BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 131537.2.452
(1348 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CB254883.1|CB254883 56-E018439-019-009-P13-T7R MPIZ-ADIS... 46 0.016
gb|CB255318.1|CB255318 44-E015393-019-006-H11-T7R MPIZ-ADIS... 46 0.016
gb|AY062559.1| Arabidopsis thaliana receptor-like protein k... 46 0.016
gb|AF367312.1| Arabidopsis thaliana AT5g48380/MJE7_1 mRNA, ... 46 0.016
gb|AY074386.1| Arabidopsis thaliana putative receptor prote... 46 0.016
gb|AF083807.1| Arabidopsis thaliana clone sps952 unknown mRNA 46 0.016
emb|BX831030.1|CNS0A1O9 Arabidopsis thaliana Full-length cD... 46 0.016
dbj|AB020745.1| Arabidopsis thaliana genomic DNA, chromosom... 46 0.016
dbj|BA000015.5| Arabidopsis thaliana DNA, chromosome 5, com... 46 0.016
emb|AL162508.1|ATT7H20 Arabidopsis thaliana DNA chromosome ... 46 0.016
ref|NM_120285.1| Arabidopsis thaliana kinase AT5G02070 mRNA... 46 0.016
ref|NM_124213.3| Arabidopsis thaliana ATP binding / protein... 46 0.016
ref|NC_003076.4| Arabidopsis thaliana chromosome 5, complet... 46 0.016
gb|BP834527.1|BP834527 BP834527 RAFL19 Arabidopsis thaliana... 42 0.25
gb|BH751418.1|BH751418 SALK_050111.48.15.x Arabidopsis thal... 40 0.97
gb|B10127.1|B10127 F20D3-Sp6 IGF Arabidopsis thaliana genom... 38 3.8
gb|AQ969864.1|AQ969864 LERJQ87TF LERG Arabidopsis thaliana ... 38 3.8
gb|AQ969865.1|AQ969865 LERJQ87TR LERG Arabidopsis thaliana ... 38 3.8
gb|BH855244.1|BH855244 SALK_086107.42.55.x Arabidopsis thal... 38 3.8
gb|AI999651.1|AI999651 701556873 A. thaliana, Columbia Col-... 38 3.8
gb|AV563538.1|AV563538 AV563538 Arabidopsis thaliana green ... 38 3.8
gb|AE005172.1| Arabidopsis thaliana chromosome 1, top arm c... 38 3.8
gb|AF083784.1| Arabidopsis thaliana clone sps825 unknown mRNA 38 3.8
gb|BT004055.1| Arabidopsis thaliana clone RAFL15-21-H23 (R2... 38 3.8
gb|BT005112.1| Arabidopsis thaliana clone U20468 putative p... 38 3.8
gb|AY085517.1| Arabidopsis thaliana clone 15535 mRNA, compl... 38 3.8
dbj|BD248390.1| Gene participating in tolerance against env... 38 3.8
gb|AC022464.4|AC022464 Genomic sequence for Arabidopsis tha... 38 3.8
gb|AC051626.5|AC051626 Genomic Sequence For Arabidopsis tha... 38 3.8
gb|AC069328.1|AC069328 Genomic Sequence For Arabidopsis tha... 38 3.8
gb|AC007060.3|T5I8 Arabidopsis thaliana chromosome 1 BAC T5... 38 3.8
gb|AC013288.7|AC013288 Arabidopsis thaliana chromosome 1 BA... 38 3.8
gb|AC083891.4|AC083891 Arabidopsis thaliana chromosome 1 BA... 38 3.8
gb|AC067754.6|AC067754 Arabidopsis thaliana chromosome 1 BA... 38 3.8
gb|AC009755.7|ATAC009755 Arabidopsis thaliana chromosome II... 38 3.8
gb|AC011664.10|ATAC011664 Arabidopsis thaliana chromosome I... 38 3.8
emb|BX830642.1|CNS09ZZZ Arabidopsis thaliana Full-length cD... 38 3.8
emb|BX814972.1|CNS0AAM2 Arabidopsis thaliana Full-length cD... 38 3.8
emb|BX815753.1|CNS0ACU6 Arabidopsis thaliana Full-length cD... 38 3.8
emb|BX816653.1|CNS0ADBU Arabidopsis thaliana Full-length cD... 38 3.8
emb|BX814924.1|CNS0ADWK Arabidopsis thaliana Full-length cD... 38 3.8
