BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 2618988.2.1
         (631 letters)

Database: At_nucl_with_EST.fasta 
           1,013,581 sequences; 908,940,872 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

emb|AJ595471.1|  Arabidopsis thaliana T-DNA flanking sequenc...    50   5e-004
emb|AX651767.1|  Sequence 613 from Patent WO03000898               50   5e-004
emb|BX827263.1|CNS0A2VY  Arabidopsis thaliana Full-length cD...    50   5e-004
emb|BX827376.1|CNS0A497  Arabidopsis thaliana Full-length cD...    50   5e-004
emb|AJ270060.1|  Arabidopsis thaliana DNA chromosome 4, long...    50   5e-004
dbj|AK117753.1|  Arabidopsis thaliana At4g15260 mRNA for put...    50   5e-004
emb|AL161541.2|ATCHRIV41  Arabidopsis thaliana DNA chromosom...    50   5e-004
emb|Z97338.2|ATFCA3  Arabidopsis thaliana DNA chromosome 4, ...    50   5e-004
ref|NM_117614.3|  Arabidopsis thaliana UDP-glycosyltransfera...    50   5e-004
ref|NC_003075.3|  Arabidopsis thaliana chromosome 4, complet...    50   5e-004
gb|BX835427.1|BX835427  BX835427 Arabidopsis thaliana Adult ...    42   0.11 
emb|BX823408.1|CNS0A6LZ  Arabidopsis thaliana Full-length cD...    42   0.11 
gb|B25918.1|B25918  F1B2TR IGF Arabidopsis thaliana genomic ...    40   0.45 
gb|B24884.1|B24884  F22J15TR IGF Arabidopsis thaliana genomi...    40   0.45 
emb|AL080360.1|CNS00MA2  Arabidopsis thaliana genome survey ...    40   0.45 
gb|AV782834.1|AV782834  AV782834 RAFL5 Arabidopsis thaliana ...    40   0.45 
gb|AV801289.1|AV801289  AV801289 RAFL9 Arabidopsis thaliana ...    40   0.45 
gb|AV809902.1|AV809902  AV809902 RAFL9 Arabidopsis thaliana ...    40   0.45 
gb|BX835546.1|BX835546  BX835546 Arabidopsis thaliana Adult ...    40   0.45 
gb|AV440645.1|AV440645  AV440645 Arabidopsis thaliana above-...    40   0.45 
gb|AV518117.1|AV518117  AV518117 Arabidopsis thaliana aboveg...    40   0.45 
gb|AV518385.1|AV518385  AV518385 Arabidopsis thaliana aboveg...    40   0.45 
gb|AV518619.1|AV518619  AV518619 Arabidopsis thaliana aboveg...    40   0.45 
gb|AV520871.1|AV520871  AV520871 Arabidopsis thaliana aboveg...    40   0.45 
gb|AV523817.1|AV523817  AV523817 Arabidopsis thaliana aboveg...    40   0.45 
gb|AV533312.1|AV533312  AV533312 Arabidopsis thaliana flower...    40   0.45 
gb|AV518065.2|AV518065  AV518065 Arabidopsis thaliana aboveg...    40   0.45 
gb|BP784862.1|BP784862  BP784862 RAFL7 Arabidopsis thaliana ...    40   0.45 
gb|BP787193.1|BP787193  BP787193 RAFL7 Arabidopsis thaliana ...    40   0.45 
gb|AY037255.1|  Arabidopsis thaliana AT3g16520/MDC8_15 mRNA,...    40   0.45 
gb|AY143902.1|  Arabidopsis thaliana At3g16520/MDC8_15 mRNA,...    40   0.45 
emb|BX822788.1|CNS0A4US  Arabidopsis thaliana Full-length cD...    40   0.45 
emb|BX823361.1|CNS0A6ND  Arabidopsis thaliana Full-length cD...    40   0.45 
emb|BX822861.1|CNS0A71Q  Arabidopsis thaliana Full-length cD...    40   0.45 
dbj|AP000373.1|  Arabidopsis thaliana genomic DNA, chromosom...    40   0.45 
dbj|BA000014.8|  Arabidopsis thaliana, chromosome 3, complet...    40   0.45 
emb|CQ969121.1|  Sequence 7 from Patent WO2004106508               40   0.45 
emb|CQ969122.1|  Sequence 8 from Patent WO2004106508               40   0.45 
emb|CQ974342.1|  Sequence 96 from Patent WO2004113540              40   0.45 
ref|NM_112523.1|  Arabidopsis thaliana UDP-glycosyltransfera...    40   0.45 
ref|NM_180266.1|  Arabidopsis thaliana UDP-glycosyltransfera...    40   0.45 
ref|NM_112524.3|  Arabidopsis thaliana UDP-glycosyltransfera...    40   0.45 
ref|NC_003074.4|  Arabidopsis thaliana chromosome 3, complet...    40   0.45 
>emb|AJ595471.1| Arabidopsis thaliana T-DNA flanking sequence, left border, clone
           417E03, genomic survey sequence
          Length = 516

