BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 1738863.2.3
(730 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AF085279.1|AF085279 Arabidopsis thaliana ABA-regulated g... 42 0.13
gb|AC018721.1|AC018721 Arabidopsis thaliana chromosome II s... 42 0.13
ref|NC_003071.3| Arabidopsis thaliana chromosome 2, complet... 42 0.13
>gb|AF085279.1|AF085279 Arabidopsis thaliana ABA-regulated gene cluster, complete sequence
Length = 95713
Score = 42.1 bits (21), Expect = 0.13
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 589 cttgatttggttaagtttgat 609
|||||||||||||||||||||
Sbjct: 5997 cttgatttggttaagtttgat 5977
>gb|AC018721.1|AC018721 Arabidopsis thaliana chromosome II section 217 of 255 of the complete
sequence. Sequence from clones F27I1, T7M7, T3G21
Length = 57991
Score = 42.1 bits (21), Expect = 0.13
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 589 cttgatttggttaagtttgat 609
|||||||||||||||||||||
Sbjct: 8737 cttgatttggttaagtttgat 8717
>ref|NC_003071.3| Arabidopsis thaliana chromosome 2, complete sequence
Length = 19705359
Score = 42.1 bits (21), Expect = 0.13
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 589 cttgatttggttaagtttgat 609
|||||||||||||||||||||
Sbjct: 16768037 cttgatttggttaagtttgat 16768017
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 363,312
Number of Sequences: 1013581
Number of extensions: 363312
Number of successful extensions: 28935
Number of sequences better than 0.5: 3
Number of HSP's better than 0.5 without gapping: 3
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 28788
Number of HSP's gapped (non-prelim): 147
length of query: 730
length of database: 908,940,872
effective HSP length: 20
effective length of query: 710
effective length of database: 888,669,252
effective search space: 630955168920
effective search space used: 630955168920
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)