BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2478084.2.1
(1395 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
emb|AL081339.1|CNS00N19 Arabidopsis thaliana genome survey ... 46 0.016
gb|AV782261.1|AV782261 AV782261 RAFL4 Arabidopsis thaliana ... 46 0.016
gb|AV520681.1|AV520681 AV520681 Arabidopsis thaliana aboveg... 46 0.016
gb|AV524880.1|AV524880 AV524880 Arabidopsis thaliana aboveg... 46 0.016
gb|AV534641.1|AV534641 AV534641 Arabidopsis thaliana flower... 46 0.016
gb|AV538516.1|AV538516 AV538516 Arabidopsis thaliana roots ... 46 0.016
gb|AV538890.1|AV538890 AV538890 Arabidopsis thaliana roots ... 46 0.016
gb|AV540733.1|AV540733 AV540733 Arabidopsis thaliana roots ... 46 0.016
gb|AV544780.1|AV544780 AV544780 Arabidopsis thaliana roots ... 46 0.016
gb|AV555054.1|AV555054 AV555054 Arabidopsis thaliana green ... 46 0.016
gb|BP641359.1|BP641359 BP641359 RAFL19 Arabidopsis thaliana... 46 0.016
gb|BP837459.1|BP837459 BP837459 RAFL19 Arabidopsis thaliana... 46 0.016
emb|AX458729.1| Sequence 1 from Patent WO0246439 46 0.016
emb|AX458730.1| Sequence 2 from Patent WO0246439 46 0.016
gb|AY084652.1| Arabidopsis thaliana clone 114130 mRNA, comp... 46 0.016
emb|BX831467.1|CNS09YSD Arabidopsis thaliana Full-length cD... 46 0.016
emb|BX830698.1|CNS0A0OD Arabidopsis thaliana Full-length cD... 46 0.016
emb|BX830912.1|CNS0A0QI Arabidopsis thaliana Full-length cD... 46 0.016
emb|BX832778.1|CNS0A0MK Arabidopsis thaliana Full-length cD... 46 0.016
emb|BX832315.1|CNS0A108 Arabidopsis thaliana Full-length cD... 46 0.016
emb|BX830476.1|CNS0A1DG Arabidopsis thaliana Full-length cD... 46 0.016
dbj|AB017061.1| Arabidopsis thaliana genomic DNA, chromosom... 46 0.016
dbj|BA000015.5| Arabidopsis thaliana DNA, chromosome 5, com... 46 0.016
ref|NM_124270.2| Arabidopsis thaliana transferase AT5G48930... 46 0.016
ref|NC_003076.4| Arabidopsis thaliana chromosome 5, complet... 46 0.016
>emb|AL081339.1|CNS00N19 Arabidopsis thaliana genome survey sequence SP6 end of BAC F2M22 of
IGF library from strain Columbia of Arabidopsis
thaliana, genomic survey sequence
Length = 479
Score = 46.1 bits (23), Expect = 0.016
Identities = 47/55 (85%)
Strand = Plus / Plus
Query: 509 ccgcggaccagcgccgacaggtccggctgcagctccaggtagtccagcgctgacc 563
|||||||| || || ||||| || ||||||| |||||||||||| || |||||||
Sbjct: 108 ccgcggacaagggctgacagatcaggctgcatctccaggtagtcaagagctgacc 162
>gb|AV782261.1|AV782261 AV782261 RAFL4 Arabidopsis thaliana cDNA clone RAFL04-15-L12 3',
mRNA sequence
Length = 681
Score = 46.1 bits (23), Expect = 0.016
Identities = 47/55 (85%)
Strand = Plus / Plus
Query: 509 ccgcggaccagcgccgacaggtccggctgcagctccaggtagtccagcgctgacc 563
|||||||| || || ||||| || ||||||| |||||||||||| || |||||||
Sbjct: 506 ccgcggacaagggctgacagatcaggctgcatctccaggtagtcaagagctgacc 560
>gb|AV520681.1|AV520681 AV520681 Arabidopsis thaliana aboveground organs two to six-week
old Arabidopsis thaliana cDNA clone APZ28e05F 3', mRNA
sequence
Length = 628
Score = 46.1 bits (23), Expect = 0.016
Identities = 47/55 (85%)
Strand = Plus / Plus
Query: 509 ccgcggaccagcgccgacaggtccggctgcagctccaggtagtccagcgctgacc 563
|||||||| || || ||||| || ||||||| |||||||||||| || |||||||
Sbjct: 378 ccgcggacaagggctgacagatcaggctgcatctccaggtagtcaagagctgacc 432