 Score = 50.1 bits (25), Expect = 5e-004
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 420 ctgctccgcgtagagcggccacgccaccatcgg 452
           |||||||||||| |||||||||| |||||||||
Sbjct: 79  ctgctccgcgtaaagcggccacgtcaccatcgg 47
>emb|AX651767.1| Sequence 613 from Patent WO03000898
          Length = 1359

 Score = 50.1 bits (25), Expect = 5e-004
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                             
Query: 420  ctgctccgcgtagagcggccacgccaccatcgg 452
            |||||||||||| |||||||||| |||||||||
Sbjct: 1086 ctgctccgcgtaaagcggccacgtcaccatcgg 1054
>emb|BX827263.1|CNS0A2VY Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTLS2ZF09 of Adult vegetative tissue of strain col-0 of
            Arabidopsis thaliana (thale cress)
          Length = 1611

 Score = 50.1 bits (25), Expect = 5e-004
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                             
Query: 420  ctgctccgcgtagagcggccacgccaccatcgg 452
            |||||||||||| |||||||||| |||||||||
Sbjct: 1159 ctgctccgcgtaaagcggccacgtcaccatcgg 1127
>emb|BX827376.1|CNS0A497 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTLS46ZH05 of Adult vegetative tissue of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1636

 Score = 50.1 bits (25), Expect = 5e-004
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                             
Query: 420  ctgctccgcgtagagcggccacgccaccatcgg 452
            |||||||||||| |||||||||| |||||||||
Sbjct: 1168 ctgctccgcgtaaagcggccacgtcaccatcgg 1136
>emb|AJ270060.1| Arabidopsis thaliana DNA chromosome 4, long arm
          Length = 14497843

 Score = 50.1 bits (25), Expect = 5e-004
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                                
Query: 420     ctgctccgcgtagagcggccacgccaccatcgg 452
               |||||||||||| |||||||||| |||||||||
Sbjct: 4627614 ctgctccgcgtaaagcggccacgtcaccatcgg 4627582
>dbj|AK117753.1| Arabidopsis thaliana At4g15260 mRNA for putative glucosyltransferase,
            complete cds, clone: RAFL17-44-B21
          Length = 1650

 Score = 50.1 bits (25), Expect = 5e-004
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                             
Query: 420  ctgctccgcgtagagcggccacgccaccatcgg 452
            |||||||||||| |||||||||| |||||||||
Sbjct: 1183 ctgctccgcgtaaagcggccacgtcaccatcgg 1151
>emb|AL161541.2|ATCHRIV41 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 41
          Length = 197419

 Score = 50.1 bits (25), Expect = 5e-004
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                              
Query: 420   ctgctccgcgtagagcggccacgccaccatcgg 452
             |||||||||||| |||||||||| |||||||||
Sbjct: 32991 ctgctccgcgtaaagcggccacgtcaccatcgg 32959
>emb|Z97338.2|ATFCA3 Arabidopsis thaliana DNA chromosome 4, ESSA I FCA contig fragment No. 3
          Length = 200252

 Score = 50.1 bits (25), Expect = 5e-004
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                              
Query: 420   ctgctccgcgtagagcggccacgccaccatcgg 452
             |||||||||||| |||||||||| |||||||||
Sbjct: 79514 ctgctccgcgtaaagcggccacgtcaccatcgg 79482
>ref|NM_117614.3| Arabidopsis thaliana UDP-glycosyltransferase/ transferase,
            transferring glycosyl groups AT4G15260 mRNA, complete cds
          Length = 1651

