BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 131555.2.1
(1236 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CB074863.1|CB074863 EST03016 Arabidopsis Acute Ozone poo... 48 0.004
emb|BX662728.1| Arabidopsis thaliana T-DNA flanking sequenc... 42 0.23
emb|BX662824.1| Arabidopsis thaliana T-DNA flanking sequenc... 42 0.23
emb|BX663278.1| Arabidopsis thaliana T-DNA flanking sequenc... 42 0.23
gb|BE662730.1|BE662730 EST00251 Arabidopsis Acute Ozone Rev... 42 0.23
gb|BE662731.1|BE662731 EST00252 Arabidopsis Acute Ozone Rev... 42 0.23
gb|BE662737.1|BE662737 EST00258 Arabidopsis Acute Ozone Rev... 42 0.23
gb|BE662936.1|BE662936 EST00086 Arabidopsis Acute Ozone For... 42 0.23
gb|CB185798.1|CB185798 EST00725 Arabidopsis avirulent Pseud... 42 0.23
gb|CB185880.1|CB185880 EST01071 Arabidopsis virulent Pseudo... 42 0.23
gb|CB239324.1|CB239324 EST01145 Arabidopsis virulent Pseudo... 42 0.23
gb|CB074186.1|CB074186 EST02508 Early Ovule Development For... 42 0.23
gb|CB074223.1|CB074223 EST01000 Virulent Peronospora parasi... 42 0.23
gb|CB074227.1|CB074227 EST01003 Virulent Peronospora parasi... 42 0.23
gb|CB074279.1|CB074279 EST00792 Virulent Peronospora parasi... 42 0.23
gb|CB074411.1|CB074411 EST00927 Virulent Peronospora parasi... 42 0.23
gb|CB074582.1|CB074582 EST0088 Virulent Peronospora parasit... 42 0.23
gb|CB074854.1|CB074854 EST03007 Arabidopsis Acute Ozone poo... 42 0.23
gb|CB074862.1|CB074862 EST03015 Arabidopsis Acute Ozone poo... 42 0.23
gb|CB097368.1|CB097368 EST00995 Virulent Peronospora parasi... 42 0.23
gb|CB165160.1|CB165160 EST00996 Virulent Peronospora parasi... 42 0.23
gb|CF772955.1|CF772955 AG_FSL_10D03 Arabidopsis ag-1 35S:AG... 42 0.23
emb|AX507774.1| Sequence 2469 from Patent WO0216655 42 0.23
>gb|CB074863.1|CB074863 EST03016 Arabidopsis Acute Ozone pooled time-points
Forward-Subtracted Library Arabidopsis thaliana cDNA
clone AtAOzLH10 similar to putative protein, mRNA
sequence
Length = 305
Score = 48.1 bits (24), Expect = 0.004
Identities = 24/24 (100%)
Strand = Plus / Plus
Query: 1212 cgcgtacctgcccgggcggccgct 1235
||||||||||||||||||||||||
Sbjct: 275 cgcgtacctgcccgggcggccgct 298
>emb|BX662728.1| Arabidopsis thaliana T-DNA flanking sequence GK-708B12-022965,
genomic survey sequence
Length = 378
Score = 42.1 bits (21), Expect = 0.23
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 1215 gtacctgcccgggcggccgct 1235
|||||||||||||||||||||
Sbjct: 51 gtacctgcccgggcggccgct 31
>emb|BX662824.1| Arabidopsis thaliana T-DNA flanking sequence GK-708H07-022965,
genomic survey sequence
Length = 416
Score = 42.1 bits (21), Expect = 0.23
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 1215 gtacctgcccgggcggccgct 1235
|||||||||||||||||||||
Sbjct: 52 gtacctgcccgggcggccgct 32
>emb|BX663278.1| Arabidopsis thaliana T-DNA flanking sequence GK-712A09-022963,
genomic survey sequence
Length = 278
Score = 42.1 bits (21), Expect = 0.23
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 1215 gtacctgcccgggcggccgct 1235
|||||||||||||||||||||
Sbjct: 199 gtacctgcccgggcggccgct 219
>gb|BE662730.1|BE662730 EST00251 Arabidopsis Acute Ozone Reverse-Subtracted Library
Arabidopsis thaliana cDNA clone AtAOzHA7 similar to small
nuclear ribosomal protein E, mRNA sequence
Length = 263
Score = 42.1 bits (21), Expect = 0.23
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 1215 gtacctgcccgggcggccgct 1235
|||||||||||||||||||||
Sbjct: 239 gtacctgcccgggcggccgct 259
>gb|BE662731.1|BE662731 EST00252 Arabidopsis Acute Ozone Reverse-Subtracted Library
Arabidopsis thaliana cDNA clone AtAOzHA9, mRNA sequence
Length = 328
Score = 42.1 bits (21), Expect = 0.23
