BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2618988.2.1
(631 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
emb|AJ595471.1| Arabidopsis thaliana T-DNA flanking sequenc... 50 5e-004
emb|AX651767.1| Sequence 613 from Patent WO03000898 50 5e-004
emb|BX827263.1|CNS0A2VY Arabidopsis thaliana Full-length cD... 50 5e-004
emb|BX827376.1|CNS0A497 Arabidopsis thaliana Full-length cD... 50 5e-004
emb|AJ270060.1| Arabidopsis thaliana DNA chromosome 4, long... 50 5e-004
dbj|AK117753.1| Arabidopsis thaliana At4g15260 mRNA for put... 50 5e-004
emb|AL161541.2|ATCHRIV41 Arabidopsis thaliana DNA chromosom... 50 5e-004
emb|Z97338.2|ATFCA3 Arabidopsis thaliana DNA chromosome 4, ... 50 5e-004
ref|NM_117614.3| Arabidopsis thaliana UDP-glycosyltransfera... 50 5e-004
ref|NC_003075.3| Arabidopsis thaliana chromosome 4, complet... 50 5e-004
gb|BX835427.1|BX835427 BX835427 Arabidopsis thaliana Adult ... 42 0.11
emb|BX823408.1|CNS0A6LZ Arabidopsis thaliana Full-length cD... 42 0.11
gb|B25918.1|B25918 F1B2TR IGF Arabidopsis thaliana genomic ... 40 0.45
gb|B24884.1|B24884 F22J15TR IGF Arabidopsis thaliana genomi... 40 0.45
emb|AL080360.1|CNS00MA2 Arabidopsis thaliana genome survey ... 40 0.45
gb|AV782834.1|AV782834 AV782834 RAFL5 Arabidopsis thaliana ... 40 0.45
gb|AV801289.1|AV801289 AV801289 RAFL9 Arabidopsis thaliana ... 40 0.45
gb|AV809902.1|AV809902 AV809902 RAFL9 Arabidopsis thaliana ... 40 0.45
gb|BX835546.1|BX835546 BX835546 Arabidopsis thaliana Adult ... 40 0.45
gb|AV440645.1|AV440645 AV440645 Arabidopsis thaliana above-... 40 0.45
gb|AV518117.1|AV518117 AV518117 Arabidopsis thaliana aboveg... 40 0.45
gb|AV518385.1|AV518385 AV518385 Arabidopsis thaliana aboveg... 40 0.45
gb|AV518619.1|AV518619 AV518619 Arabidopsis thaliana aboveg... 40 0.45
gb|AV520871.1|AV520871 AV520871 Arabidopsis thaliana aboveg... 40 0.45
gb|AV523817.1|AV523817 AV523817 Arabidopsis thaliana aboveg... 40 0.45
gb|AV533312.1|AV533312 AV533312 Arabidopsis thaliana flower... 40 0.45
gb|AV518065.2|AV518065 AV518065 Arabidopsis thaliana aboveg... 40 0.45
gb|BP784862.1|BP784862 BP784862 RAFL7 Arabidopsis thaliana ... 40 0.45
gb|BP787193.1|BP787193 BP787193 RAFL7 Arabidopsis thaliana ... 40 0.45
gb|AY037255.1| Arabidopsis thaliana AT3g16520/MDC8_15 mRNA,... 40 0.45
gb|AY143902.1| Arabidopsis thaliana At3g16520/MDC8_15 mRNA,... 40 0.45
emb|BX822788.1|CNS0A4US Arabidopsis thaliana Full-length cD... 40 0.45
emb|BX823361.1|CNS0A6ND Arabidopsis thaliana Full-length cD... 40 0.45
emb|BX822861.1|CNS0A71Q Arabidopsis thaliana Full-length cD... 40 0.45
dbj|AP000373.1| Arabidopsis thaliana genomic DNA, chromosom... 40 0.45
dbj|BA000014.8| Arabidopsis thaliana, chromosome 3, complet... 40 0.45
emb|CQ969121.1| Sequence 7 from Patent WO2004106508 40 0.45
