BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2643622.2.1
(1067 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BZ354240.1|BZ354240 SALK_123405.45.35.x Arabidopsis thal... 42 0.19
gb|AI994017.1|AI994017 701496312 A. thaliana, Ohio State cl... 42 0.19
gb|CB261152.1|CB261152 28-E9518-012-003-G16-T7R MPIZ-ADIS-0... 42 0.19
gb|CB262251.1|CB262251 68-E8864-008-010-H18-pBl2 MPIZ-ADIS-... 42 0.19
gb|AV547509.1|AV547509 AV547509 Arabidopsis thaliana roots ... 42 0.19
gb|BP814651.1|BP814651 BP814651 RAFL19 Arabidopsis thaliana... 42 0.19
gb|U18929.1|ATU18929 Arabidopsis thaliana cytochrome p450 d... 42 0.19
gb|U69134.1|ATU69134 Arabidopsis thaliana cytochrome P450 m... 42 0.19
gb|AF428469.1|AF428469 Arabidopsis thaliana AT4g13770/F18A5... 42 0.19
gb|AY057637.1| Arabidopsis thaliana AT4g13770/F18A5_160 mRN... 42 0.19
gb|AY075697.1| Arabidopsis thaliana AT4g13770/F18A5_160 mRN... 42 0.19
gb|AY091779.1| Arabidopsis thaliana AT5g65110/MQN23_4 mRNA ... 42 0.19
gb|AY102146.1| Arabidopsis thaliana AT4g13770/F18A5_160 mRN... 42 0.19
emb|AX506804.1| Sequence 1499 from Patent WO0216655 42 0.19
emb|AX651745.1| Sequence 586 from Patent WO03000898 42 0.19
emb|BX827552.1|CNS0A3O7 Arabidopsis thaliana Full-length cD... 42 0.19
emb|AJ270060.1| Arabidopsis thaliana DNA chromosome 4, long... 42 0.19
dbj|D78599.1| Arabidopsis thaliana mRNA for cytochrome P450... 42 0.19
emb|CR384235.1| Arabidopsis thaliana transposon insertion S... 42 0.19
emb|CQ804976.1| Sequence 1387 from Patent WO2004035798 42 0.19
emb|AL035528.2|ATF18A5 Arabidopsis thaliana DNA chromosome ... 42 0.19
emb|AL161537.2|ATCHRIV37 Arabidopsis thaliana DNA chromosom... 42 0.19
dbj|AK220835.1| Arabidopsis thaliana mRNA for cytochrome P4... 42 0.19
ref|NM_117451.2| Arabidopsis thaliana CYP83A1 (CYTOCHROME P... 42 0.19
ref|NC_003075.3| Arabidopsis thaliana chromosome 4, complet... 42 0.19
>gb|BZ354240.1|BZ354240 SALK_123405.45.35.x Arabidopsis thaliana TDNA insertion lines
Arabidopsis thaliana genomic clone SALK_123405.45.35.x,
DNA sequence
Length = 464
Score = 42.1 bits (21), Expect = 0.19
Identities = 24/25 (96%)
Strand = Plus / Minus
Query: 538 ggggatgtcgtagccggcgatcttg 562
|||||||||||| ||||||||||||
Sbjct: 349 ggggatgtcgtaaccggcgatcttg 325
>gb|AI994017.1|AI994017 701496312 A. thaliana, Ohio State clone set Arabidopsis thaliana
cDNA clone 701496312, mRNA sequence
Length = 511
Score = 42.1 bits (21), Expect = 0.19
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 538 ggggatgtcgtagccggcgatcttg 562
|||||||||||| ||||||||||||
Sbjct: 444 ggggatgtcgtaaccggcgatcttg 468
>gb|CB261152.1|CB261152 28-E9518-012-003-G16-T7R MPIZ-ADIS-012 Arabidopsis thaliana cDNA
clone MPIZp769G163Q 5-PRIME, mRNA sequence
Length = 634
Score = 42.1 bits (21), Expect = 0.19
Identities = 24/25 (96%)
Strand = Plus / Minus
Query: 538 ggggatgtcgtagccggcgatcttg 562
|||||||||||| ||||||||||||
Sbjct: 449 ggggatgtcgtaaccggcgatcttg 425
>gb|CB262251.1|CB262251 68-E8864-008-010-H18-pBl2 MPIZ-ADIS-008 Arabidopsis thaliana cDNA
clone MPIZp767H1810Q 5-PRIME, mRNA sequence
Length = 635
Score = 42.1 bits (21), Expect = 0.19
Identities = 24/25 (96%)
Strand = Plus / Minus
Query: 538 ggggatgtcgtagccggcgatcttg 562
|||||||||||| ||||||||||||
Sbjct: 243 ggggatgtcgtaaccggcgatcttg 219
>gb|AV547509.1|AV547509 AV547509 Arabidopsis thaliana roots Columbia Arabidopsis thaliana
cDNA clone RZL33f01F 3', mRNA sequence
Length = 590