dbj|D12522.1|ATHAPK1A Arabidopsis thaliana APK1 gene for pr... 38 3.8
dbj|AK117442.1| Arabidopsis thaliana At3g02130 mRNA for put... 38 3.8
dbj|AB101213.1| Arabidopsis thaliana gene for receptor-like... 38 3.8
dbj|AB101214.1| Arabidopsis thaliana gene for receptor-like... 38 3.8
dbj|AB101216.1| Arabidopsis thaliana gene for receptor-like... 38 3.8
dbj|AB101217.1| Arabidopsis thaliana gene for receptor-like... 38 3.8
dbj|AB101218.1| Arabidopsis thaliana gene for receptor-like... 38 3.8
dbj|AB101219.1| Arabidopsis thaliana gene for receptor-like... 38 3.8
dbj|AB101220.1| Arabidopsis thaliana gene for receptor-like... 38 3.8
dbj|AB101221.1| Arabidopsis thaliana gene for receptor-like... 38 3.8
dbj|AB101224.1| Arabidopsis thaliana gene for receptor-like... 38 3.8
dbj|AB101226.1| Arabidopsis thaliana gene for receptor-like... 38 3.8
dbj|AB101227.1| Arabidopsis thaliana gene for receptor-like... 38 3.8
dbj|AB101228.1| Arabidopsis thaliana gene for receptor-like... 38 3.8
dbj|AB101229.1| Arabidopsis thaliana gene for receptor-like... 38 3.8
emb|CQ804206.1| Sequence 617 from Patent WO2004035798 38 3.8
dbj|BA000014.8| Arabidopsis thaliana, chromosome 3, complet... 38 3.8
emb|AL133298.1|ATF18L15 Arabidopsis thaliana DNA chromosome... 38 3.8
gb|AE005173.1| Arabidopsis thaliana chromosome 1, bottom ar... 38 3.8
ref|NM_102798.1| Arabidopsis thaliana EMB2279 AT1G30610 (EM... 38 3.8
ref|NM_114508.1| Arabidopsis thaliana ATP binding / kinase/... 38 3.8
ref|NM_111080.2| Arabidopsis thaliana ATP binding / kinase/... 38 3.8
ref|NM_121855.2| Arabidopsis thaliana ATP binding / kinase/... 38 3.8
ref|NM_105359.2| Arabidopsis thaliana ATP binding / protein... 38 3.8
ref|NM_105878.2| Arabidopsis thaliana oxidoreductase/ oxido... 38 3.8
ref|NM_100631.3| Arabidopsis thaliana APK1A; kinase AT1G075... 38 3.8
ref|NM_105877.3| Arabidopsis thaliana ATP binding / kinase/... 38 3.8
ref|NM_202049.1| Arabidopsis thaliana APK1A; kinase AT1G075... 38 3.8
ref|NM_001036821.1| Arabidopsis thaliana ATP binding / kina... 38 3.8
ref|NC_003074.4| Arabidopsis thaliana chromosome 3, complet... 38 3.8
ref|NC_003070.5| Arabidopsis thaliana chromosome 1, complet... 38 3.8
>gb|CB254883.1|CB254883 56-E018439-019-009-P13-T7R MPIZ-ADIS-019 Arabidopsis thaliana cDNA
clone MPIZp768P139Q 5-PRIME, mRNA sequence
Length = 635
Score = 46.1 bits (23), Expect = 0.016
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 725 gatgtctacagcttcggcgtggtgcttctggagct 759
||||||||||||||||| || |||||||| |||||
Sbjct: 72 gatgtctacagcttcggtgttgtgcttctagagct 106
>gb|CB255318.1|CB255318 44-E015393-019-006-H11-T7R MPIZ-ADIS-019 Arabidopsis thaliana cDNA
clone MPIZp768H116Q 5-PRIME, mRNA sequence
Length = 708
Score = 46.1 bits (23), Expect = 0.016
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 725 gatgtctacagcttcggcgtggtgcttctggagct 759
||||||||||||||||| || |||||||| |||||
Sbjct: 373 gatgtctacagcttcggtgttgtgcttctagagct 407
>gb|AY062559.1| Arabidopsis thaliana receptor-like protein kinase (At5g48380; MJE7.1)
mRNA, complete cds
Length = 2211
Score = 46.1 bits (23), Expect = 0.016