>gb|AV524880.1|AV524880 AV524880 Arabidopsis thaliana aboveground organs two to six-week
old Arabidopsis thaliana cDNA clone APD12b08R 5', mRNA
sequence
Length = 528
Score = 46.1 bits (23), Expect = 0.016
Identities = 47/55 (85%)
Strand = Plus / Plus
Query: 509 ccgcggaccagcgccgacaggtccggctgcagctccaggtagtccagcgctgacc 563
|||||||| || || ||||| || ||||||| |||||||||||| || |||||||
Sbjct: 356 ccgcggacaagggctgacagatcaggctgcatctccaggtagtcaagagctgacc 410
>gb|AV534641.1|AV534641 AV534641 Arabidopsis thaliana flower buds Columbia Arabidopsis
thaliana cDNA clone FB083e07F 3', mRNA sequence
Length = 502
Score = 46.1 bits (23), Expect = 0.016
Identities = 47/55 (85%)
Strand = Plus / Plus
Query: 509 ccgcggaccagcgccgacaggtccggctgcagctccaggtagtccagcgctgacc 563
|||||||| || || ||||| || ||||||| |||||||||||| || |||||||
Sbjct: 411 ccgcggacaagggctgacagatcaggctgcatctccaggtagtcaagagctgacc 465
>gb|AV538516.1|AV538516 AV538516 Arabidopsis thaliana roots Columbia Arabidopsis thaliana
cDNA clone RZ117h01F 3', mRNA sequence
Length = 599
Score = 46.1 bits (23), Expect = 0.016
Identities = 47/55 (85%)
Strand = Plus / Plus
Query: 509 ccgcggaccagcgccgacaggtccggctgcagctccaggtagtccagcgctgacc 563
|||||||| || || ||||| || ||||||| |||||||||||| || |||||||
Sbjct: 474 ccgcggacaagggctgacagatcaggctgcatctccaggtagtcaagagctgacc 528
>gb|AV538890.1|AV538890 AV538890 Arabidopsis thaliana roots Columbia Arabidopsis thaliana
cDNA clone RZ123d02F 3', mRNA sequence
Length = 551
Score = 46.1 bits (23), Expect = 0.016
Identities = 47/55 (85%)
Strand = Plus / Plus
Query: 509 ccgcggaccagcgccgacaggtccggctgcagctccaggtagtccagcgctgacc 563
|||||||| || || ||||| || ||||||| |||||||||||| || |||||||
Sbjct: 481 ccgcggacaagggctgacagatcaggctgcatctccaggtagtcaagagctgacc 535
>gb|AV540733.1|AV540733 AV540733 Arabidopsis thaliana roots Columbia Arabidopsis thaliana
cDNA clone RZ154c11F 3', mRNA sequence
Length = 581
Score = 46.1 bits (23), Expect = 0.016
Identities = 47/55 (85%)
Strand = Plus / Plus
Query: 509 ccgcggaccagcgccgacaggtccggctgcagctccaggtagtccagcgctgacc 563
|||||||| || || ||||| || ||||||| |||||||||||| || |||||||
Sbjct: 505 ccgcggacaagggctgacagatcaggctgcatctccaggtagtcaagagctgacc 559
>gb|AV544780.1|AV544780 AV544780 Arabidopsis thaliana roots Columbia Arabidopsis thaliana
cDNA clone RZ59b06F 3', mRNA sequence
Length = 651
Score = 46.1 bits (23), Expect = 0.016
Identities = 47/55 (85%)
Strand = Plus / Plus
Query: 509 ccgcggaccagcgccgacaggtccggctgcagctccaggtagtccagcgctgacc 563
|||||||| || || ||||| || ||||||| |||||||||||| || |||||||
Sbjct: 479 ccgcggacaagggctgacagatcaggctgcatctccaggtagtcaagagctgacc 533
>gb|AV555054.1|AV555054 AV555054 Arabidopsis thaliana green siliques Columbia Arabidopsis
thaliana cDNA clone SQ002g05F 3', mRNA sequence
Length = 574
Score = 46.1 bits (23), Expect = 0.016
Identities = 47/55 (85%)
Strand = Plus / Plus
Query: 509 ccgcggaccagcgccgacaggtccggctgcagctccaggtagtccagcgctgacc 563
|||||||| || || ||||| || ||||||| |||||||||||| || |||||||
Sbjct: 436 ccgcggacaagggctgacagatcaggctgcatctccaggtagtcaagagctgacc 490
>gb|BP641359.1|BP641359 BP641359 RAFL19 Arabidopsis thaliana cDNA clone RAFL19-54-P15 3',
mRNA sequence
Length = 461
Score = 46.1 bits (23), Expect = 0.016
Identities = 47/55 (85%)
Strand = Plus / Plus
Query: 509 ccgcggaccagcgccgacaggtccggctgcagctccaggtagtccagcgctgacc 563
