttcctcctctgcgatgatgtcacgctcgggaatgttatcca 2995
>dbj|BA000014.8| Arabidopsis thaliana, chromosome 3, complete sequence
Length = 23403063
Score = 131 bits (66), Expect = 8e-028
Identities = 288/362 (79%)
Strand = Plus / Plus
Query: 842 cctgctttgatcagaggtactgcccattcaacaatgttcccctcctcgaactgcatgtcg 901
||||||||||||| ||| ||||||||||| || |||||||| || ||| | ||||||||
Sbjct: 21918891 cctgctttgatcaaaggaactgcccattctactatgttcccttcttcgtagtgcatgtca 21918950
Query: 902 atcgctttcctgccacttagtatctccaggagaacaaccccgaagctgtagacatcagat 961
|| ||||| || || ||||| ||||| || || | || || |||||||||||||| |||
Sbjct: 21918951 atggcttttcttccgcttaggatctcgagaagcaggactccaaagctgtagacatcggat 21919010
Query: 962 tttgtagtcaagtagtggagacggtagtactcagggtcaaggtagccaagagtccctgct 1021
|| || || | ||||| || || |||||||| || |||||||| || ||||| ||||||
Sbjct: 21919011 ttggttgtgagatagtgaagtcgatagtactcgggatcaaggtaaccgagagttcctgct 21919070
Query: 1022 ggcagctcagacagtggggtaccgctatctgcaggacccaatatagacagaccaaagtca 1081
|| || || | || || | |||||||| ||||||| | || || |||||||| |||
Sbjct: 21919071 ggtagttctgccaaaggagagccgctatcgacaggaccaagtaaggagagaccaaaatca 21919130
Query: 1082 gcaacacgggcattgtgatcctcatcaatcaatatgtttgacgacttgatgtcccggtga 1141
|| || || |||||||| || ||||| || | |||||||| || || || |||||||||
Sbjct: 21919131 gctactcgagcattgtgttcttcatctataagaatgtttgatgatttaatatcccggtga 21919190
Query: 1142 attacaggagggcaagcatagccatgcaagtactcaattcccctagcagcctgtacagca 1201
|| || ||||||||||| || ||||||||||| || ||||| |||||||| || ||||||
Sbjct: 21919191 atcacgggagggcaagcgtaaccatgcaagtattcgattcctctagcagcttggacagca 21919250
Query: 1202 at 1203
||
Sbjct: 21919251 at 21919252
Score = 60.0 bits (30), Expect = 3e-006
Identities = 51/58 (87%)
Strand = Plus / Plus
Query: 462 cttcggatgcagatgatttcctcctctgtgatgaggtcacgctaggaaaagttatcca 519
|||| ||||| ||||||||||||||||| ||||| |||||||| || || ||||||||
Sbjct: 21918535 cttcagatgccgatgatttcctcctctgcgatgatgtcacgctcgggaatgttatcca 21918592
Score = 46.1 bits (23), Expect = 0.038
Identities = 35/39 (89%)
Strand = Plus / Minus
Query: 1105 atcaatcaatatgtttgacgacttgatgtcccggtgaat 1143
|||||||||||||||||||| ||| || || ||||||||
Sbjct: 8903693 atcaatcaatatgtttgacgccttaatatcacggtgaat 8903655
Score = 46.1 bits (23), Expect = 0.038
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 1109 atcaatatgtttgacgacttgatgtcccggtgaat 1143
|||||||||||||||| |||||| || ||||||||
Sbjct: 8802157 atcaatatgtttgacgccttgatatcacggtgaat 8802191
>emb|AL356014.1|ATF25L23 Arabidopsis thaliana DNA chromosome 3, BAC clone F25L23
Length = 114080
Score = 131 bits (66), Expect = 8e-028
Identities = 288/362 (79%)
Strand = Plus / Plus
Query: 842 cctgctttgatcagaggtactgcccattcaacaatgttcccctcctcgaactgcatgtcg 901
||||||||||||| ||| ||||||||||| || |||||||| || ||| | ||||||||
Sbjct: 87577 cctgctttgatcaaaggaactgcccattctactatgttcccttcttcgtagtgcatgtca 87636
Query: 902 atcgctttcctgccacttagtatctccaggagaacaaccccgaagctgtagacatcagat 961
|| ||||| || || ||||| ||||| || || | || || |||||||||||||| |||
Sbjct: 87637 atggcttttcttccgcttaggatctcgagaagcaggactccaaagctgtagacatcggat 87696