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 725 gatgtctacagcttcggcgtggtgcttctggagct 759
||||||||||||||||| || |||||||| |||||
Sbjct: 1711 gatgtctacagcttcggtgttgtgcttctagagct 1745
>gb|AF367312.1| Arabidopsis thaliana AT5g48380/MJE7_1 mRNA, complete cds
Length = 2298
Score = 46.1 bits (23), Expect = 0.016
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 725 gatgtctacagcttcggcgtggtgcttctggagct 759
||||||||||||||||| || |||||||| |||||
Sbjct: 1714 gatgtctacagcttcggtgttgtgcttctagagct 1748
>gb|AY074386.1| Arabidopsis thaliana putative receptor protein kinase (At5g48380)
mRNA, complete cds
Length = 2404
Score = 46.1 bits (23), Expect = 0.016
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 725 gatgtctacagcttcggcgtggtgcttctggagct 759
||||||||||||||||| || |||||||| |||||
Sbjct: 1702 gatgtctacagcttcggtgttgtgcttctagagct 1736
>gb|AF083807.1| Arabidopsis thaliana clone sps952 unknown mRNA
Length = 2277
Score = 46.1 bits (23), Expect = 0.016
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 725 gatgtctacagcttcggcgtggtgcttctggagct 759
||||||||||||||||| || |||||||| |||||
Sbjct: 1687 gatgtctacagcttcggtgttgtgcttctagagct 1721
>emb|BX831030.1|CNS0A1O9 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTLS51ZA06 of Adult vegetative tissue of strain col-0
of Arabidopsis thaliana (thale cress)
Length = 2381
Score = 46.1 bits (23), Expect = 0.016
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 725 gatgtctacagcttcggcgtggtgcttctggagct 759
||||||||||||||||| || |||||||| |||||
Sbjct: 1817 gatgtctacagcttcggtgttgtgcttctagagct 1851
>dbj|AB020745.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MJE7
Length = 74298
Score = 46.1 bits (23), Expect = 0.016
Identities = 32/35 (91%)
Strand = Plus / Minus
Query: 725 gatgtctacagcttcggcgtggtgcttctggagct 759
||||||||||||||||| || |||||||| |||||
Sbjct: 398 gatgtctacagcttcggtgttgtgcttctagagct 364
>dbj|BA000015.5| Arabidopsis thaliana DNA, chromosome 5, complete sequence
Length = 23810767
Score = 46.1 bits (23), Expect = 0.016
Identities = 32/35 (91%)
Strand = Plus / Minus
Query: 723 gcgatgtctacagcttcggcgtggtgcttctggag 757
||||||| ||||||||||| || ||||||||||||
Sbjct: 405768 gcgatgtgtacagcttcggggttgtgcttctggag 405734
Score = 38.2 bits (19), Expect = 3.8
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 723 gcgatgtctacagcttcgg 741
|||||||||||||||||||
Sbjct: 5911330 gcgatgtctacagcttcgg 5911312
Score = 38.2 bits (19), Expect = 3.8
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 723 gcgatgtctacagcttcgg 741
|||||||||||||||||||
Sbjct: 5861646 gcgatgtctacagcttcgg 5861664
>emb|AL162508.1|ATT7H20 Arabidopsis thaliana DNA chromosome 5, BAC clone T7H20 (ESSA project)
Length = 87581
Score = 46.1 bits (23), Expect = 0.016
Identities = 32/35 (91%)
Strand = Plus / Minus
Query: 723 gcgatgtctacagcttcggcgtggtgcttctggag 757
||||||| ||||||||||| || ||||||||||||
Sbjct: 37227 gcgatgtgtacagcttcggggttgtgcttctggag 37193
>ref|NM_120285.1| Arabidopsis thaliana kinase AT5G02070 mRNA, complete cds
Length = 1974
Score = 46.1 bits (23), Expect = 0.016
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 723 gcgatgtctacagcttcggcgtggtgcttctggag 757
