BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2486118.2.1
(635 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|Z35212.1|Z35212 ATTS3758 Strasbourg-A Arabidopsis thalia... 80 5e-013
gb|AV521149.1|AV521149 AV521149 Arabidopsis thaliana aboveg... 80 5e-013
gb|AV523332.1|AV523332 AV523332 Arabidopsis thaliana aboveg... 80 5e-013
gb|AV546912.1|AV546912 AV546912 Arabidopsis thaliana roots ... 80 5e-013
gb|AV548317.1|AV548317 AV548317 Arabidopsis thaliana roots ... 80 5e-013
gb|AV548647.1|AV548647 AV548647 Arabidopsis thaliana roots ... 80 5e-013
gb|AF232907.1|AF232907 Arabidopsis thaliana cellulose synth... 80 5e-013
gb|AF360180.1| Arabidopsis thaliana putative cellulose synt... 80 5e-013
gb|AY039996.1| Arabidopsis thaliana putative cellulose synt... 80 5e-013
emb|AJ297948.1|ATH297948 Arabidopsis thaliana CSLD3 gene fo... 80 5e-013
gb|AC012328.6|ATAC012328 Arabidopsis thaliana chromosome II... 80 5e-013
dbj|BA000014.8| Arabidopsis thaliana, chromosome 3, complet... 80 5e-013
ref|NM_111175.2| Arabidopsis thaliana CSLD3 (CELLULOSE SYNT... 80 5e-013
ref|NC_003074.4| Arabidopsis thaliana chromosome 3, complet... 80 5e-013
gb|AI996738.1|AI996738 701668165 A. thaliana, Columbia Col-... 50 5e-004
>gb|Z35212.1|Z35212 ATTS3758 Strasbourg-A Arabidopsis thaliana cDNA clone FAI228 3',
mRNA sequence
Length = 366
Score = 79.8 bits (40), Expect = 5e-013
Identities = 97/116 (83%)
Strand = Plus / Plus
Query: 80 atcatgatggtgaacctgatcggcatcgcggtcgggttcagccgcaccatctacagcgag 139
||||||||||||||||| |||| ||||||||||||||| ||| | || || ||||| | |
Sbjct: 205 atcatgatggtgaacctaatcgccatcgcggtcgggtttagcaggacgatatacagtgtg 264
Query: 140 atcccgcagtggagcaagctgctgggcggcgtcttcttcagcttctgggtgctggc 195
|| ||||||||||| ||| || | || || || |||||||| |||||||| |||||
Sbjct: 265 attccgcagtggagtaagttgattggaggagtgttcttcagtttctgggtactggc 320
>gb|AV521149.1|AV521149 AV521149 Arabidopsis thaliana aboveground organs two to six-week
old Arabidopsis thaliana cDNA clone APZ45d05F 3', mRNA
sequence
Length = 631
Score = 79.8 bits (40), Expect = 5e-013
Identities = 97/116 (83%)
Strand = Plus / Minus
Query: 80 atcatgatggtgaacctgatcggcatcgcggtcgggttcagccgcaccatctacagcgag 139
||||||||||||||||| |||| ||||||||||||||| ||| | || || ||||| | |
Sbjct: 519 atcatgatggtgaacctaatcgccatcgcggtcgggtttagcaggacgatatacagtgtg 460
Query: 140 atcccgcagtggagcaagctgctgggcggcgtcttcttcagcttctgggtgctggc 195
|| ||||||||||| ||| || | || || || |||||||| |||||||| |||||
Sbjct: 459 attccgcagtggagtaagttgattggaggagtgttcttcagtttctgggtactggc 404
>gb|AV523332.1|AV523332 AV523332 Arabidopsis thaliana aboveground organs two to six-week
old Arabidopsis thaliana cDNA clone APZL24e03F 3', mRNA
sequence
Length = 620
Score = 79.8 bits (40), Expect = 5e-013
Identities = 97/116 (83%)
Strand = Plus / Minus
Query: 80 atcatgatggtgaacctgatcggcatcgcggtcgggttcagccgcaccatctacagcgag 139