Query: 962 tttgtagtcaagtagtggagacggtagtactcagggtcaaggtagccaagagtccctgct 1021
|| || || | ||||| || || |||||||| || |||||||| || ||||| ||||||
Sbjct: 87697 ttggttgtgagatagtgaagtcgatagtactcgggatcaaggtaaccgagagttcctgct 87756
Query: 1022 ggcagctcagacagtggggtaccgctatctgcaggacccaatatagacagaccaaagtca 1081
|| || || | || || | |||||||| ||||||| | || || |||||||| |||
Sbjct: 87757 ggtagttctgccaaaggagagccgctatcgacaggaccaagtaaggagagaccaaaatca 87816
Query: 1082 gcaacacgggcattgtgatcctcatcaatcaatatgtttgacgacttgatgtcccggtga 1141
|| || || |||||||| || ||||| || | |||||||| || || || |||||||||
Sbjct: 87817 gctactcgagcattgtgttcttcatctataagaatgtttgatgatttaatatcccggtga 87876
Query: 1142 attacaggagggcaagcatagccatgcaagtactcaattcccctagcagcctgtacagca 1201
|| || ||||||||||| || ||||||||||| || ||||| |||||||| || ||||||
Sbjct: 87877 atcacgggagggcaagcgtaaccatgcaagtattcgattcctctagcagcttggacagca 87936
Query: 1202 at 1203
||
Sbjct: 87937 at 87938
Score = 60.0 bits (30), Expect = 3e-006
Identities = 51/58 (87%)
Strand = Plus / Plus
Query: 462 cttcggatgcagatgatttcctcctctgtgatgaggtcacgctaggaaaagttatcca 519
|||| ||||| ||||||||||||||||| ||||| |||||||| || || ||||||||
Sbjct: 87221 cttcagatgccgatgatttcctcctctgcgatgatgtcacgctcgggaatgttatcca 87278
>ref|NM_115804.3| Arabidopsis thaliana ACR4; kinase AT3G59420 (ACR4) mRNA, complete cds
Length = 3395
Score = 131 bits (66), Expect = 8e-028
Identities = 288/362 (79%)
Strand = Plus / Minus
Query: 842 cctgctttgatcagaggtactgcccattcaacaatgttcccctcctcgaactgcatgtcg 901
||||||||||||| ||| ||||||||||| || |||||||| || ||| | ||||||||
Sbjct: 2696 cctgctttgatcaaaggaactgcccattctactatgttcccttcttcgtagtgcatgtca 2637
Query: 902 atcgctttcctgccacttagtatctccaggagaacaaccccgaagctgtagacatcagat 961
|| ||||| || || ||||| ||||| || || | || || |||||||||||||| |||
Sbjct: 2636 atggcttttcttccgcttaggatctcgagaagcaggactccaaagctgtagacatcggat 2577
Query: 962 tttgtagtcaagtagtggagacggtagtactcagggtcaaggtagccaagagtccctgct 1021
|| || || | ||||| || || |||||||| || |||||||| || ||||| ||||||
Sbjct: 2576 ttggttgtgagatagtgaagtcgatagtactcgggatcaaggtaaccgagagttcctgct 2517
Query: 1022 ggcagctcagacagtggggtaccgctatctgcaggacccaatatagacagaccaaagtca 1081
|| || || | || || | |||||||| ||||||| | || || |||||||| |||
Sbjct: 2516 ggtagttctgccaaaggagagccgctatcgacaggaccaagtaaggagagaccaaaatca 2457
Query: 1082 gcaacacgggcattgtgatcctcatcaatcaatatgtttgacgacttgatgtcccggtga 1141
|| || || |||||||| || ||||| || | |||||||| || || || |||||||||
Sbjct: 2456 gctactcgagcattgtgttcttcatctataagaatgtttgatgatttaatatcccggtga 2397
Query: 1142 attacaggagggcaagcatagccatgcaagtactcaattcccctagcagcctgtacagca 1201
|| || ||||||||||| || ||||||||||| || ||||| |||||||| || ||||||
Sbjct: 2396 atcacgggagggcaagcgtaaccatgcaagtattcgattcctctagcagcttggacagca 2337
Query: 1202 at 1203
||
Sbjct: 2336 at 2335
Score = 60.0 bits (30), Expect = 3e-006
Identities = 51/58 (87%)
Strand = Plus / Minus
Query: 462 cttcggatgcagatgatttcctcctctgtgatgaggtcacgctaggaaaagttatcca 519
|||| ||||| ||||||||||||||||| ||||| |||||||| || || ||||||||
Sbjct: 3052 cttcagatgccgatgatttcctcctctgcgatgatgtcacgctcgggaatgttatcca 2995