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 1215 gtacctgcccgggcggccgct 1235
|||||||||||||||||||||
Sbjct: 304 gtacctgcccgggcggccgct 324
>gb|BE662737.1|BE662737 EST00258 Arabidopsis Acute Ozone Reverse-Subtracted Library
Arabidopsis thaliana cDNA clone AtaOzHC2 similar to Lhca2
chlorophyll a/b-binding protein, mRNA sequence
Length = 450
Score = 42.1 bits (21), Expect = 0.23
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 1215 gtacctgcccgggcggccgct 1235
|||||||||||||||||||||
Sbjct: 81 gtacctgcccgggcggccgct 61
>gb|BE662936.1|BE662936 EST00086 Arabidopsis Acute Ozone Forward-Subtracted Library
Arabidopsis thaliana cDNA clone AtAOzD61, mRNA sequence
Length = 255
Score = 42.1 bits (21), Expect = 0.23
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 1215 gtacctgcccgggcggccgct 1235
|||||||||||||||||||||
Sbjct: 170 gtacctgcccgggcggccgct 190
>gb|CB185798.1|CB185798 EST00725 Arabidopsis avirulent Pseudomonas syringae subtracted
library Arabidopsis thaliana cDNA clone AVR2-A8 similar
to hypothetical protein targeted to chloroplast, mRNA
sequence
Length = 456
Score = 42.1 bits (21), Expect = 0.23
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 1214 cgtacctgcccgggcggccgc 1234
|||||||||||||||||||||
Sbjct: 435 cgtacctgcccgggcggccgc 455
>gb|CB185880.1|CB185880 EST01071 Arabidopsis virulent Pseudomonas syringae subtracted library
Arabidopsis thaliana cDNA clone DC4-H4 similar to
putative protein with homology to rubisco small subunit,
mRNA sequence
Length = 370
Score = 42.1 bits (21), Expect = 0.23
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 1215 gtacctgcccgggcggccgct 1235
|||||||||||||||||||||
Sbjct: 84 gtacctgcccgggcggccgct 64
>gb|CB239324.1|CB239324 EST01145 Arabidopsis virulent Pseudomonas syringae subtracted library
Arabidopsis thaliana cDNA clone DC1-C2 similar to
putative tyrosine aminotransferase, mRNA sequence
Length = 579
Score = 42.1 bits (21), Expect = 0.23
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 1215 gtacctgcccgggcggccgct 1235
|||||||||||||||||||||
Sbjct: 59 gtacctgcccgggcggccgct 39
>gb|CB074186.1|CB074186 EST02508 Early Ovule Development Forward Subtracted Library
Arabidopsis thaliana cDNA clone 1D17G5 similar to blue
copper protein, mRNA sequence
Length = 149
Score = 42.1 bits (21), Expect = 0.23
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 1215 gtacctgcccgggcggccgct 1235
|||||||||||||||||||||
Sbjct: 33 gtacctgcccgggcggccgct 13
>gb|CB074223.1|CB074223 EST01000 Virulent Peronospora parasitica Infected Arabidopsis
reverse-Subtracted Library Arabidopsis thaliana cDNA
clone VPP-RAA10 similar to chlorophyll a/b-binding
protein, mRNA sequence
Length = 527
Score = 42.1 bits (21), Expect = 0.23
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 1215 gtacctgcccgggcggccgct 1235
|||||||||||||||||||||
Sbjct: 366 gtacctgcccgggcggccgct 386
>gb|CB074227.1|CB074227 EST01003 Virulent Peronospora parasitica Infected Arabidopsis
reverse-Subtracted Library Arabidopsis thaliana cDNA
clone VPP-RBC07 similar to PSI subunit, mRNA sequence
Length = 249
Score = 42.1 bits (21), Expect = 0.23
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 1215 gtacctgcccgggcggccgct 1235
|||||||||||||||||||||
Sbjct: 224 gtacctgcccgggcggccgct 244
>gb|CB074279.1|CB074279 EST00792 Virulent Peronospora parasitica Infected Arabidopsis
Forward-Subtracted Library Arabidopsis thaliana cDNA
clone VPP-BB7 similar to PUTATIVE PROTEIN, mRNA sequence
Length = 320
Score = 42.1 bits (21), Expect = 0.23
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 1215 gtacctgcccgggcggccgct 1235
|||||||||||||||||||||
