BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 2440958.2.1
         (791 letters)

Database: At_nucl_with_EST.fasta 
           1,013,581 sequences; 908,940,872 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|AC007167.5|  Arabidopsis thaliana chromosome 2 clone F3C1...    42   0.14 
ref|NC_003071.3|  Arabidopsis thaliana chromosome 2, complet...    42   0.14 

>gb|AC007167.5| Arabidopsis thaliana chromosome 2 clone F3C11 map mi310, complete
             sequence
          Length = 103874

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 713   tatatatatcatataaataaatatt 737
             ||||||||| |||||||||||||||
Sbjct: 88465 tatatatattatataaataaatatt 88489



>ref|NC_003071.3| Arabidopsis thaliana chromosome 2, complete sequence
          Length = 19705359

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 713     tatatatatcatataaataaatatt 737
               ||||||||| |||||||||||||||
Sbjct: 1279442 tatatatattatataaataaatatt 1279466



  Database: At_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:09 PM
  Number of letters in database: 908,940,872
  Number of sequences in database:  1,013,581
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 357,811
Number of Sequences: 1013581
Number of extensions: 357811
Number of successful extensions: 28943
Number of sequences better than  0.5: 2
Number of HSP's better than  0.5 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 28711
Number of HSP's gapped (non-prelim): 232
length of query: 791
length of database: 908,940,872
effective HSP length: 20
effective length of query: 771
effective length of database: 888,669,252
effective search space: 685163993292
effective search space used: 685163993292
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)