>ref|NC_003074.4| Arabidopsis thaliana chromosome 3, complete sequence
Length = 23470805
Score = 131 bits (66), Expect = 8e-028
Identities = 288/362 (79%)
Strand = Plus / Plus
Query: 842 cctgctttgatcagaggtactgcccattcaacaatgttcccctcctcgaactgcatgtcg 901
||||||||||||| ||| ||||||||||| || |||||||| || ||| | ||||||||
Sbjct: 21971323 cctgctttgatcaaaggaactgcccattctactatgttcccttcttcgtagtgcatgtca 21971382
Query: 902 atcgctttcctgccacttagtatctccaggagaacaaccccgaagctgtagacatcagat 961
|| ||||| || || ||||| ||||| || || | || || |||||||||||||| |||
Sbjct: 21971383 atggcttttcttccgcttaggatctcgagaagcaggactccaaagctgtagacatcggat 21971442
Query: 962 tttgtagtcaagtagtggagacggtagtactcagggtcaaggtagccaagagtccctgct 1021
|| || || | ||||| || || |||||||| || |||||||| || ||||| ||||||
Sbjct: 21971443 ttggttgtgagatagtgaagtcgatagtactcgggatcaaggtaaccgagagttcctgct 21971502
Query: 1022 ggcagctcagacagtggggtaccgctatctgcaggacccaatatagacagaccaaagtca 1081
|| || || | || || | |||||||| ||||||| | || || |||||||| |||
Sbjct: 21971503 ggtagttctgccaaaggagagccgctatcgacaggaccaagtaaggagagaccaaaatca 21971562
Query: 1082 gcaacacgggcattgtgatcctcatcaatcaatatgtttgacgacttgatgtcccggtga 1141
|| || || |||||||| || ||||| || | |||||||| || || || |||||||||
Sbjct: 21971563 gctactcgagcattgtgttcttcatctataagaatgtttgatgatttaatatcccggtga 21971622
Query: 1142 attacaggagggcaagcatagccatgcaagtactcaattcccctagcagcctgtacagca 1201
|| || ||||||||||| || ||||||||||| || ||||| |||||||| || ||||||
Sbjct: 21971623 atcacgggagggcaagcgtaaccatgcaagtattcgattcctctagcagcttggacagca 21971682
Query: 1202 at 1203
||
Sbjct: 21971683 at 21971684
Score = 60.0 bits (30), Expect = 3e-006
Identities = 51/58 (87%)
Strand = Plus / Plus
Query: 462 cttcggatgcagatgatttcctcctctgtgatgaggtcacgctaggaaaagttatcca 519
|||| ||||| ||||||||||||||||| ||||| |||||||| || || ||||||||
Sbjct: 21970967 cttcagatgccgatgatttcctcctctgcgatgatgtcacgctcgggaatgttatcca 21971024
Score = 46.1 bits (23), Expect = 0.038
Identities = 35/39 (89%)
Strand = Plus / Minus
Query: 1105 atcaatcaatatgtttgacgacttgatgtcccggtgaat 1143
|||||||||||||||||||| ||| || || ||||||||
Sbjct: 8962012 atcaatcaatatgtttgacgccttaatatcacggtgaat 8961974
Score = 46.1 bits (23), Expect = 0.038
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 1109 atcaatatgtttgacgacttgatgtcccggtgaat 1143
|||||||||||||||| |||||| || ||||||||
Sbjct: 8859860 atcaatatgtttgacgccttgatatcacggtgaat 8859894
>emb|AL082002.1|CNS00NJO Arabidopsis thaliana genome survey sequence SP6 end of BAC F4B2 of
IGF library from strain Columbia of Arabidopsis
thaliana, genomic survey sequence
Length = 417
Score = 60.0 bits (30), Expect = 3e-006
Identities = 51/58 (87%)
Strand = Plus / Minus
Query: 462 cttcggatgcagatgatttcctcctctgtgatgaggtcacgctaggaaaagttatcca 519
|||| ||||| ||||||||||||||||| ||||| |||||||| || || ||||||||
Sbjct: 70 cttcagatgccgatgatttcctcctctgcgatgatgtcacgctcgggaatgttatcca 13
>gb|AV561141.1|AV561141 AV561141 Arabidopsis thaliana green siliques Columbia Arabidopsis
thaliana cDNA clone SQ146e05F 3', mRNA sequence
Length = 298
