BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 1805202.2.1
         (1139 letters)

Database: At_nucl_with_EST.fasta 
           1,013,581 sequences; 908,940,872 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|CC179447.1|CC179447  SALK_068795.25.05.x Arabidopsis thal...    42   0.21 
emb|BX658776.1|  Arabidopsis thaliana T-DNA flanking sequenc...    42   0.21 
gb|AC012193.6|AC012193  Arabidopsis thaliana chromosome 1 BA...    42   0.21 
emb|CR376938.1|  Arabidopsis thaliana transposon insertion S...    42   0.21 
gb|AE005173.1|  Arabidopsis thaliana chromosome 1, bottom ar...    42   0.21 
ref|NC_003070.5|  Arabidopsis thaliana chromosome 1, complet...    42   0.21 

>gb|CC179447.1|CC179447 SALK_068795.25.05.x Arabidopsis thaliana TDNA insertion lines
            Arabidopsis thaliana genomic clone SALK_068795.25.05.x,
            DNA sequence
          Length = 111

 Score = 42.1 bits (21), Expect = 0.21
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 1048 tctctttcttccttcactcct 1068
            |||||||||||||||||||||
Sbjct: 51   tctctttcttccttcactcct 71



>emb|BX658776.1| Arabidopsis thaliana T-DNA flanking sequence GK-639E11-022256,
            genomic survey sequence
          Length = 509

 Score = 42.1 bits (21), Expect = 0.21
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 1048 tctctttcttccttcactcct 1068
            |||||||||||||||||||||
Sbjct: 306  tctctttcttccttcactcct 326



>gb|AC012193.6|AC012193 Arabidopsis thaliana chromosome 1 BAC T32E8 genomic sequence, complete
             sequence
          Length = 82454

 Score = 42.1 bits (21), Expect = 0.21
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 1048  tctctttcttccttcactcct 1068
             |||||||||||||||||||||
Sbjct: 17453 tctctttcttccttcactcct 17433



>emb|CR376938.1| Arabidopsis thaliana transposon insertion STS GT_3.9115, sequence
            tagged site
          Length = 268

 Score = 42.1 bits (21), Expect = 0.21
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 1048 tctctttcttccttcactcct 1068
            |||||||||||||||||||||
Sbjct: 22   tctctttcttccttcactcct 42



>gb|AE005173.1| Arabidopsis thaliana chromosome 1, bottom arm complete sequence
          Length = 14668883

 Score = 42.1 bits (21), Expect = 0.21
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 1048     tctctttcttccttcactcct 1068
                |||||||||||||||||||||
Sbjct: 13451309 tctctttcttccttcactcct 13451289



>ref|NC_003070.5| Arabidopsis thaliana chromosome 1, complete sequence
          Length = 30432563

 Score = 42.1 bits (21), Expect = 0.21
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 1048     tctctttcttccttcactcct 1068
                |||||||||||||||||||||
Sbjct: 29214990 tctctttcttccttcactcct 29214970



  Database: At_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:09 PM
  Number of letters in database: 908,940,872
  Number of sequences in database:  1,013,581
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 617,516
Number of Sequences: 1013581
Number of extensions: 617516
Number of successful extensions: 44652
Number of sequences better than  0.5: 6
Number of HSP's better than  0.5 without gapping: 6
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 44179
Number of HSP's gapped (non-prelim): 473
length of query: 1139
length of database: 908,940,872
effective HSP length: 20
effective length of query: 1119
effective length of database: 888,669,252
effective search space: 994420892988
effective search space used: 994420892988
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)