BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2276562.2.1
(1286 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BU636029.1|BU636029 044F02 Infected Arabidopsis Leaf Ara... 52 2e-004
gb|AV543709.1|AV543709 AV543709 Arabidopsis thaliana roots ... 52 2e-004
gb|AV550611.1|AV550611 AV550611 Arabidopsis thaliana roots ... 52 2e-004
gb|AV551133.1|AV551133 AV551133 Arabidopsis thaliana roots ... 52 2e-004
gb|AV551178.1|AV551178 AV551178 Arabidopsis thaliana roots ... 52 2e-004
gb|AV552015.1|AV552015 AV552015 Arabidopsis thaliana roots ... 52 2e-004
gb|BP562196.2|BP562196 BP562196 RAFL9 Arabidopsis thaliana ... 52 2e-004
gb|BP797312.1|BP797312 BP797312 RAFL14 Arabidopsis thaliana... 52 2e-004
gb|BP797704.1|BP797704 BP797704 RAFL14 Arabidopsis thaliana... 52 2e-004
gb|BP798396.1|BP798396 BP798396 RAFL14 Arabidopsis thaliana... 52 2e-004
gb|BP799214.1|BP799214 BP799214 RAFL14 Arabidopsis thaliana... 52 2e-004
gb|BP800826.1|BP800826 BP800826 RAFL14 Arabidopsis thaliana... 52 2e-004
gb|BP805301.1|BP805301 BP805301 RAFL16 Arabidopsis thaliana... 52 2e-004
gb|BP855457.1|BP855457 BP855457 RAFL21 Arabidopsis thaliana... 52 2e-004
gb|BP862180.1|BP862180 BP862180 RAFL21 Arabidopsis thaliana... 52 2e-004
gb|BP866405.1|BP866405 BP866405 RAFL21 Arabidopsis thaliana... 52 2e-004
gb|Z25968.1|Z25968 ATTS1245 Versailles-VB Arabidopsis thali... 52 2e-004
gb|AF083914.1|AF083914 Arabidopsis thaliana annexin (AnnAt2... 52 2e-004
gb|AY070400.1| Arabidopsis thaliana putative annexin protei... 52 2e-004
gb|AY096577.1| Arabidopsis thaliana putative annexin (At5g6... 52 2e-004
gb|AY085713.1| Arabidopsis thaliana clone 1728 mRNA, comple... 52 2e-004
emb|BX829662.1|CNS09ZXW Arabidopsis thaliana Full-length cD... 52 2e-004
emb|BX829954.1|CNS0A081 Arabidopsis thaliana Full-length cD... 52 2e-004
emb|BX829955.1|CNS0A082 Arabidopsis thaliana Full-length cD... 52 2e-004
emb|CQ806274.1| Sequence 2685 from Patent WO2004035798 52 2e-004
ref|NM_125901.2| Arabidopsis thaliana ANNAT2; calcium ion b... 52 2e-004
gb|AA712138.1|AA712138 31866 Lambda-PRL2 Arabidopsis thalia... 48 0.004
emb|BX832444.1|CNS09ZP4 Arabidopsis thaliana Full-length cD... 46 0.015
gb|BP800932.1|BP800932 BP800932 RAFL14 Arabidopsis thaliana... 44 0.059
gb|BP807759.1|BP807759 BP807759 RAFL16 Arabidopsis thaliana... 44 0.059
gb|BP811861.1|BP811861 BP811861 RAFL19 Arabidopsis thaliana... 44 0.059
gb|AY014798.1| Arabidopsis thaliana calcium-binding protein... 44 0.059
emb|BX832714.1|CNS09ZK9 Arabidopsis thaliana Full-length cD... 44 0.059
dbj|AB019236.1| Arabidopsis thaliana genomic DNA, chromosom... 44 0.059
dbj|AK175572.1| Arabidopsis thaliana mRNA for annexin -like... 44 0.059
dbj|AK175641.1| Arabidopsis thaliana mRNA for annexin -like... 44 0.059
dbj|AK175892.1| Arabidopsis thaliana mRNA for annexin -like... 44 0.059
dbj|BA000015.5| Arabidopsis thaliana DNA, chromosome 5, com... 44 0.059
emb|AL356332.1|ATT31P16 Arabidopsis thaliana DNA chromosome... 44 0.059
