BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2405117.2.2
(800 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CC798462.1|CC798462 SALK_146381.42.40.x Arabidopsis thal... 44 0.037
gb|CL482268.1|CL482268 SAIL_358_F09.v1 SAIL Collection Arab... 44 0.037
gb|N37583.1|N37583 18810 Lambda-PRL2 Arabidopsis thaliana c... 44 0.037
gb|AF370621.1|AF370621 Arabidopsis thaliana xylglucan endo-... 44 0.037
emb|AX507453.1| Sequence 2148 from Patent WO0216655 44 0.037
gb|AC004512.2|T8F5 Arabidopsis thaliana chromosome 1 BAC T8... 44 0.037
gb|AE005173.1| Arabidopsis thaliana chromosome 1, bottom ar... 44 0.037
ref|NM_105205.2| Arabidopsis thaliana ATXTH17; hydrolase, a... 44 0.037
ref|NC_003070.5| Arabidopsis thaliana chromosome 1, complet... 44 0.037
gb|CL479436.1|CL479436 SAIL_306_D12.v1 SAIL Collection Arab... 42 0.14
>gb|CC798462.1|CC798462 SALK_146381.42.40.x Arabidopsis thaliana TDNA insertion lines
Arabidopsis thaliana genomic clone SALK_146381.42.40.x,
DNA sequence
Length = 200
Score = 44.1 bits (22), Expect = 0.037
Identities = 25/26 (96%)
Strand = Plus / Minus
Query: 331 tacatgatctacaactactgcaccga 356
||||||||||||||||| ||||||||
Sbjct: 131 tacatgatctacaactattgcaccga 106
>gb|CL482268.1|CL482268 SAIL_358_F09.v1 SAIL Collection Arabidopsis thaliana genomic clone
SAIL_358_F09.v1, DNA sequence
Length = 975
Score = 44.1 bits (22), Expect = 0.037
Identities = 28/30 (93%)
Strand = Plus / Plus
Query: 236 ccggcgcccccgcctccgccgccggcgccg 265
|||||||||||||| ||||||||| |||||
Sbjct: 903 ccggcgcccccgccgccgccgccgccgccg 932
>gb|N37583.1|N37583 18810 Lambda-PRL2 Arabidopsis thaliana cDNA clone 206L9T7 3', mRNA
sequence
Length = 570
Score = 44.1 bits (22), Expect = 0.037
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 331 tacatgatctacaactactgcaccga 356
||||||||||||||||| ||||||||
Sbjct: 248 tacatgatctacaactattgcaccga 273
>gb|AF370621.1|AF370621 Arabidopsis thaliana xylglucan endo-transglycolsylase-like protein
(T8F5.9) mRNA, complete cds
Length = 849
Score = 44.1 bits (22), Expect = 0.037
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 331 tacatgatctacaactactgcaccga 356
||||||||||||||||| ||||||||
Sbjct: 781 tacatgatctacaactattgcaccga 806
>emb|AX507453.1| Sequence 2148 from Patent WO0216655
Length = 849
Score = 44.1 bits (22), Expect = 0.037
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 331 tacatgatctacaactactgcaccga 356
||||||||||||||||| ||||||||
Sbjct: 781 tacatgatctacaactattgcaccga 806
>gb|AC004512.2|T8F5 Arabidopsis thaliana chromosome 1 BAC T8F5 sequence, complete sequence
Length = 88292
Score = 44.1 bits (22), Expect = 0.037
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 331 tacatgatctacaactactgcaccga 356
||||||||||||||||| ||||||||
Sbjct: 24313 tacatgatctacaactattgcaccga 24338
>gb|AE005173.1| Arabidopsis thaliana chromosome 1, bottom arm complete sequence
Length = 14668883
Score = 44.1 bits (22), Expect = 0.037
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 331 tacatgatctacaactactgcaccga 356
||||||||||||||||| ||||||||
Sbjct: 8499566 tacatgatctacaactattgcaccga 8499591
>ref|NM_105205.2| Arabidopsis thaliana ATXTH17; hydrolase, acting on glycosyl bonds /
hydrolase, hydrolyzing O-glycosyl compounds AT1G65310
(ATXTH17) mRNA, complete cds
Length = 1003
Score = 44.1 bits (22), Expect = 0.037
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 331 tacatgatctacaactactgcaccga 356
||||||||||||||||| ||||||||
Sbjct: 781 tacatgatctacaactattgcaccga 806
>ref|NC_003070.5| Arabidopsis thaliana chromosome 1, complete sequence
Length = 30432563
Score = 44.1 bits (22), Expect = 0.037
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 331 tacatgatctacaactactgcaccga 356
||||||||||||||||| ||||||||
Sbjct: 24261914 tacatgatctacaactattgcaccga 24261939
>gb|CL479436.1|CL479436 SAIL_306_D12.v1 SAIL Collection Arabidopsis thaliana genomic clone
SAIL_306_D12.v1, DNA sequence
Length = 952
Score = 42.1 bits (21), Expect = 0.14
Identities = 24/25 (96%)
Strand = Plus / Minus
Query: 242 cccccgcctccgccgccggcgccgg 266
|||||||||||||||| ||||||||
Sbjct: 740 cccccgcctccgccgcgggcgccgg 716
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 188,361
Number of Sequences: 1013581
Number of extensions: 188361
Number of successful extensions: 14347
Number of sequences better than 0.5: 10
Number of HSP's better than 0.5 without gapping: 10
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 14207
Number of HSP's gapped (non-prelim): 140
length of query: 800
length of database: 908,940,872
effective HSP length: 20
effective length of query: 780
effective length of database: 888,669,252
effective search space: 693162016560
effective search space used: 693162016560
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)