 Score = 50.1 bits (25), Expect = 5e-004
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                             
Query: 420  ctgctccgcgtagagcggccacgccaccatcgg 452
            |||||||||||| |||||||||| |||||||||
Sbjct: 1183 ctgctccgcgtaaagcggccacgtcaccatcgg 1151
>ref|NC_003075.3| Arabidopsis thaliana chromosome 4, complete sequence
          Length = 18585042

 Score = 50.1 bits (25), Expect = 5e-004
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                                
Query: 420     ctgctccgcgtagagcggccacgccaccatcgg 452
               |||||||||||| |||||||||| |||||||||
Sbjct: 8714871 ctgctccgcgtaaagcggccacgtcaccatcgg 8714839
>gb|BX835427.1|BX835427 BX835427 Arabidopsis thaliana Adult vegetative tissue Col-0
           Arabidopsis thaliana cDNA clone GSLTLS87ZA03 3PRIM, mRNA
           sequence
          Length = 752

 Score = 42.1 bits (21), Expect = 0.11
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 415 agccgctgctccgcgtagagcggccacgccaccatcggcac 455
           |||| |||||| ||||| | |||||| ||||||||||||||
Sbjct: 269 agcctctgctcagcgtacaacggccaagccaccatcggcac 309
>emb|BX823408.1|CNS0A6LZ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTLS34ZB08 of Adult vegetative tissue of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1478

 Score = 42.1 bits (21), Expect = 0.11
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                     
Query: 415  agccgctgctccgcgtagagcggccacgccaccatcggcac 455
            |||| |||||| ||||| | |||||| ||||||||||||||
Sbjct: 1143 agcctctgctcagcgtacaacggccaagccaccatcggcac 1103
>gb|B25918.1|B25918 F1B2TR IGF Arabidopsis thaliana genomic clone F1B2, DNA sequence
          Length = 287

 Score = 40.1 bits (20), Expect = 0.45
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 420 ctgctccgcgtagagcggccacgccaccatcggcac 455
           |||||| ||||| | |||||| ||||||||||||||
Sbjct: 134 ctgctcagcgtacaacggccaagccaccatcggcac 99
>gb|B24884.1|B24884 F22J15TR IGF Arabidopsis thaliana genomic clone F22J15, DNA
           sequence
          Length = 482

 Score = 40.1 bits (20), Expect = 0.45
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 420 ctgctccgcgtagagcggccacgccaccatcggcac 455
           |||||| ||||| | |||||| ||||||||||||||
Sbjct: 151 ctgctcagcgtacaacggccaagccaccatcggcac 116
>emb|AL080360.1|CNS00MA2 Arabidopsis thaliana genome survey sequence SP6 end of BAC F1B2 of
           IGF library from strain Columbia of Arabidopsis
           thaliana, genomic survey sequence
          Length = 265

 Score = 40.1 bits (20), Expect = 0.45
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 420 ctgctccgcgtagagcggccacgccaccatcggcac 455
           |||||| ||||| | |||||| ||||||||||||||
Sbjct: 151 ctgctcagcgtacaacggccaagccaccatcggcac 116
>gb|AV782834.1|AV782834 AV782834 RAFL5 Arabidopsis thaliana cDNA clone RAFL05-02-D20 3',
           mRNA sequence
          Length = 685

 Score = 40.1 bits (20), Expect = 0.45
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 420 ctgctccgcgtagagcggccacgccaccatcggcac 455
           |||||| ||||| | |||||| ||||||||||||||
Sbjct: 367 ctgctcagcgtacaacggccaagccaccatcggcac 402
>gb|AV801289.1|AV801289 AV801289 RAFL9 Arabidopsis thaliana cDNA clone RAFL09-27-I20 3',
           mRNA sequence
          Length = 401

 Score = 40.1 bits (20), Expect = 0.45
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 420 ctgctccgcgtagagcggccacgccaccatcggcac 455
           |||||| ||||| | |||||| ||||||||||||||
Sbjct: 346 ctgctcagcgtacaacggccaagccaccatcggcac 381
>gb|AV809902.1|AV809902 AV809902 RAFL9 Arabidopsis thaliana cDNA clone RAFL09-61-L19 3',
           mRNA sequence
          Length = 405