||||||||||||||||| |||| ||||||||||||||| ||| | || || ||||| | |
Sbjct: 479 atcatgatggtgaacctaatcgccatcgcggtcgggtttagcaggacgatatacagtgtg 420
Query: 140 atcccgcagtggagcaagctgctgggcggcgtcttcttcagcttctgggtgctggc 195
|| ||||||||||| ||| || | || || || |||||||| |||||||| |||||
Sbjct: 419 attccgcagtggagtaagttgattggaggagtgttcttcagtttctgggtactggc 364
>gb|AV546912.1|AV546912 AV546912 Arabidopsis thaliana roots Columbia Arabidopsis thaliana
cDNA clone RZL21f11F 3', mRNA sequence
Length = 570
Score = 79.8 bits (40), Expect = 5e-013
Identities = 97/116 (83%)
Strand = Plus / Minus
Query: 80 atcatgatggtgaacctgatcggcatcgcggtcgggttcagccgcaccatctacagcgag 139
||||||||||||||||| |||| ||||||||||||||| ||| | || || ||||| | |
Sbjct: 551 atcatgatggtgaacctaatcgccatcgcggtcgggtttagcaggacgatatacagtgtg 492
Query: 140 atcccgcagtggagcaagctgctgggcggcgtcttcttcagcttctgggtgctggc 195
|| ||||||||||| ||| || | || || || |||||||| |||||||| |||||
Sbjct: 491 attccgcagtggagtaagttgattggaggagtgttcttcagtttctgggtactggc 436
>gb|AV548317.1|AV548317 AV548317 Arabidopsis thaliana roots Columbia Arabidopsis thaliana
cDNA clone RZL51f07F 3', mRNA sequence
Length = 557
Score = 79.8 bits (40), Expect = 5e-013
Identities = 97/116 (83%)
Strand = Plus / Minus
Query: 80 atcatgatggtgaacctgatcggcatcgcggtcgggttcagccgcaccatctacagcgag 139
||||||||||||||||| |||| ||||||||||||||| ||| | || || ||||| | |
Sbjct: 538 atcatgatggtgaacctaatcgccatcgcggtcgggtttagcaggacgatatacagtgtg 479
Query: 140 atcccgcagtggagcaagctgctgggcggcgtcttcttcagcttctgggtgctggc 195
|| ||||||||||| ||| || | || || || |||||||| |||||||| |||||
Sbjct: 478 attccgcagtggagtaagttgattggaggagtgttcttcagtttctgggtactggc 423
>gb|AV548647.1|AV548647 AV548647 Arabidopsis thaliana roots Columbia Arabidopsis thaliana
cDNA clone RZL58g10F 3', mRNA sequence
Length = 563
Score = 79.8 bits (40), Expect = 5e-013
Identities = 97/116 (83%)
Strand = Plus / Minus
Query: 80 atcatgatggtgaacctgatcggcatcgcggtcgggttcagccgcaccatctacagcgag 139
||||||||||||||||| |||| ||||||||||||||| ||| | || || ||||| | |
Sbjct: 544 atcatgatggtgaacctaatcgccatcgcggtcgggtttagcaggacgatatacagtgtg 485
Query: 140 atcccgcagtggagcaagctgctgggcggcgtcttcttcagcttctgggtgctggc 195
|| ||||||||||| ||| || | || || || |||||||| |||||||| |||||
Sbjct: 484 attccgcagtggagtaagttgattggaggagtgttcttcagtttctgggtactggc 429
>gb|AF232907.1|AF232907 Arabidopsis thaliana cellulose synthase-like CSLD3 (CslD3) mRNA,
complete cds
Length = 3827
Score = 79.8 bits (40), Expect = 5e-013
Identities = 97/116 (83%)
Strand = Plus / Plus
Query: 80 atcatgatggtgaacctgatcggcatcgcggtcgggttcagccgcaccatctacagcgag 139
||||||||||||||||| |||| ||||||||||||||| ||| | || || ||||| | |
Sbjct: 3405 atcatgatggtgaacctaatcgccatcgcggtcgggtttagcaggacgatatacagtgtg 3464
Query: 140 atcccgcagtggagcaagctgctgggcggcgtcttcttcagcttctgggtgctggc 195
|| ||||||||||| ||| || | || || || |||||||| |||||||| |||||
Sbjct: 3465 attccgcagtggagtaagttgattggaggagtgttcttcagtttctgggtactggc 3520