emb|AL360334.1|ATF18D22 Arabidopsis thaliana DNA chromosome... 44 0.059
ref|NM_121060.2| Arabidopsis thaliana ANN6 (annexin 6); cal... 44 0.059
ref|NC_003076.4| Arabidopsis thaliana chromosome 5, complet... 44 0.059
>gb|BU636029.1|BU636029 044F02 Infected Arabidopsis Leaf Arabidopsis thaliana cDNA, mRNA
sequence
Length = 758
Score = 52.0 bits (26), Expect = 2e-004
Identities = 47/54 (87%)
Strand = Plus / Minus
Query: 1049 atgatcagcttctcgttggtgccccaaccttcgaaggccttgtggagctgctcg 1102
|||||||||||||||||||| ||||| ||| || ||||||||||| ||||||
Sbjct: 182 atgatcagcttctcgttggtaccccatcctgaaaaagccttgtggagttgctcg 129
>gb|AV543709.1|AV543709 AV543709 Arabidopsis thaliana roots Columbia Arabidopsis thaliana
cDNA clone RZ205h11F 3', mRNA sequence
Length = 400
Score = 52.0 bits (26), Expect = 2e-004
Identities = 47/54 (87%)
Strand = Plus / Minus
Query: 1049 atgatcagcttctcgttggtgccccaaccttcgaaggccttgtggagctgctcg 1102
|||||||||||||||||||| ||||| ||| || ||||||||||| ||||||
Sbjct: 144 atgatcagcttctcgttggtaccccatcctgaaaaagccttgtggagttgctcg 91
>gb|AV550611.1|AV550611 AV550611 Arabidopsis thaliana roots Columbia Arabidopsis thaliana
cDNA clone RZ114h08R 5', mRNA sequence
Length = 257
Score = 52.0 bits (26), Expect = 2e-004
Identities = 47/54 (87%)
Strand = Plus / Minus
Query: 1049 atgatcagcttctcgttggtgccccaaccttcgaaggccttgtggagctgctcg 1102
|||||||||||||||||||| ||||| ||| || ||||||||||| ||||||
Sbjct: 86 atgatcagcttctcgttggtaccccatcctgaaaaagccttgtggagttgctcg 33
>gb|AV551133.1|AV551133 AV551133 Arabidopsis thaliana roots Columbia Arabidopsis thaliana
cDNA clone RZ121f07R 5', mRNA sequence
Length = 268
Score = 52.0 bits (26), Expect = 2e-004
Identities = 47/54 (87%)
Strand = Plus / Minus
Query: 1049 atgatcagcttctcgttggtgccccaaccttcgaaggccttgtggagctgctcg 1102
|||||||||||||||||||| ||||| ||| || ||||||||||| ||||||
Sbjct: 109 atgatcagcttctcgttggtaccccatcctgaaaaagccttgtggagttgctcg 56
>gb|AV551178.1|AV551178 AV551178 Arabidopsis thaliana roots Columbia Arabidopsis thaliana
cDNA clone RZ122c07R 5', mRNA sequence
Length = 566
Score = 52.0 bits (26), Expect = 2e-004
Identities = 47/54 (87%)
Strand = Plus / Minus
Query: 1049 atgatcagcttctcgttggtgccccaaccttcgaaggccttgtggagctgctcg 1102
|||||||||||||||||||| ||||| ||| || ||||||||||| ||||||
Sbjct: 127 atgatcagcttctcgttggtaccccatcctgaaaaagccttgtggagttgctcg 74
>gb|AV552015.1|AV552015 AV552015 Arabidopsis thaliana roots Columbia Arabidopsis thaliana
cDNA clone RZ18h08R 5', mRNA sequence
Length = 332
Score = 52.0 bits (26), Expect = 2e-004
Identities = 47/54 (87%)
Strand = Plus / Minus
Query: 1049 atgatcagcttctcgttggtgccccaaccttcgaaggccttgtggagctgctcg 1102
|||||||||||||||||||| ||||| ||| || ||||||||||| ||||||
Sbjct: 137 atgatcagcttctcgttggtaccccatcctgaaaaagccttgtggagttgctcg 84
>gb|BP562196.2|BP562196 BP562196 RAFL9 Arabidopsis thaliana cDNA clone RAFL09-60-I16 5', mRNA
sequence
Length = 250
Score = 52.0 bits (26), Expect = 2e-004
Identities = 47/54 (87%)
Strand = Plus / Minus
