BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 2623104.2.4
         (1628 letters)

Database: At_nucl_with_EST.fasta 
           1,013,581 sequences; 908,940,872 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|CC459017.1|CC459017  SALK_123620.49.05.x Arabidopsis thal...    42   0.30 
emb|X97383.1|ATDRAN2  A.thaliana atran2 gene                       42   0.30 
gb|AF296836.1|F28I16  Arabidopsis thaliana BAC F28I16              42   0.30 
dbj|BA000015.5|  Arabidopsis thaliana DNA, chromosome 5, com...    42   0.30 
ref|NC_003076.4|  Arabidopsis thaliana chromosome 5, complet...    42   0.30 

>gb|CC459017.1|CC459017 SALK_123620.49.05.x Arabidopsis thaliana TDNA insertion lines
            Arabidopsis thaliana genomic clone SALK_123620.49.05.x,
            DNA sequence
          Length = 413

 Score = 42.1 bits (21), Expect = 0.30
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 1525 attatttattttgtcaaaact 1545
            |||||||||||||||||||||
Sbjct: 261  attatttattttgtcaaaact 241



>emb|X97383.1|ATDRAN2 A.thaliana atran2 gene
          Length = 3544

 Score = 42.1 bits (21), Expect = 0.30
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 1525 attatttattttgtcaaaact 1545
            |||||||||||||||||||||
Sbjct: 646  attatttattttgtcaaaact 666



>gb|AF296836.1|F28I16 Arabidopsis thaliana BAC F28I16
          Length = 84334

 Score = 42.1 bits (21), Expect = 0.30
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 1525  attatttattttgtcaaaact 1545
             |||||||||||||||||||||
Sbjct: 51297 attatttattttgtcaaaact 51317



>dbj|BA000015.5| Arabidopsis thaliana DNA, chromosome 5, complete sequence
          Length = 23810767

 Score = 42.1 bits (21), Expect = 0.30
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 1525    attatttattttgtcaaaact 1545
               |||||||||||||||||||||
Sbjct: 6476892 attatttattttgtcaaaact 6476912



>ref|NC_003076.4| Arabidopsis thaliana chromosome 5, complete sequence
          Length = 26992728

 Score = 42.1 bits (21), Expect = 0.30
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 1525    attatttattttgtcaaaact 1545
               |||||||||||||||||||||
Sbjct: 6762568 attatttattttgtcaaaact 6762588



  Database: At_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:09 PM
  Number of letters in database: 908,940,872
  Number of sequences in database:  1,013,581
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 676,723
Number of Sequences: 1013581
Number of extensions: 676723
Number of successful extensions: 51853
Number of sequences better than  0.5: 5
Number of HSP's better than  0.5 without gapping: 5
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 51233
Number of HSP's gapped (non-prelim): 620
length of query: 1628
length of database: 908,940,872
effective HSP length: 21
effective length of query: 1607
effective length of database: 887,655,671
effective search space: 1426462663297
effective search space used: 1426462663297
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)