|||||||| || || ||||| || ||||||| |||||||||||| || |||||||
Sbjct: 300 ccgcggacaagggctgacagatcaggctgcatctccaggtagtcaagagctgacc 354
>gb|BP837459.1|BP837459 BP837459 RAFL19 Arabidopsis thaliana cDNA clone RAFL22-20-M06 5',
mRNA sequence
Length = 404
Score = 46.1 bits (23), Expect = 0.016
Identities = 29/31 (93%)
Strand = Plus / Minus
Query: 533 ggctgcagctccaggtagtccagcgctgacc 563
||||||| ||||||||||||||| |||||||
Sbjct: 359 ggctgcatctccaggtagtccagagctgacc 329
>emb|AX458729.1| Sequence 1 from Patent WO0246439
Length = 7438
Score = 46.1 bits (23), Expect = 0.016
Identities = 47/55 (85%)
Strand = Plus / Plus
Query: 509 ccgcggaccagcgccgacaggtccggctgcagctccaggtagtccagcgctgacc 563
|||||||| || || ||||| || ||||||| |||||||||||| || |||||||
Sbjct: 580 ccgcggacaagggctgacagatcaggctgcatctccaggtagtcaagagctgacc 634
>emb|AX458730.1| Sequence 2 from Patent WO0246439
Length = 3499
Score = 46.1 bits (23), Expect = 0.016
Identities = 47/55 (85%)
Strand = Plus / Plus
Query: 509 ccgcggaccagcgccgacaggtccggctgcagctccaggtagtccagcgctgacc 563
|||||||| || || ||||| || ||||||| |||||||||||| || |||||||
Sbjct: 580 ccgcggacaagggctgacagatcaggctgcatctccaggtagtcaagagctgacc 634
>gb|AY084652.1| Arabidopsis thaliana clone 114130 mRNA, complete sequence
Length = 1596
Score = 46.1 bits (23), Expect = 0.016
Identities = 47/55 (85%)
Strand = Plus / Minus
Query: 509 ccgcggaccagcgccgacaggtccggctgcagctccaggtagtccagcgctgacc 563
|||||||| || || ||||| || ||||||| |||||||||||| || |||||||
Sbjct: 1122 ccgcggacaagggctgacagatcaggctgcatctccaggtagtcaagagctgacc 1068
>emb|BX831467.1|CNS09YSD Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTLS93ZH08 of Adult vegetative tissue of strain col-0
of Arabidopsis thaliana (thale cress)
Length = 1601
Score = 46.1 bits (23), Expect = 0.016
Identities = 47/55 (85%)
Strand = Plus / Minus
Query: 509 ccgcggaccagcgccgacaggtccggctgcagctccaggtagtccagcgctgacc 563
|||||||| || || ||||| || ||||||| |||||||||||| || |||||||
Sbjct: 1105 ccgcggacaagggctgacagatcaggctgcatctccaggtagtcaagagctgacc 1051
>emb|BX830698.1|CNS0A0OD Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTLS15ZE08 of Adult vegetative tissue of strain col-0
of Arabidopsis thaliana (thale cress)
Length = 1508
Score = 46.1 bits (23), Expect = 0.016
Identities = 47/55 (85%)
Strand = Plus / Minus
Query: 509 ccgcggaccagcgccgacaggtccggctgcagctccaggtagtccagcgctgacc 563
|||||||| || || ||||| || ||||||| |||||||||||| || |||||||
Sbjct: 1101 ccgcggacaagggctgacagatcaggctgcatctccaggtagtcaagagctgacc 1047
>emb|BX830912.1|CNS0A0QI Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTLS39ZB07 of Adult vegetative tissue of strain col-0
of Arabidopsis thaliana (thale cress)
Length = 1525
Score = 46.1 bits (23), Expect = 0.016
Identities = 47/55 (85%)
Strand = Plus / Minus
Query: 509 ccgcggaccagcgccgacaggtccggctgcagctccaggtagtccagcgctgacc 563
|||||||| || || ||||| || ||||||| |||||||||||| || |||||||
Sbjct: 1102 ccgcggacaagggctgacagatcaggctgcatctccaggtagtcaagagctgacc 1048
>emb|BX832778.1|CNS0A0MK Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTSIL10ZG04 of Silique of strain col-0 of Arabidopsis
thaliana (thale cress)
Length = 1443
Score = 46.1 bits (23), Expect = 0.016
Identities = 47/55 (85%)
Strand = Plus / Minus
Query: 509 ccgcggaccagcgccgacaggtccggctgcagctccaggtagtccagcgctgacc 563