Query: 1049 atgatcagcttctcgttggtgccccaaccttcgaaggccttgtggagctgctcg 1102
|||||||||||||||||||| ||||| ||| || ||||||||||| ||||||
Sbjct: 200 atgatcagcttctcgttggtaccccatcctgaaaaagccttgtggagttgctcg 147
>gb|BP797312.1|BP797312 BP797312 RAFL14 Arabidopsis thaliana cDNA clone RAFL23-02-O21 5',
mRNA sequence
Length = 394
Score = 52.0 bits (26), Expect = 2e-004
Identities = 47/54 (87%)
Strand = Plus / Minus
Query: 1049 atgatcagcttctcgttggtgccccaaccttcgaaggccttgtggagctgctcg 1102
|||||||||||||||||||| ||||| ||| || ||||||||||| ||||||
Sbjct: 167 atgatcagcttctcgttggtaccccatcctgaaaaagccttgtggagttgctcg 114
>gb|BP797704.1|BP797704 BP797704 RAFL14 Arabidopsis thaliana cDNA clone RAFL23-04-G16 5',
mRNA sequence
Length = 380
Score = 52.0 bits (26), Expect = 2e-004
Identities = 47/54 (87%)
Strand = Plus / Minus
Query: 1049 atgatcagcttctcgttggtgccccaaccttcgaaggccttgtggagctgctcg 1102
|||||||||||||||||||| ||||| ||| || ||||||||||| ||||||
Sbjct: 166 atgatcagcttctcgttggtaccccatcctgaaaaagccttgtggagttgctcg 113
>gb|BP798396.1|BP798396 BP798396 RAFL14 Arabidopsis thaliana cDNA clone RAFL23-07-C01 5',
mRNA sequence
Length = 401
Score = 52.0 bits (26), Expect = 2e-004
Identities = 47/54 (87%)
Strand = Plus / Minus
Query: 1049 atgatcagcttctcgttggtgccccaaccttcgaaggccttgtggagctgctcg 1102
|||||||||||||||||||| ||||| ||| || ||||||||||| ||||||
Sbjct: 167 atgatcagcttctcgttggtaccccatcctgaaaaagccttgtggagttgctcg 114
>gb|BP799214.1|BP799214 BP799214 RAFL14 Arabidopsis thaliana cDNA clone RAFL23-10-C15 5',
mRNA sequence
Length = 417
Score = 52.0 bits (26), Expect = 2e-004
Identities = 47/54 (87%)
Strand = Plus / Minus
Query: 1049 atgatcagcttctcgttggtgccccaaccttcgaaggccttgtggagctgctcg 1102
|||||||||||||||||||| ||||| ||| || ||||||||||| ||||||
Sbjct: 157 atgatcagcttctcgttggtaccccatcctgaaaaagccttgtggagttgctcg 104
>gb|BP800826.1|BP800826 BP800826 RAFL14 Arabidopsis thaliana cDNA clone RAFL23-16-O09 5',
mRNA sequence
Length = 383
Score = 52.0 bits (26), Expect = 2e-004
Identities = 47/54 (87%)
Strand = Plus / Minus
Query: 1049 atgatcagcttctcgttggtgccccaaccttcgaaggccttgtggagctgctcg 1102
|||||||||||||||||||| ||||| ||| || ||||||||||| ||||||
Sbjct: 167 atgatcagcttctcgttggtaccccatcctgaaaaagccttgtggagttgctcg 114
>gb|BP805301.1|BP805301 BP805301 RAFL16 Arabidopsis thaliana cDNA clone RAFL24-05-G03 5',
mRNA sequence
Length = 415
Score = 52.0 bits (26), Expect = 2e-004
Identities = 47/54 (87%)
Strand = Plus / Minus
Query: 1049 atgatcagcttctcgttggtgccccaaccttcgaaggccttgtggagctgctcg 1102
|||||||||||||||||||| ||||| ||| || ||||||||||| ||||||
Sbjct: 187 atgatcagcttctcgttggtaccccatcctgaaaaagccttgtggagttgctcg 134
>gb|BP855457.1|BP855457 BP855457 RAFL21 Arabidopsis thaliana cDNA clone RAFL25-26-L04 5',
mRNA sequence
Length = 403
Score = 52.0 bits (26), Expect = 2e-004
Identities = 47/54 (87%)
Strand = Plus / Minus
Query: 1049 atgatcagcttctcgttggtgccccaaccttcgaaggccttgtggagctgctcg 1102
|||||||||||||||||||| ||||| ||| || ||||||||||| ||||||