Score = 60.0 bits (30), Expect = 3e-006
Identities = 51/58 (87%)
Strand = Plus / Plus
Query: 462 cttcggatgcagatgatttcctcctctgtgatgaggtcacgctaggaaaagttatcca 519
|||| ||||| ||||||||||||||||| ||||| |||||||| || || ||||||||
Sbjct: 232 cttcagatgccgatgatttcctcctctgcgatgatgtcacgctcgggaatgttatcca 289
>gb|AV562142.1|AV562142 AV562142 Arabidopsis thaliana green siliques Columbia Arabidopsis
thaliana cDNA clone SQ164f02F 3', mRNA sequence
Length = 370
Score = 60.0 bits (30), Expect = 3e-006
Identities = 51/58 (87%)
Strand = Plus / Plus
Query: 462 cttcggatgcagatgatttcctcctctgtgatgaggtcacgctaggaaaagttatcca 519
|||| ||||| ||||||||||||||||| ||||| |||||||| || || ||||||||
Sbjct: 294 cttcagatgccgatgatttcctcctctgcgatgatgtcacgctcgggaatgttatcca 351
>gb|AV565071.1|AV565071 AV565071 Arabidopsis thaliana green siliques Columbia Arabidopsis
thaliana cDNA clone SQ216e03F 3', mRNA sequence
Length = 505
Score = 60.0 bits (30), Expect = 3e-006
Identities = 51/58 (87%)
Strand = Plus / Plus
Query: 462 cttcggatgcagatgatttcctcctctgtgatgaggtcacgctaggaaaagttatcca 519
|||| ||||| ||||||||||||||||| ||||| |||||||| || || ||||||||
Sbjct: 284 cttcagatgccgatgatttcctcctctgcgatgatgtcacgctcgggaatgttatcca 341
>emb|BX660697.1| Arabidopsis thaliana T-DNA flanking sequence GK-658F05-021134,
genomic survey sequence
Length = 144
Score = 52.0 bits (26), Expect = 6e-004
Identities = 41/46 (89%)
Strand = Plus / Plus
Query: 474 atgatttcctcctctgtgatgaggtcacgctaggaaaagttatcca 519
|||||||||||||||| ||||| |||||||| || || ||||||||
Sbjct: 5 atgatttcctcctctgcgatgatgtcacgctcgggaatgttatcca 50
>gb|AY085517.1| Arabidopsis thaliana clone 15535 mRNA, complete sequence
Length = 2004
Score = 48.1 bits (24), Expect = 0.010
Identities = 30/32 (93%)
Strand = Plus / Minus
Query: 926 tccaggagaacaaccccgaagctgtagacatc 957
|||| ||| |||||||||||||||||||||||
Sbjct: 1284 tccaagagtacaaccccgaagctgtagacatc 1253
>gb|AY087491.1| Arabidopsis thaliana clone 36000 mRNA, complete sequence
Length = 1750
Score = 48.1 bits (24), Expect = 0.010
Identities = 27/28 (96%)
Strand = Plus / Minus
Query: 931 gagaacaaccccgaagctgtagacatca 958
||||||||| ||||||||||||||||||
Sbjct: 1174 gagaacaacaccgaagctgtagacatca 1147
>gb|AC051626.5|AC051626 Genomic Sequence For Arabidopsis thaliana Clone F20L16 From Chromosome
V, complete sequence
Length = 96050
Score = 48.1 bits (24), Expect = 0.010
Identities = 30/32 (93%)
Strand = Plus / Minus
Query: 926 tccaggagaacaaccccgaagctgtagacatc 957
|||| ||| |||||||||||||||||||||||
Sbjct: 87810 tccaagagtacaaccccgaagctgtagacatc 87779
>gb|AC069328.1|AC069328 Genomic Sequence For Arabidopsis thaliana Clone T28N17 From Chromosome
V, complete sequence
Length = 75593
Score = 48.1 bits (24), Expect = 0.010
Identities = 30/32 (93%)
Strand = Plus / Plus
Query: 926 tccaggagaacaaccccgaagctgtagacatc 957
|||| ||| |||||||||||||||||||||||
Sbjct: 62606 tccaagagtacaaccccgaagctgtagacatc 62637
>emb|BX830642.1|CNS09ZZZ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTFB9ZD06 of Flowers and buds of strain col-0 of
Arabidopsis thaliana (thale cress)