 Score = 40.1 bits (20), Expect = 0.45
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 420 ctgctccgcgtagagcggccacgccaccatcggcac 455
           |||||| ||||| | |||||| ||||||||||||||
Sbjct: 363 ctgctcagcgtacaacggccaagccaccatcggcac 398
>gb|BX835546.1|BX835546 BX835546 Arabidopsis thaliana Adult vegetative tissue Col-0
           Arabidopsis thaliana cDNA clone GSLTLS85ZG05 3PRIM, mRNA
           sequence
          Length = 986

 Score = 40.1 bits (20), Expect = 0.45
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 420 ctgctccgcgtagagcggccacgccaccatcggcac 455
           |||||| ||||| | |||||| ||||||||||||||
Sbjct: 465 ctgctcagcgtacaacggccaagccaccatcggcac 500
>gb|AV440645.1|AV440645 AV440645 Arabidopsis thaliana above-ground organ two to six-week
           old Arabidopsis thaliana cDNA clone APZ05a12_f 3', mRNA
           sequence
          Length = 643

 Score = 40.1 bits (20), Expect = 0.45
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 420 ctgctccgcgtagagcggccacgccaccatcggcac 455
           |||||| ||||| | |||||| ||||||||||||||
Sbjct: 270 ctgctcagcgtacaacggccaagccaccatcggcac 305
>gb|AV518117.1|AV518117 AV518117 Arabidopsis thaliana aboveground organs two to six-week
           old Arabidopsis thaliana cDNA clone APD09a12F 3', mRNA
           sequence
          Length = 583

 Score = 40.1 bits (20), Expect = 0.45
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 420 ctgctccgcgtagagcggccacgccaccatcggcac 455
           |||||| ||||| | |||||| ||||||||||||||
Sbjct: 340 ctgctcagcgtacaacggccaagccaccatcggcac 375
>gb|AV518385.1|AV518385 AV518385 Arabidopsis thaliana aboveground organs two to six-week
           old Arabidopsis thaliana cDNA clone APD18h09F 3', mRNA
           sequence
          Length = 599

 Score = 40.1 bits (20), Expect = 0.45
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 420 ctgctccgcgtagagcggccacgccaccatcggcac 455
           |||||| ||||| | |||||| ||||||||||||||
Sbjct: 322 ctgctcagcgtacaacggccaagccaccatcggcac 357
>gb|AV518619.1|AV518619 AV518619 Arabidopsis thaliana aboveground organs two to six-week
           old Arabidopsis thaliana cDNA clone APD34a06F 3', mRNA
           sequence
          Length = 486

 Score = 40.1 bits (20), Expect = 0.45
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 420 ctgctccgcgtagagcggccacgccaccatcggcac 455
           |||||| ||||| | |||||| ||||||||||||||
Sbjct: 340 ctgctcagcgtacaacggccaagccaccatcggcac 375
>gb|AV520871.1|AV520871 AV520871 Arabidopsis thaliana aboveground organs two to six-week
           old Arabidopsis thaliana cDNA clone APZ35d09F 3', mRNA
           sequence
          Length = 480

 Score = 40.1 bits (20), Expect = 0.45
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 420 ctgctccgcgtagagcggccacgccaccatcggcac 455
           |||||| ||||| | |||||| ||||||||||||||
Sbjct: 339 ctgctcagcgtacaacggccaagccaccatcggcac 374
>gb|AV523817.1|AV523817 AV523817 Arabidopsis thaliana aboveground organs two to six-week
           old Arabidopsis thaliana cDNA clone APZL40h03F 3', mRNA
           sequence
          Length = 501

 Score = 40.1 bits (20), Expect = 0.45
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 420 ctgctccgcgtagagcggccacgccaccatcggcac 455
           |||||| ||||| | |||||| ||||||||||||||
Sbjct: 303 ctgctcagcgtacaacggccaagccaccatcggcac 338
>gb|AV533312.1|AV533312 AV533312 Arabidopsis thaliana flower buds Columbia Arabidopsis
           thaliana cDNA clone FB059e11F 3', mRNA sequence
          Length = 508