Sbjct: 162 atgatcagcttctcgttggtaccccatcctgaaaaagccttgtggagttgctcg 109
>gb|BP862180.1|BP862180 BP862180 RAFL21 Arabidopsis thaliana cDNA clone RAFL21-61-P06 5',
mRNA sequence
Length = 388
Score = 52.0 bits (26), Expect = 2e-004
Identities = 47/54 (87%)
Strand = Plus / Minus
Query: 1049 atgatcagcttctcgttggtgccccaaccttcgaaggccttgtggagctgctcg 1102
|||||||||||||||||||| ||||| ||| || ||||||||||| ||||||
Sbjct: 157 atgatcagcttctcgttggtaccccatcctgaaaaagccttgtggagttgctcg 104
>gb|BP866405.1|BP866405 BP866405 RAFL21 Arabidopsis thaliana cDNA clone RAFL21-77-K01 5',
mRNA sequence
Length = 382
Score = 52.0 bits (26), Expect = 2e-004
Identities = 47/54 (87%)
Strand = Plus / Minus
Query: 1049 atgatcagcttctcgttggtgccccaaccttcgaaggccttgtggagctgctcg 1102
|||||||||||||||||||| ||||| ||| || ||||||||||| ||||||
Sbjct: 168 atgatcagcttctcgttggtaccccatcctgaaaaagccttgtggagttgctcg 115
>gb|Z25968.1|Z25968 ATTS1245 Versailles-VB Arabidopsis thaliana cDNA clone VBV08-20592
similar to Annexin., mRNA sequence
Length = 359
Score = 52.0 bits (26), Expect = 2e-004
Identities = 47/54 (87%)
Strand = Plus / Minus
Query: 1049 atgatcagcttctcgttggtgccccaaccttcgaaggccttgtggagctgctcg 1102
|||||||||||||||||||| ||||| ||| || ||||||||||| ||||||
Sbjct: 93 atgatcagcttctcgttggtaccccatcctgaaaaagccttgtggagttgctcg 40
>gb|AF083914.1|AF083914 Arabidopsis thaliana annexin (AnnAt2) mRNA, complete cds
Length = 1137
Score = 52.0 bits (26), Expect = 2e-004
Identities = 47/54 (87%)
Strand = Plus / Minus
Query: 1049 atgatcagcttctcgttggtgccccaaccttcgaaggccttgtggagctgctcg 1102
|||||||||||||||||||| ||||| ||| || ||||||||||| ||||||
Sbjct: 161 atgatcagcttctcgttggtaccccatcctgaaaaagccttgtggagttgctcg 108
>gb|AY070400.1| Arabidopsis thaliana putative annexin protein (At5g65020) mRNA,
complete cds
Length = 1230
Score = 52.0 bits (26), Expect = 2e-004
Identities = 47/54 (87%)
Strand = Plus / Minus
Query: 1049 atgatcagcttctcgttggtgccccaaccttcgaaggccttgtggagctgctcg 1102
|||||||||||||||||||| ||||| ||| || ||||||||||| ||||||
Sbjct: 198 atgatcagcttctcgttggtaccccatcctgaaaaagccttgtggagttgctcg 145
>gb|AY096577.1| Arabidopsis thaliana putative annexin (At5g65020) mRNA, complete cds
Length = 985
Score = 52.0 bits (26), Expect = 2e-004
Identities = 47/54 (87%)
Strand = Plus / Minus
Query: 1049 atgatcagcttctcgttggtgccccaaccttcgaaggccttgtggagctgctcg 1102
|||||||||||||||||||| ||||| ||| || ||||||||||| ||||||
Sbjct: 104 atgatcagcttctcgttggtaccccatcctgaaaaagccttgtggagttgctcg 51
>gb|AY085713.1| Arabidopsis thaliana clone 1728 mRNA, complete sequence
Length = 1160
Score = 52.0 bits (26), Expect = 2e-004
Identities = 47/54 (87%)
Strand = Plus / Minus
Query: 1049 atgatcagcttctcgttggtgccccaaccttcgaaggccttgtggagctgctcg 1102
|||||||||||||||||||| ||||| ||| || ||||||||||| ||||||
Sbjct: 199 atgatcagcttctcgttggtaccccatcctgaaaaagccttgtggagttgctcg 146
>emb|BX829662.1|CNS09ZXW Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTFB28ZD07 of Flowers and buds of strain col-0 of
Arabidopsis thaliana (thale cress)
Length = 1043