emb|CQ969122.1| Sequence 8 from Patent WO2004106508 40 0.45
emb|CQ974342.1| Sequence 96 from Patent WO2004113540 40 0.45
ref|NM_112523.1| Arabidopsis thaliana UDP-glycosyltransfera... 40 0.45
ref|NM_180266.1| Arabidopsis thaliana UDP-glycosyltransfera... 40 0.45
ref|NM_112524.3| Arabidopsis thaliana UDP-glycosyltransfera... 40 0.45
ref|NC_003074.4| Arabidopsis thaliana chromosome 3, complet... 40 0.45
>emb|AJ595471.1| Arabidopsis thaliana T-DNA flanking sequence, left border, clone
417E03, genomic survey sequence
Length = 516
Score = 50.1 bits (25), Expect = 5e-004
Identities = 31/33 (93%)
Strand = Plus / Minus
Query: 420 ctgctccgcgtagagcggccacgccaccatcgg 452
|||||||||||| |||||||||| |||||||||
Sbjct: 79 ctgctccgcgtaaagcggccacgtcaccatcgg 47
>emb|AX651767.1| Sequence 613 from Patent WO03000898
Length = 1359
Score = 50.1 bits (25), Expect = 5e-004
Identities = 31/33 (93%)
Strand = Plus / Minus
Query: 420 ctgctccgcgtagagcggccacgccaccatcgg 452
|||||||||||| |||||||||| |||||||||
Sbjct: 1086 ctgctccgcgtaaagcggccacgtcaccatcgg 1054
>emb|BX827263.1|CNS0A2VY Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTLS2ZF09 of Adult vegetative tissue of strain col-0 of
Arabidopsis thaliana (thale cress)
Length = 1611
Score = 50.1 bits (25), Expect = 5e-004
Identities = 31/33 (93%)
Strand = Plus / Minus
Query: 420 ctgctccgcgtagagcggccacgccaccatcgg 452
|||||||||||| |||||||||| |||||||||
Sbjct: 1159 ctgctccgcgtaaagcggccacgtcaccatcgg 1127
>emb|BX827376.1|CNS0A497 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTLS46ZH05 of Adult vegetative tissue of strain col-0
of Arabidopsis thaliana (thale cress)
Length = 1636
Score = 50.1 bits (25), Expect = 5e-004
Identities = 31/33 (93%)
Strand = Plus / Minus
Query: 420 ctgctccgcgtagagcggccacgccaccatcgg 452
|||||||||||| |||||||||| |||||||||
Sbjct: 1168 ctgctccgcgtaaagcggccacgtcaccatcgg 1136
>emb|AJ270060.1| Arabidopsis thaliana DNA chromosome 4, long arm
Length = 14497843
Score = 50.1 bits (25), Expect = 5e-004
Identities = 31/33 (93%)
Strand = Plus / Minus
Query: 420 ctgctccgcgtagagcggccacgccaccatcgg 452
|||||||||||| |||||||||| |||||||||
Sbjct: 4627614 ctgctccgcgtaaagcggccacgtcaccatcgg 4627582
>dbj|AK117753.1| Arabidopsis thaliana At4g15260 mRNA for putative glucosyltransferase,
complete cds, clone: RAFL17-44-B21
Length = 1650
Score = 50.1 bits (25), Expect = 5e-004
Identities = 31/33 (93%)
Strand = Plus / Minus
Query: 420 ctgctccgcgtagagcggccacgccaccatcgg 452
|||||||||||| |||||||||| |||||||||
Sbjct: 1183 ctgctccgcgtaaagcggccacgtcaccatcgg 1151
>emb|AL161541.2|ATCHRIV41 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 41
Length = 197419
Score = 50.1 bits (25), Expect = 5e-004
Identities = 31/33 (93%)
Strand = Plus / Minus
Query: 420 ctgctccgcgtagagcggccacgccaccatcgg 452