Length = 1939
Score = 48.1 bits (24), Expect = 0.010
Identities = 30/32 (93%)
Strand = Plus / Minus
Query: 926 tccaggagaacaaccccgaagctgtagacatc 957
|||| ||| |||||||||||||||||||||||
Sbjct: 1261 tccaagagtacaaccccgaagctgtagacatc 1230
>dbj|BA000015.5| Arabidopsis thaliana DNA, chromosome 5, complete sequence
Length = 23810767
Score = 48.1 bits (24), Expect = 0.010
Identities = 30/32 (93%)
Strand = Plus / Plus
Query: 926 tccaggagaacaaccccgaagctgtagacatc 957
|||| ||| |||||||||||||||||||||||
Sbjct: 5911297 tccaagagtacaaccccgaagctgtagacatc 5911328
Score = 48.1 bits (24), Expect = 0.010
Identities = 30/32 (93%)
Strand = Plus / Minus
Query: 926 tccaggagaacaaccccgaagctgtagacatc 957
|||| ||| |||||||||||||||||||||||
Sbjct: 5861679 tccaagagtacaaccccgaagctgtagacatc 5861648
Score = 46.1 bits (23), Expect = 0.038
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 923 atctccaggagaacaaccccgaagctgtagacatc 957
|||||||| || ||||||||||||||||| |||||
Sbjct: 405732 atctccagaagcacaaccccgaagctgtacacatc 405766
>ref|NM_121855.2| Arabidopsis thaliana ATP binding / kinase/ protein kinase/ protein
serine/threonine kinase/ protein-tyrosine kinase
AT5G18500 transcript variant AT5G18500.1 mRNA, complete
cds
Length = 2007
Score = 48.1 bits (24), Expect = 0.010
Identities = 30/32 (93%)
Strand = Plus / Minus
Query: 926 tccaggagaacaaccccgaagctgtagacatc 957
|||| ||| |||||||||||||||||||||||
Sbjct: 1284 tccaagagtacaaccccgaagctgtagacatc 1253
>ref|NM_001036821.1| Arabidopsis thaliana ATP binding / kinase/ protein kinase/ protein
serine/threonine kinase/ protein-tyrosine kinase
AT5G18500 transcript variant AT5G18500.2 mRNA, complete
cds
Length = 1971
Score = 48.1 bits (24), Expect = 0.010
Identities = 30/32 (93%)
Strand = Plus / Minus
Query: 926 tccaggagaacaaccccgaagctgtagacatc 957
|||| ||| |||||||||||||||||||||||
Sbjct: 1248 tccaagagtacaaccccgaagctgtagacatc 1217
>ref|NC_003076.4| Arabidopsis thaliana chromosome 5, complete sequence
Length = 26992728
Score = 48.1 bits (24), Expect = 0.010
Identities = 30/32 (93%)
Strand = Plus / Minus
Query: 926 tccaggagaacaaccccgaagctgtagacatc 957
|||| ||| |||||||||||||||||||||||
Sbjct: 6140706 tccaagagtacaaccccgaagctgtagacatc 6140675
Score = 46.1 bits (23), Expect = 0.038
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 923 atctccaggagaacaaccccgaagctgtagacatc 957
|||||||| || ||||||||||||||||| |||||
Sbjct: 406175 atctccagaagcacaaccccgaagctgtacacatc 406209
>gb|AF370509.1|AF370509 Arabidopsis thaliana protein kinase-like protein (MOB24.13) mRNA,
complete cds
Length = 2257
Score = 46.1 bits (23), Expect = 0.038
Identities = 35/39 (89%)
Strand = Plus / Minus
Query: 1105 atcaatcaatatgtttgacgacttgatgtcccggtgaat 1143
|||||||||||||||||||| ||| || || ||||||||
Sbjct: 1345 atcaatcaatatgtttgacgccttaatatcacggtgaat 1307
>gb|AY056788.1| Arabidopsis thaliana AT3g24550/MOB24_8 mRNA, complete cds
Length = 2116
Score = 46.1 bits (23), Expect = 0.038
Identities = 35/39 (89%)
Strand = Plus / Minus
Query: 1105 atcaatcaatatgtttgacgacttgatgtcccggtgaat 1143
|||||||||||||||||||| ||| || || ||||||||