Score = 52.0 bits (26), Expect = 2e-004
Identities = 47/54 (87%)
Strand = Plus / Minus
Query: 1049 atgatcagcttctcgttggtgccccaaccttcgaaggccttgtggagctgctcg 1102
|||||||||||||||||||| ||||| ||| || ||||||||||| ||||||
Sbjct: 150 atgatcagcttctcgttggtaccccatcctgaaaaagccttgtggagttgctcg 97
>emb|BX829954.1|CNS0A081 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTFB49ZE07 of Flowers and buds of strain col-0 of
Arabidopsis thaliana (thale cress)
Length = 1107
Score = 52.0 bits (26), Expect = 2e-004
Identities = 47/54 (87%)
Strand = Plus / Minus
Query: 1049 atgatcagcttctcgttggtgccccaaccttcgaaggccttgtggagctgctcg 1102
|||||||||||||||||||| ||||| ||| || ||||||||||| ||||||
Sbjct: 180 atgatcagcttctcgttggtaccccatcctgaaaaagccttgtggagttgctcg 127
>emb|BX829955.1|CNS0A082 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTFB49ZE08 of Flowers and buds of strain col-0 of
Arabidopsis thaliana (thale cress)
Length = 1106
Score = 52.0 bits (26), Expect = 2e-004
Identities = 47/54 (87%)
Strand = Plus / Minus
Query: 1049 atgatcagcttctcgttggtgccccaaccttcgaaggccttgtggagctgctcg 1102
|||||||||||||||||||| ||||| ||| || ||||||||||| ||||||
Sbjct: 180 atgatcagcttctcgttggtaccccatcctgaaaaagccttgtggagttgctcg 127
>emb|CQ806274.1| Sequence 2685 from Patent WO2004035798
Length = 954
Score = 52.0 bits (26), Expect = 2e-004
Identities = 47/54 (87%)
Strand = Plus / Minus
Query: 1049 atgatcagcttctcgttggtgccccaaccttcgaaggccttgtggagctgctcg 1102
|||||||||||||||||||| ||||| ||| || ||||||||||| ||||||
Sbjct: 104 atgatcagcttctcgttggtaccccatcctgaaaaagccttgtggagttgctcg 51
>ref|NM_125901.2| Arabidopsis thaliana ANNAT2; calcium ion binding / calcium-dependent
phospholipid binding AT5G65020 (ANNAT2) mRNA, complete
cds
Length = 1220
Score = 52.0 bits (26), Expect = 2e-004
Identities = 47/54 (87%)
Strand = Plus / Minus
Query: 1049 atgatcagcttctcgttggtgccccaaccttcgaaggccttgtggagctgctcg 1102
|||||||||||||||||||| ||||| ||| || ||||||||||| ||||||
Sbjct: 198 atgatcagcttctcgttggtaccccatcctgaaaaagccttgtggagttgctcg 145
>gb|AA712138.1|AA712138 31866 Lambda-PRL2 Arabidopsis thaliana cDNA clone 180J1T7, mRNA
sequence
Length = 309
Score = 48.1 bits (24), Expect = 0.004
Identities = 46/54 (85%)
Strand = Plus / Minus
Query: 1049 atgatcagcttctcgttggtgccccaaccttcgaaggccttgtggagctgctcg 1102
||||||||| |||||||||| ||||| ||| || ||||||||||| ||||||
Sbjct: 125 atgatcagcntctcgttggtaccccatcctgnaaaagccttgtggagttgctcg 72
>emb|BX832444.1|CNS09ZP4 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTPGH73ZD05 of Hormone Treated Callus of strain col-0
of Arabidopsis thaliana (thale cress)
Length = 1103
Score = 46.1 bits (23), Expect = 0.015
Identities = 41/47 (87%)
Strand = Plus / Minus
Query: 1049 atgatcagcttctcgttggtgccccaaccttcgaaggccttgtggag 1095
|||||||||||||||||||| ||||| ||| || |||||||||||
Sbjct: 151 atgatcagcttctcgttggtaccccatcctgaaaaagccttgtggag 105
>gb|BP800932.1|BP800932 BP800932 RAFL14 Arabidopsis thaliana cDNA clone RAFL23-17-G20 5',
mRNA sequence
Length = 386