|||||||||||| |||||||||| |||||||||
Sbjct: 32991 ctgctccgcgtaaagcggccacgtcaccatcgg 32959
>emb|Z97338.2|ATFCA3 Arabidopsis thaliana DNA chromosome 4, ESSA I FCA contig fragment No. 3
Length = 200252
Score = 50.1 bits (25), Expect = 5e-004
Identities = 31/33 (93%)
Strand = Plus / Minus
Query: 420 ctgctccgcgtagagcggccacgccaccatcgg 452
|||||||||||| |||||||||| |||||||||
Sbjct: 79514 ctgctccgcgtaaagcggccacgtcaccatcgg 79482
>ref|NM_117614.3| Arabidopsis thaliana UDP-glycosyltransferase/ transferase,
transferring glycosyl groups AT4G15260 mRNA, complete cds
Length = 1651
Score = 50.1 bits (25), Expect = 5e-004
Identities = 31/33 (93%)
Strand = Plus / Minus
Query: 420 ctgctccgcgtagagcggccacgccaccatcgg 452
|||||||||||| |||||||||| |||||||||
Sbjct: 1183 ctgctccgcgtaaagcggccacgtcaccatcgg 1151
>ref|NC_003075.3| Arabidopsis thaliana chromosome 4, complete sequence
Length = 18585042
Score = 50.1 bits (25), Expect = 5e-004
Identities = 31/33 (93%)
Strand = Plus / Minus
Query: 420 ctgctccgcgtagagcggccacgccaccatcgg 452
|||||||||||| |||||||||| |||||||||
Sbjct: 8714871 ctgctccgcgtaaagcggccacgtcaccatcgg 8714839
>gb|BX835427.1|BX835427 BX835427 Arabidopsis thaliana Adult vegetative tissue Col-0
Arabidopsis thaliana cDNA clone GSLTLS87ZA03 3PRIM, mRNA
sequence
Length = 752
Score = 42.1 bits (21), Expect = 0.11
Identities = 36/41 (87%)
Strand = Plus / Plus
Query: 415 agccgctgctccgcgtagagcggccacgccaccatcggcac 455
|||| |||||| ||||| | |||||| ||||||||||||||
Sbjct: 269 agcctctgctcagcgtacaacggccaagccaccatcggcac 309
>emb|BX823408.1|CNS0A6LZ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTLS34ZB08 of Adult vegetative tissue of strain col-0
of Arabidopsis thaliana (thale cress)
Length = 1478
Score = 42.1 bits (21), Expect = 0.11
Identities = 36/41 (87%)
Strand = Plus / Minus
Query: 415 agccgctgctccgcgtagagcggccacgccaccatcggcac 455
|||| |||||| ||||| | |||||| ||||||||||||||
Sbjct: 1143 agcctctgctcagcgtacaacggccaagccaccatcggcac 1103
>gb|B25918.1|B25918 F1B2TR IGF Arabidopsis thaliana genomic clone F1B2, DNA sequence
Length = 287
Score = 40.1 bits (20), Expect = 0.45
Identities = 32/36 (88%)
Strand = Plus / Minus
Query: 420 ctgctccgcgtagagcggccacgccaccatcggcac 455
|||||| ||||| | |||||| ||||||||||||||
Sbjct: 134 ctgctcagcgtacaacggccaagccaccatcggcac 99
>gb|B24884.1|B24884 F22J15TR IGF Arabidopsis thaliana genomic clone F22J15, DNA
sequence
Length = 482
Score = 40.1 bits (20), Expect = 0.45
Identities = 32/36 (88%)
Strand = Plus / Minus
Query: 420 ctgctccgcgtagagcggccacgccaccatcggcac 455
|||||| ||||| | |||||| ||||||||||||||
Sbjct: 151 ctgctcagcgtacaacggccaagccaccatcggcac 116
>emb|AL080360.1|CNS00MA2 Arabidopsis thaliana genome survey sequence SP6 end of BAC F1B2 of
IGF library from strain Columbia of Arabidopsis