>gb|AF360180.1| Arabidopsis thaliana putative cellulose synthase catalytic subunit
(At3g03050) mRNA, complete cds
Length = 3962
Score = 79.8 bits (40), Expect = 5e-013
Identities = 97/116 (83%)
Strand = Plus / Plus
Query: 80 atcatgatggtgaacctgatcggcatcgcggtcgggttcagccgcaccatctacagcgag 139
||||||||||||||||| |||| ||||||||||||||| ||| | || || ||||| | |
Sbjct: 3409 atcatgatggtgaacctaatcgccatcgcggtcgggtttagcaggacgatatacagtgtg 3468
Query: 140 atcccgcagtggagcaagctgctgggcggcgtcttcttcagcttctgggtgctggc 195
|| ||||||||||| ||| || | || || || |||||||| |||||||| |||||
Sbjct: 3469 attccgcagtggagtaagttgattggaggagtgttcttcagtttctgggtactggc 3524
>gb|AY039996.1| Arabidopsis thaliana putative cellulose synthase catalytic subunit
(At3g03050) mRNA, complete cds
Length = 3438
Score = 79.8 bits (40), Expect = 5e-013
Identities = 97/116 (83%)
Strand = Plus / Plus
Query: 80 atcatgatggtgaacctgatcggcatcgcggtcgggttcagccgcaccatctacagcgag 139
||||||||||||||||| |||| ||||||||||||||| ||| | || || ||||| | |
Sbjct: 3157 atcatgatggtgaacctaatcgccatcgcggtcgggtttagcaggacgatatacagtgtg 3216
Query: 140 atcccgcagtggagcaagctgctgggcggcgtcttcttcagcttctgggtgctggc 195
|| ||||||||||| ||| || | || || || |||||||| |||||||| |||||
Sbjct: 3217 attccgcagtggagtaagttgattggaggagtgttcttcagtttctgggtactggc 3272
>emb|AJ297948.1|ATH297948 Arabidopsis thaliana CSLD3 gene for cellulose synthase-like protein,
exons 1-3
Length = 5385
Score = 79.8 bits (40), Expect = 5e-013
Identities = 97/116 (83%)
Strand = Plus / Plus
Query: 80 atcatgatggtgaacctgatcggcatcgcggtcgggttcagccgcaccatctacagcgag 139
||||||||||||||||| |||| ||||||||||||||| ||| | || || ||||| | |
Sbjct: 4681 atcatgatggtgaacctaatcgccatcgcggtcgggtttagcaggacgatatacagtgtg 4740
Query: 140 atcccgcagtggagcaagctgctgggcggcgtcttcttcagcttctgggtgctggc 195
|| ||||||||||| ||| || | || || || |||||||| |||||||| |||||
Sbjct: 4741 attccgcagtggagtaagttgattggaggagtgttcttcagtttctgggtactggc 4796
>gb|AC012328.6|ATAC012328 Arabidopsis thaliana chromosome III BAC T17B22 genomic sequence,
complete sequence
Length = 96540
Score = 79.8 bits (40), Expect = 5e-013
Identities = 97/116 (83%)
Strand = Plus / Minus
Query: 80 atcatgatggtgaacctgatcggcatcgcggtcgggttcagccgcaccatctacagcgag 139
||||||||||||||||| |||| ||||||||||||||| ||| | || || ||||| | |
Sbjct: 89408 atcatgatggtgaacctaatcgccatcgcggtcgggtttagcaggacgatatacagtgtg 89349
Query: 140 atcccgcagtggagcaagctgctgggcggcgtcttcttcagcttctgggtgctggc 195
|| ||||||||||| ||| || | || || || |||||||| |||||||| |||||
Sbjct: 89348 attccgcagtggagtaagttgattggaggagtgttcttcagtttctgggtactggc 89293
>dbj|BA000014.8| Arabidopsis thaliana, chromosome 3, complete sequence
Length = 23403063
Score = 79.8 bits (40), Expect = 5e-013
Identities = 97/116 (83%)
Strand = Plus / Minus
Query: 80 atcatgatggtgaacctgatcggcatcgcggtcgggttcagccgcaccatctacagcgag 139
||||||||||||||||| |||| ||||||||||||||| ||| | || || ||||| | |
