BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2404725.2.2
(910 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AV797263.1|AV797263 AV797263 RAFL9 Arabidopsis thaliana ... 46 0.011
gb|AV530346.1|AV530346 AV530346 Arabidopsis thaliana flower... 46 0.011
gb|AV535618.1|AV535618 AV535618 Arabidopsis thaliana flower... 46 0.011
gb|BP639266.1|BP639266 BP639266 RAFL19 Arabidopsis thaliana... 46 0.011
gb|AF367325.1| Arabidopsis thaliana At1g55570/T5A14_1 mRNA,... 46 0.011
gb|AY133602.1| Arabidopsis thaliana At1g55570/T5A14_1 mRNA,... 46 0.011
gb|AC005223.1| Arabidopsis thaliana chromosome I BAC T5A14,... 46 0.011
gb|AE005173.1| Arabidopsis thaliana chromosome 1, bottom ar... 46 0.011
ref|NM_104433.2| Arabidopsis thaliana SKS12; copper ion bin... 46 0.011
ref|NC_003070.5| Arabidopsis thaliana chromosome 1, complet... 46 0.011
>gb|AV797263.1|AV797263 AV797263 RAFL9 Arabidopsis thaliana cDNA clone RAFL09-11-G24 3',
mRNA sequence
Length = 428
Score = 46.1 bits (23), Expect = 0.011
Identities = 29/31 (93%)
Strand = Plus / Plus
Query: 423 aggctggtctccggcatgttgtactcgtccc 453
||||| ||||||||||||||||| |||||||
Sbjct: 361 aggcttgtctccggcatgttgtattcgtccc 391
>gb|AV530346.1|AV530346 AV530346 Arabidopsis thaliana flower buds Columbia Arabidopsis
thaliana cDNA clone FB002b10F 3', mRNA sequence
Length = 314
Score = 46.1 bits (23), Expect = 0.011
Identities = 29/31 (93%)
Strand = Plus / Plus
Query: 423 aggctggtctccggcatgttgtactcgtccc 453
||||| ||||||||||||||||| |||||||
Sbjct: 269 aggcttgtctccggcatgttgtattcgtccc 299
>gb|AV535618.1|AV535618 AV535618 Arabidopsis thaliana flower buds Columbia Arabidopsis
thaliana cDNA clone FB099c04F 3', mRNA sequence
Length = 284
Score = 46.1 bits (23), Expect = 0.011
Identities = 29/31 (93%)
Strand = Plus / Plus
Query: 423 aggctggtctccggcatgttgtactcgtccc 453
||||| ||||||||||||||||| |||||||
Sbjct: 243 aggcttgtctccggcatgttgtattcgtccc 273
>gb|BP639266.1|BP639266 BP639266 RAFL19 Arabidopsis thaliana cDNA clone RAFL19-47-C23 3',
mRNA sequence
Length = 367
Score = 46.1 bits (23), Expect = 0.011
Identities = 29/31 (93%)
Strand = Plus / Plus
Query: 423 aggctggtctccggcatgttgtactcgtccc 453
||||| ||||||||||||||||| |||||||
Sbjct: 252 aggcttgtctccggcatgttgtattcgtccc 282
>gb|AF367325.1| Arabidopsis thaliana At1g55570/T5A14_1 mRNA, complete cds
Length = 2088
Score = 46.1 bits (23), Expect = 0.011
Identities = 29/31 (93%)
Strand = Plus / Minus
Query: 423 aggctggtctccggcatgttgtactcgtccc 453
||||| ||||||||||||||||| |||||||
Sbjct: 1728 aggcttgtctccggcatgttgtattcgtccc 1698
>gb|AY133602.1| Arabidopsis thaliana At1g55570/T5A14_1 mRNA, complete cds
Length = 1668
Score = 46.1 bits (23), Expect = 0.011
Identities = 29/31 (93%)
Strand = Plus / Minus
Query: 423 aggctggtctccggcatgttgtactcgtccc 453
||||| ||||||||||||||||| |||||||
Sbjct: 1613 aggcttgtctccggcatgttgtattcgtccc 1583
>gb|AC005223.1| Arabidopsis thaliana chromosome I BAC T5A14, complete sequence
Length = 87967
Score = 46.1 bits (23), Expect = 0.011
Identities = 29/31 (93%)
Strand = Plus / Plus
Query: 423 aggctggtctccggcatgttgtactcgtccc 453
||||| ||||||||||||||||| |||||||
Sbjct: 11220 aggcttgtctccggcatgttgtattcgtccc 11250
>gb|AE005173.1| Arabidopsis thaliana chromosome 1, bottom arm complete sequence
Length = 14668883
Score = 46.1 bits (23), Expect = 0.011
Identities = 29/31 (93%)
Strand = Plus / Minus
Query: 423 aggctggtctccggcatgttgtactcgtccc 453
||||| ||||||||||||||||| |||||||
Sbjct: 5119148 aggcttgtctccggcatgttgtattcgtccc 5119118
>ref|NM_104433.2| Arabidopsis thaliana SKS12; copper ion binding AT1G55570 (SKS12)
mRNA, complete cds
Length = 2083
Score = 46.1 bits (23), Expect = 0.011
Identities = 29/31 (93%)
Strand = Plus / Minus
Query: 423 aggctggtctccggcatgttgtactcgtccc 453
||||| ||||||||||||||||| |||||||
Sbjct: 1723 aggcttgtctccggcatgttgtattcgtccc 1693
>ref|NC_003070.5| Arabidopsis thaliana chromosome 1, complete sequence
Length = 30432563
Score = 46.1 bits (23), Expect = 0.011
Identities = 29/31 (93%)
Strand = Plus / Minus
Query: 423 aggctggtctccggcatgttgtactcgtccc 453
||||| ||||||||||||||||| |||||||
Sbjct: 20763382 aggcttgtctccggcatgttgtattcgtccc 20763352
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 272,948
Number of Sequences: 1013581
Number of extensions: 272948
Number of successful extensions: 18521
Number of sequences better than 0.5: 10
Number of HSP's better than 0.5 without gapping: 10
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 18295
Number of HSP's gapped (non-prelim): 226
length of query: 910
length of database: 908,940,872
effective HSP length: 20
effective length of query: 890
effective length of database: 888,669,252
effective search space: 790915634280
effective search space used: 790915634280
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)