thaliana, genomic survey sequence
Length = 265
Score = 40.1 bits (20), Expect = 0.45
Identities = 32/36 (88%)
Strand = Plus / Minus
Query: 420 ctgctccgcgtagagcggccacgccaccatcggcac 455
|||||| ||||| | |||||| ||||||||||||||
Sbjct: 151 ctgctcagcgtacaacggccaagccaccatcggcac 116
>gb|AV782834.1|AV782834 AV782834 RAFL5 Arabidopsis thaliana cDNA clone RAFL05-02-D20 3',
mRNA sequence
Length = 685
Score = 40.1 bits (20), Expect = 0.45
Identities = 32/36 (88%)
Strand = Plus / Plus
Query: 420 ctgctccgcgtagagcggccacgccaccatcggcac 455
|||||| ||||| | |||||| ||||||||||||||
Sbjct: 367 ctgctcagcgtacaacggccaagccaccatcggcac 402
>gb|AV801289.1|AV801289 AV801289 RAFL9 Arabidopsis thaliana cDNA clone RAFL09-27-I20 3',
mRNA sequence
Length = 401
Score = 40.1 bits (20), Expect = 0.45
Identities = 32/36 (88%)
Strand = Plus / Plus
Query: 420 ctgctccgcgtagagcggccacgccaccatcggcac 455
|||||| ||||| | |||||| ||||||||||||||
Sbjct: 346 ctgctcagcgtacaacggccaagccaccatcggcac 381
>gb|AV809902.1|AV809902 AV809902 RAFL9 Arabidopsis thaliana cDNA clone RAFL09-61-L19 3',
mRNA sequence
Length = 405
Score = 40.1 bits (20), Expect = 0.45
Identities = 32/36 (88%)
Strand = Plus / Plus
Query: 420 ctgctccgcgtagagcggccacgccaccatcggcac 455
|||||| ||||| | |||||| ||||||||||||||
Sbjct: 363 ctgctcagcgtacaacggccaagccaccatcggcac 398
>gb|BX835546.1|BX835546 BX835546 Arabidopsis thaliana Adult vegetative tissue Col-0
Arabidopsis thaliana cDNA clone GSLTLS85ZG05 3PRIM, mRNA
sequence
Length = 986
Score = 40.1 bits (20), Expect = 0.45
Identities = 32/36 (88%)
Strand = Plus / Plus
Query: 420 ctgctccgcgtagagcggccacgccaccatcggcac 455
|||||| ||||| | |||||| ||||||||||||||
Sbjct: 465 ctgctcagcgtacaacggccaagccaccatcggcac 500
>gb|AV440645.1|AV440645 AV440645 Arabidopsis thaliana above-ground organ two to six-week
old Arabidopsis thaliana cDNA clone APZ05a12_f 3', mRNA
sequence
Length = 643
Score = 40.1 bits (20), Expect = 0.45
Identities = 32/36 (88%)
Strand = Plus / Plus
Query: 420 ctgctccgcgtagagcggccacgccaccatcggcac 455
|||||| ||||| | |||||| ||||||||||||||
Sbjct: 270 ctgctcagcgtacaacggccaagccaccatcggcac 305
>gb|AV518117.1|AV518117 AV518117 Arabidopsis thaliana aboveground organs two to six-week
old Arabidopsis thaliana cDNA clone APD09a12F 3', mRNA
sequence
Length = 583
Score = 40.1 bits (20), Expect = 0.45
Identities = 32/36 (88%)
Strand = Plus / Plus
Query: 420 ctgctccgcgtagagcggccacgccaccatcggcac 455
|||||| ||||| | |||||| ||||||||||||||
Sbjct: 340 ctgctcagcgtacaacggccaagccaccatcggcac 375
>gb|AV518385.1|AV518385 AV518385 Arabidopsis thaliana aboveground organs two to six-week
old Arabidopsis thaliana cDNA clone APD18h09F 3', mRNA
sequence
Length = 599
Score = 40.1 bits (20), Expect = 0.45
Identities = 32/36 (88%)
Strand = Plus / Plus
