BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 2419137.2.4
         (591 letters)

Database: At_nucl_with_EST.fasta 
           1,013,581 sequences; 908,940,872 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

emb|AJ270060.1|  Arabidopsis thaliana DNA chromosome 4, long...    42   0.11 
emb|AL033545.2|ATF7K2  Arabidopsis thaliana DNA chromosome 4...    42   0.11 
emb|AL161557.2|ATCHRIV57  Arabidopsis thaliana DNA chromosom...    42   0.11 
ref|NM_118372.1|  Arabidopsis thaliana lipid binding AT4G224...    42   0.11 
ref|NC_003075.3|  Arabidopsis thaliana chromosome 4, complet...    42   0.11 
gb|BH235921.1|BH235921  ATZKF88TF ATZK Arabidopsis thaliana ...    40   0.42 
gb|BH236121.1|BH236121  ATZKE18TR ATZK Arabidopsis thaliana ...    40   0.42 

>emb|AJ270060.1| Arabidopsis thaliana DNA chromosome 4, long arm
          Length = 14497843

 Score = 42.1 bits (21), Expect = 0.11
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                                
Query: 198     gctgaggttgatgggcaggttgaggttgatgcc 230
               ||||||||||||||| ||| | |||||||||||
Sbjct: 7751982 gctgaggttgatgggaagggtaaggttgatgcc 7752014



>emb|AL033545.2|ATF7K2 Arabidopsis thaliana DNA chromosome 4, BAC clone F7K2 (ESSA project)
          Length = 106702

 Score = 42.1 bits (21), Expect = 0.11
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                              
Query: 198   gctgaggttgatgggcaggttgaggttgatgcc 230
             ||||||||||||||| ||| | |||||||||||
Sbjct: 27113 gctgaggttgatgggaagggtaaggttgatgcc 27145



>emb|AL161557.2|ATCHRIV57 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 57
          Length = 199577

 Score = 42.1 bits (21), Expect = 0.11
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                              
Query: 198   gctgaggttgatgggcaggttgaggttgatgcc 230
             ||||||||||||||| ||| | |||||||||||
Sbjct: 75921 gctgaggttgatgggaagggtaaggttgatgcc 75953



>ref|NM_118372.1| Arabidopsis thaliana lipid binding AT4G22460 mRNA, complete cds
          Length = 402

 Score = 42.1 bits (21), Expect = 0.11
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 198 gctgaggttgatgggcaggttgaggttgatgcc 230
           ||||||||||||||| ||| | |||||||||||
Sbjct: 348 gctgaggttgatgggaagggtaaggttgatgcc 316



>ref|NC_003075.3| Arabidopsis thaliana chromosome 4, complete sequence
          Length = 18585042

 Score = 42.1 bits (21), Expect = 0.11
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                                 
Query: 198      gctgaggttgatgggcaggttgaggttgatgcc 230
                ||||||||||||||| ||| | |||||||||||
Sbjct: 11839226 gctgaggttgatgggaagggtaaggttgatgcc 11839258



>gb|BH235921.1|BH235921 ATZKF88TF ATZK Arabidopsis thaliana genomic clone ATZKF88, DNA
           sequence
          Length = 736

 Score = 40.1 bits (20), Expect = 0.42
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 464 tgccgccgcctccaccactgctgccgcc 491
           |||||||||| || ||||||||||||||
Sbjct: 52  tgccgccgccgccgccactgctgccgcc 79



>gb|BH236121.1|BH236121 ATZKE18TR ATZK Arabidopsis thaliana genomic clone ATZKE18, DNA
           sequence
          Length = 742

 Score = 40.1 bits (20), Expect = 0.42
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 464 tgccgccgcctccaccactgctgccgcc 491
           |||||||||| || ||||||||||||||
Sbjct: 52  tgccgccgccgccgccactgctgccgcc 25



  Database: At_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:09 PM
  Number of letters in database: 908,940,872
  Number of sequences in database:  1,013,581
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 137,380
Number of Sequences: 1013581
Number of extensions: 137380
Number of successful extensions: 11213
Number of sequences better than  0.5: 7
Number of HSP's better than  0.5 without gapping: 7
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 11047
Number of HSP's gapped (non-prelim): 166
length of query: 591
length of database: 908,940,872
effective HSP length: 20
effective length of query: 571
effective length of database: 888,669,252
effective search space: 507430142892
effective search space used: 507430142892
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)