Score = 44.1 bits (22), Expect = 0.059
Identities = 46/54 (85%)
Strand = Plus / Minus
Query: 1049 atgatcagcttctcgttggtgccccaaccttcgaaggccttgtggagctgctcg 1102
|||||||||||||| ||||| ||||| ||| || ||||||||||| ||||||
Sbjct: 167 atgatcagcttctctttggtaccccatcctgaaaaagccttgtggagttgctcg 114
>gb|BP807759.1|BP807759 BP807759 RAFL16 Arabidopsis thaliana cDNA clone RAFL24-15-C11 5',
mRNA sequence
Length = 387
Score = 44.1 bits (22), Expect = 0.059
Identities = 46/54 (85%)
Strand = Plus / Minus
Query: 1049 atgatcagcttctcgttggtgccccaaccttcgaaggccttgtggagctgctcg 1102
|||||||||||||| ||||| ||||| ||| || ||||||||||| ||||||
Sbjct: 167 atgatcagcttctccttggtaccccatcctgaaaaagccttgtggagttgctcg 114
>gb|BP811861.1|BP811861 BP811861 RAFL19 Arabidopsis thaliana cDNA clone RAFL22-01-I09 5',
mRNA sequence
Length = 385
Score = 44.1 bits (22), Expect = 0.059
Identities = 34/38 (89%)
Strand = Plus / Minus
Query: 1070 ccccaaccttcgaaggccttgtggagctgctcgcagtc 1107
||||| |||| ||| |||||||||||||||||| ||||
Sbjct: 123 ccccatcctttgaatgccttgtggagctgctcggagtc 86
>gb|AY014798.1| Arabidopsis thaliana calcium-binding protein annexin 6 (ANN6) mRNA,
complete cds
Length = 1003
Score = 44.1 bits (22), Expect = 0.059
Identities = 34/38 (89%)
Strand = Plus / Minus
Query: 1070 ccccaaccttcgaaggccttgtggagctgctcgcagtc 1107
||||| |||| ||| |||||||||||||||||| ||||
Sbjct: 106 ccccatcctttgaatgccttgtggagctgctcggagtc 69
>emb|BX832714.1|CNS09ZK9 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTPGH91ZF03 of Hormone Treated Callus of strain col-0
of Arabidopsis thaliana (thale cress)
Length = 1055
Score = 44.1 bits (22), Expect = 0.059
Identities = 25/26 (96%)
Strand = Plus / Minus
Query: 1049 atgatcagcttctcgttggtgcccca 1074
|||||||||||||||||||| |||||
Sbjct: 151 atgatcagcttctcgttggtacccca 126
>dbj|AB019236.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MXK3
Length = 81494
Score = 44.1 bits (22), Expect = 0.059
Identities = 25/26 (96%)
Strand = Plus / Minus
Query: 1049 atgatcagcttctcgttggtgcccca 1074
|||||||||||||||||||| |||||
Sbjct: 71759 atgatcagcttctcgttggtacccca 71734
>dbj|AK175572.1| Arabidopsis thaliana mRNA for annexin -like protein, complete cds,
clone: RAFL22-01-I09
Length = 1120
Score = 44.1 bits (22), Expect = 0.059
Identities = 34/38 (89%)
Strand = Plus / Minus
Query: 1070 ccccaaccttcgaaggccttgtggagctgctcgcagtc 1107
||||| |||| ||| |||||||||||||||||| ||||
Sbjct: 124 ccccatcctttgaatgccttgtggagctgctcggagtc 87
>dbj|AK175641.1| Arabidopsis thaliana mRNA for annexin -like protein, complete cds,
clone: RAFL22-13-B15
Length = 1120
Score = 44.1 bits (22), Expect = 0.059
Identities = 34/38 (89%)
Strand = Plus / Minus
Query: 1070 ccccaaccttcgaaggccttgtggagctgctcgcagtc 1107
||||| |||| ||| |||||||||||||||||| ||||
Sbjct: 124 ccccatcctttgaatgccttgtggagctgctcggagtc 87
>dbj|AK175892.1| Arabidopsis thaliana mRNA for annexin -like protein, complete cds,
clone: RAFL22-53-L09
Length = 1120
Score = 44.1 bits (22), Expect = 0.059
Identities = 34/38 (89%)