 Score = 40.1 bits (20), Expect = 0.45
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 420 ctgctccgcgtagagcggccacgccaccatcggcac 455
           |||||| ||||| | |||||| ||||||||||||||
Sbjct: 367 ctgctcagcgtacaacggccaagccaccatcggcac 402
>gb|AV518065.2|AV518065 AV518065 Arabidopsis thaliana aboveground organs two to six-week
           old Arabidopsis thaliana cDNA clone APD07a10F 3', mRNA
           sequence
          Length = 529

 Score = 40.1 bits (20), Expect = 0.45
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 420 ctgctccgcgtagagcggccacgccaccatcggcac 455
           |||||| ||||| | |||||| ||||||||||||||
Sbjct: 370 ctgctcagcgtacaacggccaagccaccatcggcac 405
>gb|BP784862.1|BP784862 BP784862 RAFL7 Arabidopsis thaliana cDNA clone RAFL07-92-G19 3',
           mRNA sequence
          Length = 411

 Score = 40.1 bits (20), Expect = 0.45
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 420 ctgctccgcgtagagcggccacgccaccatcggcac 455
           |||||| ||||| | |||||| ||||||||||||||
Sbjct: 368 ctgctcagcgtacaacggccaagccaccatcggcac 403
>gb|BP787193.1|BP787193 BP787193 RAFL7 Arabidopsis thaliana cDNA clone RAFL26-03-F20 3',
           mRNA sequence
          Length = 417

 Score = 40.1 bits (20), Expect = 0.45
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 420 ctgctccgcgtagagcggccacgccaccatcggcac 455
           |||||| ||||| | |||||| ||||||||||||||
Sbjct: 368 ctgctcagcgtacaacggccaagccaccatcggcac 403
>gb|AY037255.1| Arabidopsis thaliana AT3g16520/MDC8_15 mRNA, complete cds
          Length = 1534

 Score = 40.1 bits (20), Expect = 0.45
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 420  ctgctccgcgtagagcggccacgccaccatcggcac 455
            |||||| ||||| | |||||| ||||||||||||||
Sbjct: 1168 ctgctcagcgtacaacggccaagccaccatcggcac 1133
>gb|AY143902.1| Arabidopsis thaliana At3g16520/MDC8_15 mRNA, complete cds
          Length = 1389

 Score = 40.1 bits (20), Expect = 0.45
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 420  ctgctccgcgtagagcggccacgccaccatcggcac 455
            |||||| ||||| | |||||| ||||||||||||||
Sbjct: 1152 ctgctcagcgtacaacggccaagccaccatcggcac 1117
>emb|BX822788.1|CNS0A4US Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTFB64ZB03 of Flowers and buds of strain col-0 of
            Arabidopsis thaliana (thale cress)
          Length = 1401

 Score = 40.1 bits (20), Expect = 0.45
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 420  ctgctccgcgtagagcggccacgccaccatcggcac 455
            |||||| ||||| | |||||| ||||||||||||||
Sbjct: 1108 ctgctcagcgtacaacggccaagccaccatcggcac 1073
>emb|BX823361.1|CNS0A6ND Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTLS27ZC04 of Adult vegetative tissue of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1464

 Score = 40.1 bits (20), Expect = 0.45
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 420  ctgctccgcgtagagcggccacgccaccatcggcac 455
            |||||| ||||| | |||||| ||||||||||||||
Sbjct: 1143 ctgctcagcgtacaacggccaagccaccatcggcac 1108
>emb|BX822861.1|CNS0A71Q Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTFB69ZF05 of Flowers and buds of strain col-0 of
            Arabidopsis thaliana (thale cress)
          Length = 1501

 Score = 40.1 bits (20), Expect = 0.45
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 420  ctgctccgcgtagagcggccacgccaccatcggcac 455
            |||||| ||||| | |||||| ||||||||||||||
Sbjct: 1169 ctgctcagcgtacaacggccaagccaccatcggcac 1134
>dbj|AP000373.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MDC8
          Length = 71521