||||||| ||||||||||| || ||||||||||||
Sbjct: 1655 gcgatgtgtacagcttcggggttgtgcttctggag 1689
>ref|NM_124213.3| Arabidopsis thaliana ATP binding / protein binding / protein kinase/
protein serine/threonine kinase/ protein-tyrosine kinase
AT5G48380 mRNA, complete cds
Length = 2706
Score = 46.1 bits (23), Expect = 0.016
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 725 gatgtctacagcttcggcgtggtgcttctggagct 759
||||||||||||||||| || |||||||| |||||
Sbjct: 1816 gatgtctacagcttcggtgttgtgcttctagagct 1850
>ref|NC_003076.4| Arabidopsis thaliana chromosome 5, complete sequence
Length = 26992728
Score = 46.1 bits (23), Expect = 0.016
Identities = 32/35 (91%)
Strand = Plus / Minus
Query: 725 gatgtctacagcttcggcgtggtgcttctggagct 759
||||||||||||||||| || |||||||| |||||
Sbjct: 19622205 gatgtctacagcttcggtgttgtgcttctagagct 19622171
Score = 46.1 bits (23), Expect = 0.016
Identities = 32/35 (91%)
Strand = Plus / Minus
Query: 723 gcgatgtctacagcttcggcgtggtgcttctggag 757
||||||| ||||||||||| || ||||||||||||
Sbjct: 406211 gcgatgtgtacagcttcggggttgtgcttctggag 406177
Score = 38.2 bits (19), Expect = 3.8
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 723 gcgatgtctacagcttcgg 741
|||||||||||||||||||
Sbjct: 6140673 gcgatgtctacagcttcgg 6140691
>gb|BP834527.1|BP834527 BP834527 RAFL19 Arabidopsis thaliana cDNA clone RAFL22-10-J07 5',
mRNA sequence
Length = 384
Score = 42.1 bits (21), Expect = 0.25
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 723 gcgatgtctacagcttcggcgtggt 747
||||||||||||||||||| |||||
Sbjct: 334 gcgatgtctacagcttcggggtggt 358
>gb|BH751418.1|BH751418 SALK_050111.48.15.x Arabidopsis thaliana TDNA insertion lines
Arabidopsis thaliana genomic clone SALK_050111.48.15.x,
DNA sequence
Length = 414
Score = 40.1 bits (20), Expect = 0.97
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 725 gatgtctacagcttcggcgt 744
||||||||||||||||||||
Sbjct: 309 gatgtctacagcttcggcgt 328
>gb|B10127.1|B10127 F20D3-Sp6 IGF Arabidopsis thaliana genomic clone F20D3, DNA sequence
Length = 889
Score = 38.2 bits (19), Expect = 3.8
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 1270 aattgcttcgctttatact 1288
|||||||||||||||||||
Sbjct: 316 aattgcttcgctttatact 298
>gb|AQ969864.1|AQ969864 LERJQ87TF LERG Arabidopsis thaliana genomic clone LERJQ87, DNA
sequence
Length = 658
Score = 38.2 bits (19), Expect = 3.8
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 723 gcgatgtctacagcttcgg 741
|||||||||||||||||||
Sbjct: 153 gcgatgtctacagcttcgg 135
>gb|AQ969865.1|AQ969865 LERJQ87TR LERG Arabidopsis thaliana genomic clone LERJQ87, DNA
sequence
Length = 556
Score = 38.2 bits (19), Expect = 3.8
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 723 gcgatgtctacagcttcgg 741
|||||||||||||||||||
Sbjct: 501 gcgatgtctacagcttcgg 519
>gb|BH855244.1|BH855244 SALK_086107.42.55.x Arabidopsis thaliana TDNA insertion lines
Arabidopsis thaliana genomic clone SALK_086107.42.55.x,
DNA sequence
Length = 384
Score = 38.2 bits (19), Expect = 3.8
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 782 tggtatgaacaagatcagc 800