Query: 420 ctgctccgcgtagagcggccacgccaccatcggcac 455
|||||| ||||| | |||||| ||||||||||||||
Sbjct: 322 ctgctcagcgtacaacggccaagccaccatcggcac 357
>gb|AV518619.1|AV518619 AV518619 Arabidopsis thaliana aboveground organs two to six-week
old Arabidopsis thaliana cDNA clone APD34a06F 3', mRNA
sequence
Length = 486
Score = 40.1 bits (20), Expect = 0.45
Identities = 32/36 (88%)
Strand = Plus / Plus
Query: 420 ctgctccgcgtagagcggccacgccaccatcggcac 455
|||||| ||||| | |||||| ||||||||||||||
Sbjct: 340 ctgctcagcgtacaacggccaagccaccatcggcac 375
>gb|AV520871.1|AV520871 AV520871 Arabidopsis thaliana aboveground organs two to six-week
old Arabidopsis thaliana cDNA clone APZ35d09F 3', mRNA
sequence
Length = 480
Score = 40.1 bits (20), Expect = 0.45
Identities = 32/36 (88%)
Strand = Plus / Plus
Query: 420 ctgctccgcgtagagcggccacgccaccatcggcac 455
|||||| ||||| | |||||| ||||||||||||||
Sbjct: 339 ctgctcagcgtacaacggccaagccaccatcggcac 374
>gb|AV523817.1|AV523817 AV523817 Arabidopsis thaliana aboveground organs two to six-week
old Arabidopsis thaliana cDNA clone APZL40h03F 3', mRNA
sequence
Length = 501
Score = 40.1 bits (20), Expect = 0.45
Identities = 32/36 (88%)
Strand = Plus / Plus
Query: 420 ctgctccgcgtagagcggccacgccaccatcggcac 455
|||||| ||||| | |||||| ||||||||||||||
Sbjct: 303 ctgctcagcgtacaacggccaagccaccatcggcac 338
>gb|AV533312.1|AV533312 AV533312 Arabidopsis thaliana flower buds Columbia Arabidopsis
thaliana cDNA clone FB059e11F 3', mRNA sequence
Length = 508
Score = 40.1 bits (20), Expect = 0.45
Identities = 32/36 (88%)
Strand = Plus / Plus
Query: 420 ctgctccgcgtagagcggccacgccaccatcggcac 455
|||||| ||||| | |||||| ||||||||||||||
Sbjct: 367 ctgctcagcgtacaacggccaagccaccatcggcac 402
>gb|AV518065.2|AV518065 AV518065 Arabidopsis thaliana aboveground organs two to six-week
old Arabidopsis thaliana cDNA clone APD07a10F 3', mRNA
sequence
Length = 529
Score = 40.1 bits (20), Expect = 0.45
Identities = 32/36 (88%)
Strand = Plus / Plus
Query: 420 ctgctccgcgtagagcggccacgccaccatcggcac 455
|||||| ||||| | |||||| ||||||||||||||
Sbjct: 370 ctgctcagcgtacaacggccaagccaccatcggcac 405
>gb|BP784862.1|BP784862 BP784862 RAFL7 Arabidopsis thaliana cDNA clone RAFL07-92-G19 3',
mRNA sequence
Length = 411
Score = 40.1 bits (20), Expect = 0.45
Identities = 32/36 (88%)
Strand = Plus / Plus
Query: 420 ctgctccgcgtagagcggccacgccaccatcggcac 455
|||||| ||||| | |||||| ||||||||||||||
Sbjct: 368 ctgctcagcgtacaacggccaagccaccatcggcac 403
>gb|BP787193.1|BP787193 BP787193 RAFL7 Arabidopsis thaliana cDNA clone RAFL26-03-F20 3',
mRNA sequence
Length = 417
Score = 40.1 bits (20), Expect = 0.45
Identities = 32/36 (88%)
Strand = Plus / Plus
Query: 420 ctgctccgcgtagagcggccacgccaccatcggcac 455
|||||| ||||| | |||||| ||||||||||||||
Sbjct: 368 ctgctcagcgtacaacggccaagccaccatcggcac 403