Sbjct: 1275 atcaatcaatatgtttgacgccttaatatcacggtgaat 1237
>gb|AY059901.1| Arabidopsis thaliana protein kinase-like protein (MOB24.13) mRNA,
complete cds
Length = 2188
Score = 46.1 bits (23), Expect = 0.038
Identities = 35/39 (89%)
Strand = Plus / Minus
Query: 1105 atcaatcaatatgtttgacgacttgatgtcccggtgaat 1143
|||||||||||||||||||| ||| || || ||||||||
Sbjct: 1270 atcaatcaatatgtttgacgccttaatatcacggtgaat 1232
>gb|AY093065.1| Arabidopsis thaliana unknown protein (At3g24550) mRNA, complete cds
Length = 2190
Score = 46.1 bits (23), Expect = 0.038
Identities = 35/39 (89%)
Strand = Plus / Minus
Query: 1105 atcaatcaatatgtttgacgacttgatgtcccggtgaat 1143
|||||||||||||||||||| ||| || || ||||||||
Sbjct: 1268 atcaatcaatatgtttgacgccttaatatcacggtgaat 1230
>gb|AY128792.1| Arabidopsis thaliana protein kinase-like protein mRNA, complete cds
Length = 2098
Score = 46.1 bits (23), Expect = 0.038
Identities = 35/39 (89%)
Strand = Plus / Minus
Query: 1105 atcaatcaatatgtttgacgacttgatgtcccggtgaat 1143
|||||||||||||||||||| ||| || || ||||||||
Sbjct: 1239 atcaatcaatatgtttgacgccttaatatcacggtgaat 1201
>gb|AY089024.1| Arabidopsis thaliana clone 17909 mRNA, complete sequence
Length = 2324
Score = 46.1 bits (23), Expect = 0.038
Identities = 35/39 (89%)
Strand = Plus / Minus
Query: 1105 atcaatcaatatgtttgacgacttgatgtcccggtgaat 1143
|||||||||||||||||||| ||| || || ||||||||
Sbjct: 1340 atcaatcaatatgtttgacgccttaatatcacggtgaat 1302
>gb|BT008400.1| Arabidopsis thaliana At3g24550 gene, complete cds
Length = 1959
Score = 46.1 bits (23), Expect = 0.038
Identities = 35/39 (89%)
Strand = Plus / Minus
Query: 1105 atcaatcaatatgtttgacgacttgatgtcccggtgaat 1143
|||||||||||||||||||| ||| || || ||||||||
Sbjct: 1239 atcaatcaatatgtttgacgccttaatatcacggtgaat 1201
>gb|BT008409.1| Arabidopsis thaliana At3g24600 gene, complete cds
Length = 1959
Score = 46.1 bits (23), Expect = 0.038
Identities = 35/39 (89%)
Strand = Plus / Minus
Query: 1105 atcaatcaatatgtttgacgacttgatgtcccggtgaat 1143
|||||||||||||||||||| ||| || || ||||||||
Sbjct: 1239 atcaatcaatatgtttgacgccttaatatcacggtgaat 1201
>emb|AX825738.1| Sequence 36 from Patent WO03072763
Length = 1959
Score = 46.1 bits (23), Expect = 0.038
Identities = 35/39 (89%)
Strand = Plus / Minus
Query: 1105 atcaatcaatatgtttgacgacttgatgtcccggtgaat 1143
|||||||||||||||||||| ||| || || ||||||||
Sbjct: 1239 atcaatcaatatgtttgacgccttaatatcacggtgaat 1201
>emb|BX823746.1|CNS0A4QX Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTLS71ZE12 of Adult vegetative tissue of strain col-0
of Arabidopsis thaliana (thale cress)
Length = 2106
Score = 46.1 bits (23), Expect = 0.038
Identities = 35/39 (89%)
Strand = Plus / Minus
Query: 1105 atcaatcaatatgtttgacgacttgatgtcccggtgaat 1143
|||||||||||||||||||| ||| || || ||||||||
Sbjct: 1314 atcaatcaatatgtttgacgccttaatatcacggtgaat 1276
>dbj|AB020746.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MOB24
Length = 79706
Score = 46.1 bits (23), Expect = 0.038
Identities = 35/39 (89%)
Strand = Plus / Minus
Query: 1105 atcaatcaatatgtttgacgacttgatgtcccggtgaat 1143