Score = 42.1 bits (21), Expect = 0.19
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 538 ggggatgtcgtagccggcgatcttg 562
|||||||||||| ||||||||||||
Sbjct: 546 ggggatgtcgtaaccggcgatcttg 570
>gb|BP814651.1|BP814651 BP814651 RAFL19 Arabidopsis thaliana cDNA clone RAFL22-36-G17 5',
mRNA sequence
Length = 388
Score = 42.1 bits (21), Expect = 0.19
Identities = 24/25 (96%)
Strand = Plus / Minus
Query: 538 ggggatgtcgtagccggcgatcttg 562
|||||||||||| ||||||||||||
Sbjct: 184 ggggatgtcgtaaccggcgatcttg 160
>gb|U18929.1|ATU18929 Arabidopsis thaliana cytochrome p450 dependent monooxygenase mRNA,
complete cds
Length = 1551
Score = 42.1 bits (21), Expect = 0.19
Identities = 24/25 (96%)
Strand = Plus / Minus
Query: 538 ggggatgtcgtagccggcgatcttg 562
|||||||||||| ||||||||||||
Sbjct: 1168 ggggatgtcgtaaccggcgatcttg 1144
>gb|U69134.1|ATU69134 Arabidopsis thaliana cytochrome P450 monooxygenase (CYP83) gene,
complete cds
Length = 3319
Score = 42.1 bits (21), Expect = 0.19
Identities = 24/25 (96%)
Strand = Plus / Minus
Query: 538 ggggatgtcgtagccggcgatcttg 562
|||||||||||| ||||||||||||
Sbjct: 2743 ggggatgtcgtaaccggcgatcttg 2719
>gb|AF428469.1|AF428469 Arabidopsis thaliana AT4g13770/F18A5_160 mRNA, complete cds
Length = 1681
Score = 42.1 bits (21), Expect = 0.19
Identities = 24/25 (96%)
Strand = Plus / Minus
Query: 538 ggggatgtcgtagccggcgatcttg 562
|||||||||||| ||||||||||||
Sbjct: 1182 ggggatgtcgtaaccggcgatcttg 1158
>gb|AY057637.1| Arabidopsis thaliana AT4g13770/F18A5_160 mRNA, complete cds
Length = 1710
Score = 42.1 bits (21), Expect = 0.19
Identities = 24/25 (96%)
Strand = Plus / Minus
Query: 538 ggggatgtcgtagccggcgatcttg 562
|||||||||||| ||||||||||||
Sbjct: 1274 ggggatgtcgtaaccggcgatcttg 1250
>gb|AY075697.1| Arabidopsis thaliana AT4g13770/F18A5_160 mRNA, complete cds
Length = 1686
Score = 42.1 bits (21), Expect = 0.19
Identities = 24/25 (96%)
Strand = Plus / Minus
Query: 538 ggggatgtcgtagccggcgatcttg 562
|||||||||||| ||||||||||||
Sbjct: 1188 ggggatgtcgtaaccggcgatcttg 1164
>gb|AY091779.1| Arabidopsis thaliana AT5g65110/MQN23_4 mRNA sequence
Length = 3816
Score = 42.1 bits (21), Expect = 0.19
Identities = 24/25 (96%)
Strand = Plus / Minus
Query: 538 ggggatgtcgtagccggcgatcttg 562
|||||||||||| ||||||||||||
Sbjct: 1185 ggggatgtcgtaaccggcgatcttg 1161
>gb|AY102146.1| Arabidopsis thaliana AT4g13770/F18A5_160 mRNA, complete cds
Length = 1509
Score = 42.1 bits (21), Expect = 0.19
Identities = 24/25 (96%)
Strand = Plus / Minus
Query: 538 ggggatgtcgtagccggcgatcttg 562
|||||||||||| ||||||||||||
Sbjct: 1161 ggggatgtcgtaaccggcgatcttg 1137
>emb|AX506804.1| Sequence 1499 from Patent WO0216655
Length = 1509
Score = 42.1 bits (21), Expect = 0.19
Identities = 24/25 (96%)
Strand = Plus / Minus
Query: 538 ggggatgtcgtagccggcgatcttg 562
|||||||||||| ||||||||||||
Sbjct: 1161 ggggatgtcgtaaccggcgatcttg 1137
>emb|AX651745.1| Sequence 586 from Patent WO03000898
Length = 1509
Score = 42.1 bits (21), Expect = 0.19
Identities = 24/25 (96%)
Strand = Plus / Minus
Query: 538 ggggatgtcgtagccggcgatcttg 562
|||||||||||| ||||||||||||
Sbjct: 1161 ggggatgtcgtaaccggcgatcttg 1137
>emb|BX827552.1|CNS0A3O7 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTLS72ZE08 of Adult vegetative tissue of strain col-0
of Arabidopsis thaliana (thale cress)
Length = 1629
Score = 42.1 bits (21), Expect = 0.19
Identities = 24/25 (96%)
Strand = Plus / Minus
Query: 538 ggggatgtcgtagccggcgatcttg 562
|||||||||||| ||||||||||||