>gb|AY037255.1| Arabidopsis thaliana AT3g16520/MDC8_15 mRNA, complete cds
Length = 1534
Score = 40.1 bits (20), Expect = 0.45
Identities = 32/36 (88%)
Strand = Plus / Minus
Query: 420 ctgctccgcgtagagcggccacgccaccatcggcac 455
|||||| ||||| | |||||| ||||||||||||||
Sbjct: 1168 ctgctcagcgtacaacggccaagccaccatcggcac 1133
>gb|AY143902.1| Arabidopsis thaliana At3g16520/MDC8_15 mRNA, complete cds
Length = 1389
Score = 40.1 bits (20), Expect = 0.45
Identities = 32/36 (88%)
Strand = Plus / Minus
Query: 420 ctgctccgcgtagagcggccacgccaccatcggcac 455
|||||| ||||| | |||||| ||||||||||||||
Sbjct: 1152 ctgctcagcgtacaacggccaagccaccatcggcac 1117
>emb|BX822788.1|CNS0A4US Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTFB64ZB03 of Flowers and buds of strain col-0 of
Arabidopsis thaliana (thale cress)
Length = 1401
Score = 40.1 bits (20), Expect = 0.45
Identities = 32/36 (88%)
Strand = Plus / Minus
Query: 420 ctgctccgcgtagagcggccacgccaccatcggcac 455
|||||| ||||| | |||||| ||||||||||||||
Sbjct: 1108 ctgctcagcgtacaacggccaagccaccatcggcac 1073
>emb|BX823361.1|CNS0A6ND Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTLS27ZC04 of Adult vegetative tissue of strain col-0
of Arabidopsis thaliana (thale cress)
Length = 1464
Score = 40.1 bits (20), Expect = 0.45
Identities = 32/36 (88%)
Strand = Plus / Minus
Query: 420 ctgctccgcgtagagcggccacgccaccatcggcac 455
|||||| ||||| | |||||| ||||||||||||||
Sbjct: 1143 ctgctcagcgtacaacggccaagccaccatcggcac 1108
>emb|BX822861.1|CNS0A71Q Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTFB69ZF05 of Flowers and buds of strain col-0 of
Arabidopsis thaliana (thale cress)
Length = 1501
Score = 40.1 bits (20), Expect = 0.45
Identities = 32/36 (88%)
Strand = Plus / Minus
Query: 420 ctgctccgcgtagagcggccacgccaccatcggcac 455
|||||| ||||| | |||||| ||||||||||||||
Sbjct: 1169 ctgctcagcgtacaacggccaagccaccatcggcac 1134
>dbj|AP000373.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MDC8
Length = 71521
Score = 40.1 bits (20), Expect = 0.45
Identities = 32/36 (88%)
Strand = Plus / Plus
Query: 420 ctgctccgcgtagagcggccacgccaccatcggcac 455
|||||| ||||| | |||||| ||||||||||||||
Sbjct: 57163 ctgctcagcgtacaacggccaagccaccatcggcac 57198
>dbj|BA000014.8| Arabidopsis thaliana, chromosome 3, complete sequence
Length = 23403063
Score = 40.1 bits (20), Expect = 0.45
Identities = 32/36 (88%)
Strand = Plus / Plus
Query: 420 ctgctccgcgtagagcggccacgccaccatcggcac 455
|||||| ||||| | |||||| ||||||||||||||
Sbjct: 5604060 ctgctcagcgtacaacggccaagccaccatcggcac 5604095
>emb|CQ969121.1| Sequence 7 from Patent WO2004106508
Length = 1479
Score = 40.1 bits (20), Expect = 0.45
Identities = 32/36 (88%)
Strand = Plus / Minus
Query: 420 ctgctccgcgtagagcggccacgccaccatcggcac 455
|||||| ||||| | |||||| ||||||||||||||