|||||||| || || ||||| || ||||||| |||||||||||| || |||||||
Sbjct: 1107 ccgcggacaagggctgacagatcaggctgcatctccaggtagtcaagagctgacc 1053
>emb|BX832315.1|CNS0A108 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTPGH64ZH06 of Hormone Treated Callus of strain col-0
of Arabidopsis thaliana (thale cress)
Length = 1428
Score = 46.1 bits (23), Expect = 0.016
Identities = 47/55 (85%)
Strand = Plus / Minus
Query: 509 ccgcggaccagcgccgacaggtccggctgcagctccaggtagtccagcgctgacc 563
|||||||| || || ||||| || ||||||| |||||||||||| || |||||||
Sbjct: 1083 ccgcggacaagggctgacagatcaggctgcatctccaggtagtcaagagctgacc 1029
>emb|BX830476.1|CNS0A1DG Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTFB84ZE02 of Flowers and buds of strain col-0 of
Arabidopsis thaliana (thale cress)
Length = 1571
Score = 46.1 bits (23), Expect = 0.016
Identities = 47/55 (85%)
Strand = Plus / Minus
Query: 509 ccgcggaccagcgccgacaggtccggctgcagctccaggtagtccagcgctgacc 563
|||||||| || || ||||| || ||||||| |||||||||||| || |||||||
Sbjct: 1104 ccgcggacaagggctgacagatcaggctgcatctccaggtagtcaagagctgacc 1050
>dbj|AB017061.1| Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K19E20
Length = 61712
Score = 46.1 bits (23), Expect = 0.016
Identities = 47/55 (85%)
Strand = Plus / Plus
Query: 509 ccgcggaccagcgccgacaggtccggctgcagctccaggtagtccagcgctgacc 563
|||||||| || || ||||| || ||||||| |||||||||||| || |||||||
Sbjct: 12950 ccgcggacaagggctgacagatcaggctgcatctccaggtagtcaagagctgacc 13004
>dbj|BA000015.5| Arabidopsis thaliana DNA, chromosome 5, complete sequence
Length = 23810767
Score = 46.1 bits (23), Expect = 0.016
Identities = 47/55 (85%)
Strand = Plus / Plus
Query: 509 ccgcggaccagcgccgacaggtccggctgcagctccaggtagtccagcgctgacc 563
|||||||| || || ||||| || ||||||| |||||||||||| || |||||||
Sbjct: 17897013 ccgcggacaagggctgacagatcaggctgcatctccaggtagtcaagagctgacc 17897067
>ref|NM_124270.2| Arabidopsis thaliana transferase AT5G48930 mRNA, complete cds
Length = 1710
Score = 46.1 bits (23), Expect = 0.016
Identities = 47/55 (85%)
Strand = Plus / Minus
Query: 509 ccgcggaccagcgccgacaggtccggctgcagctccaggtagtccagcgctgacc 563
|||||||| || || ||||| || ||||||| |||||||||||| || |||||||
Sbjct: 1123 ccgcggacaagggctgacagatcaggctgcatctccaggtagtcaagagctgacc 1069
>ref|NC_003076.4| Arabidopsis thaliana chromosome 5, complete sequence
Length = 26992728
Score = 46.1 bits (23), Expect = 0.016
Identities = 47/55 (85%)
Strand = Plus / Plus
Query: 509 ccgcggaccagcgccgacaggtccggctgcagctccaggtagtccagcgctgacc 563
|||||||| || || ||||| || ||||||| |||||||||||| || |||||||
Sbjct: 19854112 ccgcggacaagggctgacagatcaggctgcatctccaggtagtcaagagctgacc 19854166
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 350,855
Number of Sequences: 1013581
Number of extensions: 350855
Number of successful extensions: 25320
Number of sequences better than 0.5: 25
Number of HSP's better than 0.5 without gapping: 25
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 25022
Number of HSP's gapped (non-prelim): 298
length of query: 1395
length of database: 908,940,872
effective HSP length: 21
effective length of query: 1374
effective length of database: 887,655,671
effective search space: 1219638891954
effective search space used: 1219638891954
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)