Sbjct: 213 gtacctgcccgggcggccgct 233
>gb|CB074411.1|CB074411 EST00927 Virulent Peronospora parasitica Infected Arabidopsis
Forward-Subtracted Library Arabidopsis thaliana cDNA
clone VPP-FF9 similar to UNKNOWN PROTEIN, mRNA sequence
Length = 421
Score = 42.1 bits (21), Expect = 0.23
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 1215 gtacctgcccgggcggccgct 1235
|||||||||||||||||||||
Sbjct: 397 gtacctgcccgggcggccgct 417
>gb|CB074582.1|CB074582 EST0088 Virulent Peronospora parasitica Infected Arabidopsis
Forward-Subtracted Library Arabidopsis thaliana cDNA
clone VPP-EB10, mRNA sequence
Length = 406
Score = 42.1 bits (21), Expect = 0.23
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 1215 gtacctgcccgggcggccgct 1235
|||||||||||||||||||||
Sbjct: 382 gtacctgcccgggcggccgct 402
>gb|CB074854.1|CB074854 EST03007 Arabidopsis Acute Ozone pooled time-points
Forward-Subtracted Library Arabidopsis thaliana cDNA
clone AtAOzLC01 similar to PSII 32Kda protein, mRNA
sequence
Length = 358
Score = 42.1 bits (21), Expect = 0.23
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 1215 gtacctgcccgggcggccgct 1235
|||||||||||||||||||||
Sbjct: 329 gtacctgcccgggcggccgct 349
>gb|CB074862.1|CB074862 EST03015 Arabidopsis Acute Ozone pooled time-points
Forward-Subtracted Library Arabidopsis thaliana cDNA
clone AtAOzLH04 similar to PsbA gene in chloroplast
genome, mRNA sequence
Length = 360
Score = 42.1 bits (21), Expect = 0.23
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 1215 gtacctgcccgggcggccgct 1235
|||||||||||||||||||||
Sbjct: 332 gtacctgcccgggcggccgct 352
>gb|CB097368.1|CB097368 EST00995 Virulent Peronospora parasitica Infected Arabidopsis
Forward-Subtracted Library Arabidopsis thaliana cDNA
clone VPP-AA5 similar to NAD dependent epimerase, mRNA
sequence
Length = 601
Score = 42.1 bits (21), Expect = 0.23
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 1215 gtacctgcccgggcggccgct 1235
|||||||||||||||||||||
Sbjct: 452 gtacctgcccgggcggccgct 472
>gb|CB165160.1|CB165160 EST00996 Virulent Peronospora parasitica Infected Arabidopsis
Forward-Subtracted Library Arabidopsis thaliana cDNA
clone VPP-EH12 similar to putative protein, mRNA sequence
Length = 271
Score = 42.1 bits (21), Expect = 0.23
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 1215 gtacctgcccgggcggccgct 1235
|||||||||||||||||||||
Sbjct: 247 gtacctgcccgggcggccgct 267
>gb|CF772955.1|CF772955 AG_FSL_10D03 Arabidopsis ag-1 35S:AG-GR forward subtraction library
Arabidopsis thaliana cDNA clone 10D03, mRNA sequence
Length = 640
Score = 42.1 bits (21), Expect = 0.23
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 1215 gtacctgcccgggcggccgct 1235
|||||||||||||||||||||
Sbjct: 123 gtacctgcccgggcggccgct 143
>emb|AX507774.1| Sequence 2469 from Patent WO0216655
Length = 238
Score = 42.1 bits (21), Expect = 0.23
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 1215 gtacctgcccgggcggccgct 1235
|||||||||||||||||||||
Sbjct: 24 gtacctgcccgggcggccgct 4
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 627,459
Number of Sequences: 1013581
Number of extensions: 627459
Number of successful extensions: 49841
Number of sequences better than 0.5: 24
Number of HSP's better than 0.5 without gapping: 24
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 49817
Number of HSP's gapped (non-prelim): 24
length of query: 1236
length of database: 908,940,872
effective HSP length: 20
effective length of query: 1216
effective length of database: 888,669,252
effective search space: 1080621810432
effective search space used: 1080621810432
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)