|||||||||||||||||||| ||| || || ||||||||
Sbjct: 53381 atcaatcaatatgtttgacgccttaatatcacggtgaat 53343
>dbj|AP000382.1| Arabidopsis thaliana genomic DNA, chromosome 3, TAC clone:K7M2
Length = 80393
Score = 46.1 bits (23), Expect = 0.038
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 1109 atcaatatgtttgacgacttgatgtcccggtgaat 1143
|||||||||||||||| |||||| || ||||||||
Sbjct: 67093 atcaatatgtttgacgccttgatatcacggtgaat 67127
>emb|AL162508.1|ATT7H20 Arabidopsis thaliana DNA chromosome 5, BAC clone T7H20 (ESSA project)
Length = 87581
Score = 46.1 bits (23), Expect = 0.038
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 923 atctccaggagaacaaccccgaagctgtagacatc 957
|||||||| || ||||||||||||||||| |||||
Sbjct: 37191 atctccagaagcacaaccccgaagctgtacacatc 37225
>ref|NM_120285.1| Arabidopsis thaliana kinase AT5G02070 mRNA, complete cds
Length = 1974
Score = 46.1 bits (23), Expect = 0.038
Identities = 32/35 (91%)
Strand = Plus / Minus
Query: 923 atctccaggagaacaaccccgaagctgtagacatc 957
|||||||| || ||||||||||||||||| |||||
Sbjct: 1691 atctccagaagcacaaccccgaagctgtacacatc 1657
>ref|NM_113366.2| Arabidopsis thaliana ATP binding / protein kinase/ protein
serine/threonine kinase/ protein-tyrosine kinase
AT3G24550 mRNA, complete cds
Length = 2377
Score = 46.1 bits (23), Expect = 0.038
Identities = 35/39 (89%)
Strand = Plus / Minus
Query: 1105 atcaatcaatatgtttgacgacttgatgtcccggtgaat 1143
|||||||||||||||||||| ||| || || ||||||||
Sbjct: 1392 atcaatcaatatgtttgacgccttaatatcacggtgaat 1354
>gb|AE005172.1| Arabidopsis thaliana chromosome 1, top arm complete sequence
Length = 14221815
Score = 44.1 bits (22), Expect = 0.15
Identities = 31/34 (91%)
Strand = Plus / Plus
Query: 925 ctccaggagaacaaccccgaagctgtagacatca 958
|||||| || |||||||||||||| |||||||||
Sbjct: 2331630 ctccagaaggacaaccccgaagctatagacatca 2331663
>gb|BT004055.1| Arabidopsis thaliana clone RAFL15-21-H23 (R20468) putative protein
kinase APK1A (At1g07570) mRNA, complete cds
Length = 1492
Score = 44.1 bits (22), Expect = 0.15
Identities = 31/34 (91%)
Strand = Plus / Minus
Query: 925 ctccaggagaacaaccccgaagctgtagacatca 958
|||||| || |||||||||||||| |||||||||
Sbjct: 896 ctccagaaggacaaccccgaagctatagacatca 863
>gb|BT005112.1| Arabidopsis thaliana clone U20468 putative protein kinase APK1A
(At1g07570) mRNA, complete cds
Length = 1264
Score = 44.1 bits (22), Expect = 0.15
Identities = 31/34 (91%)
Strand = Plus / Minus
Query: 925 ctccaggagaacaaccccgaagctgtagacatca 958
|||||| || |||||||||||||| |||||||||
Sbjct: 816 ctccagaaggacaaccccgaagctatagacatca 783
>dbj|BD248390.1| Gene participating in tolerance against environmental stress
Length = 1257
Score = 44.1 bits (22), Expect = 0.15
Identities = 31/34 (91%)
Strand = Plus / Minus
Query: 925 ctccaggagaacaaccccgaagctgtagacatca 958
|||||| || |||||||||||||| |||||||||
Sbjct: 828 ctccagaaggacaaccccgaagctatagacatca 795
>gb|AC022464.4|AC022464 Genomic sequence for Arabidopsis thaliana BAC F22G5 from chromosome I,
complete sequence
Length = 104830
Score = 44.1 bits (22), Expect = 0.15