Strand = Plus / Minus
Query: 1070 ccccaaccttcgaaggccttgtggagctgctcgcagtc 1107
||||| |||| ||| |||||||||||||||||| ||||
Sbjct: 124 ccccatcctttgaatgccttgtggagctgctcggagtc 87
>dbj|BA000015.5| Arabidopsis thaliana DNA, chromosome 5, complete sequence
Length = 23810767
Score = 44.1 bits (22), Expect = 0.059
Identities = 25/26 (96%)
Strand = Plus / Minus
Query: 1049 atgatcagcttctcgttggtgcccca 1074
|||||||||||||||||||| |||||
Sbjct: 22989737 atgatcagcttctcgttggtacccca 22989712
Score = 44.1 bits (22), Expect = 0.059
Identities = 31/34 (91%)
Strand = Plus / Plus
Query: 1074 aaccttcgaaggccttgtggagctgctcgcagtc 1107
|||||| ||| |||||||||||||||||| ||||
Sbjct: 3021675 aacctttgaatgccttgtggagctgctcggagtc 3021708
>emb|AL356332.1|ATT31P16 Arabidopsis thaliana DNA chromosome 5, BAC clone T31P16 (ESSA project)
Length = 80088
Score = 44.1 bits (22), Expect = 0.059
Identities = 31/34 (91%)
Strand = Plus / Plus
Query: 1074 aaccttcgaaggccttgtggagctgctcgcagtc 1107
|||||| ||| |||||||||||||||||| ||||
Sbjct: 73403 aacctttgaatgccttgtggagctgctcggagtc 73436
>emb|AL360334.1|ATF18D22 Arabidopsis thaliana DNA chromosome 5, BAC clone F18D22 (ESSA project)
Length = 57180
Score = 44.1 bits (22), Expect = 0.059
Identities = 31/34 (91%)
Strand = Plus / Plus
Query: 1074 aaccttcgaaggccttgtggagctgctcgcagtc 1107
|||||| ||| |||||||||||||||||| ||||
Sbjct: 13501 aacctttgaatgccttgtggagctgctcggagtc 13534
>ref|NM_121060.2| Arabidopsis thaliana ANN6 (annexin 6); calcium ion binding /
calcium-dependent phospholipid binding AT5G10220 (ANN6)
mRNA, complete cds
Length = 1085
Score = 44.1 bits (22), Expect = 0.059
Identities = 34/38 (89%)
Strand = Plus / Minus
Query: 1070 ccccaaccttcgaaggccttgtggagctgctcgcagtc 1107
||||| |||| ||| |||||||||||||||||| ||||
Sbjct: 106 ccccatcctttgaatgccttgtggagctgctcggagtc 69
>ref|NC_003076.4| Arabidopsis thaliana chromosome 5, complete sequence
Length = 26992728
Score = 44.1 bits (22), Expect = 0.059
Identities = 25/26 (96%)
Strand = Plus / Minus
Query: 1049 atgatcagcttctcgttggtgcccca 1074
|||||||||||||||||||| |||||
Sbjct: 25991650 atgatcagcttctcgttggtacccca 25991625
Score = 44.1 bits (22), Expect = 0.059
Identities = 31/34 (91%)
Strand = Plus / Plus
Query: 1074 aaccttcgaaggccttgtggagctgctcgcagtc 1107
|||||| ||| |||||||||||||||||| ||||
Sbjct: 3208707 aacctttgaatgccttgtggagctgctcggagtc 3208740
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 511,849
Number of Sequences: 1013581
Number of extensions: 511849
Number of successful extensions: 37210
Number of sequences better than 0.5: 42
Number of HSP's better than 0.5 without gapping: 44
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 36538
Number of HSP's gapped (non-prelim): 672
length of query: 1286
length of database: 908,940,872
effective HSP length: 20
effective length of query: 1266
effective length of database: 888,669,252
effective search space: 1125055273032
effective search space used: 1125055273032
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)