BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 2521459.2.4
         (760 letters)

Database: At_nucl_with_EST.fasta 
           1,013,581 sequences; 908,940,872 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|AV790691.1|AV790691  AV790691 RAFL6 Arabidopsis thaliana ...    42   0.14 
gb|AV825235.1|AV825235  AV825235 RAFL6 Arabidopsis thaliana ...    42   0.14 
gb|AY136336.1|  Arabidopsis thaliana unknown protein mRNA, c...    42   0.14 
gb|BT000101.1|  Arabidopsis thaliana unknown protein (not an...    42   0.14 
gb|AC005315.3|  Arabidopsis thaliana chromosome 2 clone T9I4...    42   0.14 
tpg|BK001756.1|  TPA: Arabidopsis thaliana DVL13 (DVL13) mRN...    42   0.14 
ref|NM_179799.1|  Arabidopsis thaliana unknown protein AT2G2...    42   0.14 
ref|NC_003071.3|  Arabidopsis thaliana chromosome 2, complet...    42   0.14 

>gb|AV790691.1|AV790691 AV790691 RAFL6 Arabidopsis thaliana cDNA clone RAFL06-89-M20 3',
           mRNA sequence
          Length = 425

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 39  tatgcttgtttgttggcacaa 59
           |||||||||||||||||||||
Sbjct: 328 tatgcttgtttgttggcacaa 308



>gb|AV825235.1|AV825235 AV825235 RAFL6 Arabidopsis thaliana cDNA clone RAFL06-89-M20 5',
           mRNA sequence
          Length = 577

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 39  tatgcttgtttgttggcacaa 59
           |||||||||||||||||||||
Sbjct: 443 tatgcttgtttgttggcacaa 463



>gb|AY136336.1| Arabidopsis thaliana unknown protein mRNA, complete cds
          Length = 768

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 39  tatgcttgtttgttggcacaa 59
           |||||||||||||||||||||
Sbjct: 442 tatgcttgtttgttggcacaa 462



>gb|BT000101.1| Arabidopsis thaliana unknown protein (not annotated) mRNA, complete
           cds
          Length = 583

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 39  tatgcttgtttgttggcacaa 59
           |||||||||||||||||||||
Sbjct: 312 tatgcttgtttgttggcacaa 332



>gb|AC005315.3| Arabidopsis thaliana chromosome 2 clone T9I4 map mi54, complete sequence
          Length = 108393

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 39     tatgcttgtttgttggcacaa 59
              |||||||||||||||||||||
Sbjct: 103519 tatgcttgtttgttggcacaa 103539



>tpg|BK001756.1| TPA: Arabidopsis thaliana DVL13 (DVL13) mRNA, complete cds
          Length = 348

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 39  tatgcttgtttgttggcacaa 59
           |||||||||||||||||||||
Sbjct: 312 tatgcttgtttgttggcacaa 332



>ref|NM_179799.1| Arabidopsis thaliana unknown protein AT2G29125 mRNA, complete cds
          Length = 768

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 39  tatgcttgtttgttggcacaa 59
           |||||||||||||||||||||
Sbjct: 442 tatgcttgtttgttggcacaa 462



>ref|NC_003071.3| Arabidopsis thaliana chromosome 2, complete sequence
          Length = 19705359

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 39       tatgcttgtttgttggcacaa 59
                |||||||||||||||||||||
Sbjct: 12530860 tatgcttgtttgttggcacaa 12530880



  Database: At_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:09 PM
  Number of letters in database: 908,940,872
  Number of sequences in database:  1,013,581
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 364,655
Number of Sequences: 1013581
Number of extensions: 364655
Number of successful extensions: 26602
Number of sequences better than  0.5: 8
Number of HSP's better than  0.5 without gapping: 8
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 26436
Number of HSP's gapped (non-prelim): 166
length of query: 760
length of database: 908,940,872
effective HSP length: 20
effective length of query: 740
effective length of database: 888,669,252
effective search space: 657615246480
effective search space used: 657615246480
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)