Identities = 31/34 (91%)
Strand = Plus / Minus
Query: 925 ctccaggagaacaaccccgaagctgtagacatca 958
|||||| || |||||||||||||| |||||||||
Sbjct: 12275 ctccagaaggacaaccccgaagctatagacatca 12242
>emb|BX815753.1|CNS0ACU6 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTLS90ZC03 of Adult vegetative tissue of strain col-0
of Arabidopsis thaliana (thale cress)
Length = 1617
Score = 44.1 bits (22), Expect = 0.15
Identities = 31/34 (91%)
Strand = Plus / Minus
Query: 925 ctccaggagaacaaccccgaagctgtagacatca 958
|||||| || |||||||||||||| |||||||||
Sbjct: 1001 ctccagaaggacaaccccgaagctatagacatca 968
>emb|BX816653.1|CNS0ADBU Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTPGH60ZE10 of Hormone Treated Callus of strain col-0
of Arabidopsis thaliana (thale cress)
Length = 1586
Score = 44.1 bits (22), Expect = 0.15
Identities = 31/34 (91%)
Strand = Plus / Minus
Query: 925 ctccaggagaacaaccccgaagctgtagacatca 958
|||||| || |||||||||||||| |||||||||
Sbjct: 1069 ctccagaaggacaaccccgaagctatagacatca 1036
>dbj|D12522.1|ATHAPK1A Arabidopsis thaliana APK1 gene for protein
tyrosine-serine-threonine kinase
Length = 1415
Score = 44.1 bits (22), Expect = 0.15
Identities = 31/34 (91%)
Strand = Plus / Minus
Query: 925 ctccaggagaacaaccccgaagctgtagacatca 958
|||||| || |||||||||||||| |||||||||
Sbjct: 893 ctccagaaggacaaccccgaagctatagacatca 860
>ref|NM_100631.3| Arabidopsis thaliana APK1A; kinase AT1G07570 (APK1A) transcript
variant AT1G07570.1 mRNA, complete cds
Length = 1617
Score = 44.1 bits (22), Expect = 0.15
Identities = 31/34 (91%)
Strand = Plus / Minus
Query: 925 ctccaggagaacaaccccgaagctgtagacatca 958
|||||| || |||||||||||||| |||||||||
Sbjct: 1001 ctccagaaggacaaccccgaagctatagacatca 968
>ref|NM_202049.1| Arabidopsis thaliana APK1A; kinase AT1G07570 (APK1A) transcript
variant AT1G07570.2 mRNA, complete cds
Length = 1631
Score = 44.1 bits (22), Expect = 0.15
Identities = 31/34 (91%)
Strand = Plus / Minus
Query: 925 ctccaggagaacaaccccgaagctgtagacatca 958
|||||| || |||||||||||||| |||||||||
Sbjct: 1071 ctccagaaggacaaccccgaagctatagacatca 1038
>ref|NC_003070.5| Arabidopsis thaliana chromosome 1, complete sequence
Length = 30432563
Score = 44.1 bits (22), Expect = 0.15
Identities = 31/34 (91%)
Strand = Plus / Plus
Query: 925 ctccaggagaacaaccccgaagctgtagacatca 958
|||||| || |||||||||||||| |||||||||
Sbjct: 2331783 ctccagaaggacaaccccgaagctatagacatca 2331816
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,149,383
Number of Sequences: 1013581
Number of extensions: 1149383
Number of successful extensions: 82729
Number of sequences better than 0.5: 45
Number of HSP's better than 0.5 without gapping: 49
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 78876
Number of HSP's gapped (non-prelim): 3848
length of query: 3189
length of database: 908,940,872
effective HSP length: 21
effective length of query: 3168
effective length of database: 887,655,671
effective search space: 2812093165728
effective search space used: 2812093165728
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 22 (44.1 bits)