Sbjct: 1242 ctgctcagcgtacaacggccaagccaccatcggcac 1207
>emb|CQ969122.1| Sequence 8 from Patent WO2004106508
Length = 1389
Score = 40.1 bits (20), Expect = 0.45
Identities = 32/36 (88%)
Strand = Plus / Minus
Query: 420 ctgctccgcgtagagcggccacgccaccatcggcac 455
|||||| ||||| | |||||| ||||||||||||||
Sbjct: 1152 ctgctcagcgtacaacggccaagccaccatcggcac 1117
>emb|CQ974342.1| Sequence 96 from Patent WO2004113540
Length = 1389
Score = 40.1 bits (20), Expect = 0.45
Identities = 32/36 (88%)
Strand = Plus / Minus
Query: 420 ctgctccgcgtagagcggccacgccaccatcggcac 455
|||||| ||||| | |||||| ||||||||||||||
Sbjct: 1152 ctgctcagcgtacaacggccaagccaccatcggcac 1117
>ref|NM_112523.1| Arabidopsis thaliana UDP-glycosyltransferase/ transferase,
transferring glycosyl groups AT3G16520 transcript variant
AT3G16520.1 mRNA, complete cds
Length = 1639
Score = 40.1 bits (20), Expect = 0.45
Identities = 32/36 (88%)
Strand = Plus / Minus
Query: 420 ctgctccgcgtagagcggccacgccaccatcggcac 455
|||||| ||||| | |||||| ||||||||||||||
Sbjct: 1173 ctgctcagcgtacaacggccaagccaccatcggcac 1138
>ref|NM_180266.1| Arabidopsis thaliana UDP-glycosyltransferase AT3G16520 transcript
variant AT3G16520.2 mRNA, complete cds
Length = 1644
Score = 40.1 bits (20), Expect = 0.45
Identities = 32/36 (88%)
Strand = Plus / Minus
Query: 420 ctgctccgcgtagagcggccacgccaccatcggcac 455
|||||| ||||| | |||||| ||||||||||||||
Sbjct: 1192 ctgctcagcgtacaacggccaagccaccatcggcac 1157
>ref|NM_112524.3| Arabidopsis thaliana UDP-glycosyltransferase AT3G16520 transcript
variant AT3G16520.3 mRNA, complete cds
Length = 1656
Score = 40.1 bits (20), Expect = 0.45
Identities = 32/36 (88%)
Strand = Plus / Minus
Query: 420 ctgctccgcgtagagcggccacgccaccatcggcac 455
|||||| ||||| | |||||| ||||||||||||||
Sbjct: 1192 ctgctcagcgtacaacggccaagccaccatcggcac 1157
>ref|NC_003074.4| Arabidopsis thaliana chromosome 3, complete sequence
Length = 23470805
Score = 40.1 bits (20), Expect = 0.45
Identities = 32/36 (88%)
Strand = Plus / Plus
Query: 420 ctgctccgcgtagagcggccacgccaccatcggcac 455
|||||| ||||| | |||||| ||||||||||||||
Sbjct: 5619598 ctgctcagcgtacaacggccaagccaccatcggcac 5619633
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 187,308
Number of Sequences: 1013581
Number of extensions: 187308
Number of successful extensions: 15760
Number of sequences better than 0.5: 43
Number of HSP's better than 0.5 without gapping: 43
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 15339
Number of HSP's gapped (non-prelim): 421
length of query: 631
length of database: 908,940,872
effective HSP length: 20
effective length of query: 611
effective length of database: 888,669,252
effective search space: 542976912972
effective search space used: 542976912972
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)