Sbjct: 773633 atcatgatggtgaacctaatcgccatcgcggtcgggtttagcaggacgatatacagtgtg 773574
Query: 140 atcccgcagtggagcaagctgctgggcggcgtcttcttcagcttctgggtgctggc 195
|| ||||||||||| ||| || | || || || |||||||| |||||||| |||||
Sbjct: 773573 attccgcagtggagtaagttgattggaggagtgttcttcagtttctgggtactggc 773518
>ref|NM_111175.2| Arabidopsis thaliana CSLD3 (CELLULOSE SYNTHASE-LIKE 3); cellulose
synthase/ transferase, transferring glycosyl groups
AT3G03050 (CSLD3) mRNA, complete cds
Length = 4206
Score = 79.8 bits (40), Expect = 5e-013
Identities = 97/116 (83%)
Strand = Plus / Plus
Query: 80 atcatgatggtgaacctgatcggcatcgcggtcgggttcagccgcaccatctacagcgag 139
||||||||||||||||| |||| ||||||||||||||| ||| | || || ||||| | |
Sbjct: 3656 atcatgatggtgaacctaatcgccatcgcggtcgggtttagcaggacgatatacagtgtg 3715
Query: 140 atcccgcagtggagcaagctgctgggcggcgtcttcttcagcttctgggtgctggc 195
|| ||||||||||| ||| || | || || || |||||||| |||||||| |||||
Sbjct: 3716 attccgcagtggagtaagttgattggaggagtgttcttcagtttctgggtactggc 3771
>ref|NC_003074.4| Arabidopsis thaliana chromosome 3, complete sequence
Length = 23470805
Score = 79.8 bits (40), Expect = 5e-013
Identities = 97/116 (83%)
Strand = Plus / Plus
Query: 80 atcatgatggtgaacctgatcggcatcgcggtcgggttcagccgcaccatctacagcgag 139
||||||||||||||||| |||| ||||||||||||||| ||| | || || ||||| | |
Sbjct: 691355 atcatgatggtgaacctaatcgccatcgcggtcgggtttagcaggacgatatacagtgtg 691414
Query: 140 atcccgcagtggagcaagctgctgggcggcgtcttcttcagcttctgggtgctggc 195
|| ||||||||||| ||| || | || || || |||||||| |||||||| |||||
Sbjct: 691415 attccgcagtggagtaagttgattggaggagtgttcttcagtttctgggtactggc 691470
>gb|AI996738.1|AI996738 701668165 A. thaliana, Columbia Col-0, root-1 Arabidopsis thaliana
cDNA clone 701668165, mRNA sequence
Length = 536
Score = 50.1 bits (25), Expect = 5e-004
Identities = 94/116 (81%), Gaps = 1/116 (0%)
Strand = Plus / Minus
Query: 80 atcatgatggtgaacctgatcggcatcgcggtcgggttcagccgcaccatctacagcgag 139
||||||||||||||||| ||| ||||||||||||||| | | | || || ||||| | |
Sbjct: 508 atcatgatggtgaacctaatc-ccatcgcggtcgggtttaccaggacgatatacagtgtg 450
Query: 140 atcccgcagtggagcaagctgctgggcggcgtcttcttcagcttctgggtgctggc 195
|| ||||||||||| ||| || | || || || ||||| || |||||||| |||||
Sbjct: 449 attccgcagtggagtaagttgattggaggagtgttcttnagtttctgggtactggc 394
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 345,122
Number of Sequences: 1013581
Number of extensions: 345122
Number of successful extensions: 31704
Number of sequences better than 0.5: 15
Number of HSP's better than 0.5 without gapping: 14
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 31267
Number of HSP's gapped (non-prelim): 437
length of query: 635
length of database: 908,940,872
effective HSP length: 20
effective length of query: 615
effective length of database: 888,669,252
effective search space: 546531589980
effective search space used: 546531589980
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)