 Score = 40.1 bits (20), Expect = 0.45
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                 
Query: 420   ctgctccgcgtagagcggccacgccaccatcggcac 455
             |||||| ||||| | |||||| ||||||||||||||
Sbjct: 57163 ctgctcagcgtacaacggccaagccaccatcggcac 57198
>dbj|BA000014.8| Arabidopsis thaliana, chromosome 3, complete sequence
          Length = 23403063

 Score = 40.1 bits (20), Expect = 0.45
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                   
Query: 420     ctgctccgcgtagagcggccacgccaccatcggcac 455
               |||||| ||||| | |||||| ||||||||||||||
Sbjct: 5604060 ctgctcagcgtacaacggccaagccaccatcggcac 5604095
>emb|CQ969121.1| Sequence 7 from Patent WO2004106508
          Length = 1479

 Score = 40.1 bits (20), Expect = 0.45
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 420  ctgctccgcgtagagcggccacgccaccatcggcac 455
            |||||| ||||| | |||||| ||||||||||||||
Sbjct: 1242 ctgctcagcgtacaacggccaagccaccatcggcac 1207
>emb|CQ969122.1| Sequence 8 from Patent WO2004106508
          Length = 1389

 Score = 40.1 bits (20), Expect = 0.45
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 420  ctgctccgcgtagagcggccacgccaccatcggcac 455
            |||||| ||||| | |||||| ||||||||||||||
Sbjct: 1152 ctgctcagcgtacaacggccaagccaccatcggcac 1117
>emb|CQ974342.1| Sequence 96 from Patent WO2004113540
          Length = 1389

 Score = 40.1 bits (20), Expect = 0.45
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 420  ctgctccgcgtagagcggccacgccaccatcggcac 455
            |||||| ||||| | |||||| ||||||||||||||
Sbjct: 1152 ctgctcagcgtacaacggccaagccaccatcggcac 1117
>ref|NM_112523.1| Arabidopsis thaliana UDP-glycosyltransferase/ transferase,
            transferring glycosyl groups AT3G16520 transcript variant
            AT3G16520.1 mRNA, complete cds
          Length = 1639

 Score = 40.1 bits (20), Expect = 0.45
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 420  ctgctccgcgtagagcggccacgccaccatcggcac 455
            |||||| ||||| | |||||| ||||||||||||||
Sbjct: 1173 ctgctcagcgtacaacggccaagccaccatcggcac 1138
>ref|NM_180266.1| Arabidopsis thaliana UDP-glycosyltransferase AT3G16520 transcript
            variant AT3G16520.2 mRNA, complete cds
          Length = 1644

 Score = 40.1 bits (20), Expect = 0.45
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 420  ctgctccgcgtagagcggccacgccaccatcggcac 455
            |||||| ||||| | |||||| ||||||||||||||
Sbjct: 1192 ctgctcagcgtacaacggccaagccaccatcggcac 1157
>ref|NM_112524.3| Arabidopsis thaliana UDP-glycosyltransferase AT3G16520 transcript
            variant AT3G16520.3 mRNA, complete cds
          Length = 1656

 Score = 40.1 bits (20), Expect = 0.45
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 420  ctgctccgcgtagagcggccacgccaccatcggcac 455
            |||||| ||||| | |||||| ||||||||||||||
Sbjct: 1192 ctgctcagcgtacaacggccaagccaccatcggcac 1157
>ref|NC_003074.4| Arabidopsis thaliana chromosome 3, complete sequence
          Length = 23470805

 Score = 40.1 bits (20), Expect = 0.45
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                   
Query: 420     ctgctccgcgtagagcggccacgccaccatcggcac 455
               |||||| ||||| | |||||| ||||||||||||||
Sbjct: 5619598 ctgctcagcgtacaacggccaagccaccatcggcac 5619633
  Database: At_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:09 PM
  Number of letters in database: 908,940,872
  Number of sequences in database:  1,013,581
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 187,308
Number of Sequences: 1013581
Number of extensions: 187308
Number of successful extensions: 15760
Number of sequences better than  0.5: 43
Number of HSP's better than  0.5 without gapping: 43
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 15339
Number of HSP's gapped (non-prelim): 421
length of query: 631
length of database: 908,940,872
effective HSP length: 20
effective length of query: 611
effective length of database: 888,669,252
effective search space: 542976912972
effective search space used: 542976912972
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)