BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 1738863.2.3
         (730 letters)

Database: At_nucl_with_EST.fasta 
           1,013,581 sequences; 908,940,872 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|AF085279.1|AF085279  Arabidopsis thaliana ABA-regulated g...    42   0.13 
gb|AC018721.1|AC018721  Arabidopsis thaliana chromosome II s...    42   0.13 
ref|NC_003071.3|  Arabidopsis thaliana chromosome 2, complet...    42   0.13 

>gb|AF085279.1|AF085279 Arabidopsis thaliana ABA-regulated gene cluster, complete sequence
          Length = 95713

 Score = 42.1 bits (21), Expect = 0.13
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 589  cttgatttggttaagtttgat 609
            |||||||||||||||||||||
Sbjct: 5997 cttgatttggttaagtttgat 5977



>gb|AC018721.1|AC018721 Arabidopsis thaliana chromosome II section 217 of 255 of the complete
            sequence. Sequence from clones F27I1, T7M7, T3G21
          Length = 57991

 Score = 42.1 bits (21), Expect = 0.13
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 589  cttgatttggttaagtttgat 609
            |||||||||||||||||||||
Sbjct: 8737 cttgatttggttaagtttgat 8717



>ref|NC_003071.3| Arabidopsis thaliana chromosome 2, complete sequence
          Length = 19705359

 Score = 42.1 bits (21), Expect = 0.13
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 589      cttgatttggttaagtttgat 609
                |||||||||||||||||||||
Sbjct: 16768037 cttgatttggttaagtttgat 16768017



  Database: At_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:09 PM
  Number of letters in database: 908,940,872
  Number of sequences in database:  1,013,581
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 363,312
Number of Sequences: 1013581
Number of extensions: 363312
Number of successful extensions: 28935
Number of sequences better than  0.5: 3
Number of HSP's better than  0.5 without gapping: 3
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 28788
Number of HSP's gapped (non-prelim): 147
length of query: 730
length of database: 908,940,872
effective HSP length: 20
effective length of query: 710
effective length of database: 888,669,252
effective search space: 630955168920
effective search space used: 630955168920
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)