Sbjct: 1166 ggggatgtcgtaaccggcgatcttg 1142
>emb|AJ270060.1| Arabidopsis thaliana DNA chromosome 4, long arm
Length = 14497843
Score = 42.1 bits (21), Expect = 0.19
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 538 ggggatgtcgtagccggcgatcttg 562
|||||||||||| ||||||||||||
Sbjct: 3903769 ggggatgtcgtaaccggcgatcttg 3903793
>dbj|D78599.1| Arabidopsis thaliana mRNA for cytochrome P450 monooxygenase, complete
cds, clone P450-3
Length = 1650
Score = 42.1 bits (21), Expect = 0.19
Identities = 24/25 (96%)
Strand = Plus / Minus
Query: 538 ggggatgtcgtagccggcgatcttg 562
|||||||||||| ||||||||||||
Sbjct: 1183 ggggatgtcgtaaccggcgatcttg 1159
>emb|CR384235.1| Arabidopsis thaliana transposon insertion STS GT_5.15667, sequence
tagged site
Length = 376
Score = 42.1 bits (21), Expect = 0.19
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 538 ggggatgtcgtagccggcgatcttg 562
|||||||||||| ||||||||||||
Sbjct: 22 ggggatgtcgtaaccggcgatcttg 46
>emb|CQ804976.1| Sequence 1387 from Patent WO2004035798
Length = 1509
Score = 42.1 bits (21), Expect = 0.19
Identities = 24/25 (96%)
Strand = Plus / Minus
Query: 538 ggggatgtcgtagccggcgatcttg 562
|||||||||||| ||||||||||||
Sbjct: 1161 ggggatgtcgtaaccggcgatcttg 1137
>emb|AL035528.2|ATF18A5 Arabidopsis thaliana DNA chromosome 4, BAC clone F18A5 (ESSA project)
Length = 118718
Score = 42.1 bits (21), Expect = 0.19
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 538 ggggatgtcgtagccggcgatcttg 562
|||||||||||| ||||||||||||
Sbjct: 62046 ggggatgtcgtaaccggcgatcttg 62070
>emb|AL161537.2|ATCHRIV37 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 37
Length = 199667
Score = 42.1 bits (21), Expect = 0.19
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 538 ggggatgtcgtagccggcgatcttg 562
|||||||||||| ||||||||||||
Sbjct: 83138 ggggatgtcgtaaccggcgatcttg 83162
>dbj|AK220835.1| Arabidopsis thaliana mRNA for cytochrome P450 monooxygenase,
complete cds, clone: RAFL22-36-G17
Length = 654
Score = 42.1 bits (21), Expect = 0.19
Identities = 24/25 (96%)
Strand = Plus / Minus
Query: 538 ggggatgtcgtagccggcgatcttg 562
|||||||||||| ||||||||||||
Sbjct: 185 ggggatgtcgtaaccggcgatcttg 161
>ref|NM_117451.2| Arabidopsis thaliana CYP83A1 (CYTOCHROME P450 83A1); oxygen binding
AT4G13770 (CYP83A1) mRNA, complete cds
Length = 1733
Score = 42.1 bits (21), Expect = 0.19
Identities = 24/25 (96%)
Strand = Plus / Minus
Query: 538 ggggatgtcgtagccggcgatcttg 562
|||||||||||| ||||||||||||
Sbjct: 1188 ggggatgtcgtaaccggcgatcttg 1164
>ref|NC_003075.3| Arabidopsis thaliana chromosome 4, complete sequence
Length = 18585042
Score = 42.1 bits (21), Expect = 0.19
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 538 ggggatgtcgtagccggcgatcttg 562
|||||||||||| ||||||||||||
Sbjct: 7991026 ggggatgtcgtaaccggcgatcttg 7991050
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 248,104
Number of Sequences: 1013581
Number of extensions: 248104
Number of successful extensions: 16310
Number of sequences better than 0.5: 25
Number of HSP's better than 0.5 without gapping: 25
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 16171
Number of HSP's gapped (non-prelim): 139
length of query: 1067
length of database: 908,940,872
effective HSP length: 20
effective length of query: 1047
effective length of database: 888,669,252
effective search space: 930436706844
effective search space used: 930436706844
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)