|||||||||||||||||||
Sbjct: 111 tggtatgaacaagatcagc 129
>gb|AI999651.1|AI999651 701556873 A. thaliana, Columbia Col-0, rosette-3 Arabidopsis
thaliana cDNA clone 701556873, mRNA sequence
Length = 552
Score = 38.2 bits (19), Expect = 3.8
Identities = 31/35 (88%)
Strand = Plus / Minus
Query: 725 gatgtctacagcttcggcgtggtgcttctggagct 759
||||| ||||||||||| ||||| ||||| |||||
Sbjct: 462 gatgtgtacagcttcggtgtggttcttctagagct 428
>gb|AV563538.1|AV563538 AV563538 Arabidopsis thaliana green siliques Columbia Arabidopsis
thaliana cDNA clone SQ189b03F 3', mRNA sequence
Length = 524
Score = 38.2 bits (19), Expect = 3.8
Identities = 31/35 (88%)
Strand = Plus / Minus
Query: 725 gatgtctacagcttcggcgtggtgcttctggagct 759
||||| ||||||||||| ||||| ||||| |||||
Sbjct: 517 gatgtgtacagcttcggtgtggttcttctagagct 483
>gb|AE005172.1| Arabidopsis thaliana chromosome 1, top arm complete sequence
Length = 14221815
Score = 38.2 bits (19), Expect = 3.8
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 782 tggtatgaacaagatcagc 800
|||||||||||||||||||
Sbjct: 10858391 tggtatgaacaagatcagc 10858373
Score = 38.2 bits (19), Expect = 3.8
Identities = 31/35 (88%)
Strand = Plus / Minus
Query: 725 gatgtctacagcttcggcgtggtgcttctggagct 759
|||||||| |||||||| || || |||||||||||
Sbjct: 2331662 gatgtctatagcttcggggttgtccttctggagct 2331628
>gb|AF083784.1| Arabidopsis thaliana clone sps825 unknown mRNA
Length = 2984
Score = 38.2 bits (19), Expect = 3.8
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 723 gcgatgtctacagcttcgg 741
|||||||||||||||||||
Sbjct: 2455 gcgatgtctacagcttcgg 2473
>gb|BT004055.1| Arabidopsis thaliana clone RAFL15-21-H23 (R20468) putative protein
kinase APK1A (At1g07570) mRNA, complete cds
Length = 1492
Score = 38.2 bits (19), Expect = 3.8
Identities = 31/35 (88%)
Strand = Plus / Plus
Query: 725 gatgtctacagcttcggcgtggtgcttctggagct 759
|||||||| |||||||| || || |||||||||||
Sbjct: 864 gatgtctatagcttcggggttgtccttctggagct 898
>gb|BT005112.1| Arabidopsis thaliana clone U20468 putative protein kinase APK1A
(At1g07570) mRNA, complete cds
Length = 1264
Score = 38.2 bits (19), Expect = 3.8
Identities = 31/35 (88%)
Strand = Plus / Plus
Query: 725 gatgtctacagcttcggcgtggtgcttctggagct 759
|||||||| |||||||| || || |||||||||||
Sbjct: 784 gatgtctatagcttcggggttgtccttctggagct 818
>gb|AY085517.1| Arabidopsis thaliana clone 15535 mRNA, complete sequence
Length = 2004
Score = 38.2 bits (19), Expect = 3.8
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 723 gcgatgtctacagcttcgg 741
|||||||||||||||||||
Sbjct: 1251 gcgatgtctacagcttcgg 1269
>dbj|BD248390.1| Gene participating in tolerance against environmental stress
Length = 1257
Score = 38.2 bits (19), Expect = 3.8
Identities = 31/35 (88%)
Strand = Plus / Plus
Query: 725 gatgtctacagcttcggcgtggtgcttctggagct 759
|||||||| |||||||| || || |||||||||||
Sbjct: 796 gatgtctatagcttcggggttgtccttctggagct 830
>gb|AC022464.4|AC022464 Genomic sequence for Arabidopsis thaliana BAC F22G5 from chromosome I,
complete sequence
Length = 104830
Score = 38.2 bits (19), Expect = 3.8
Identities = 31/35 (88%)
Strand = Plus / Plus
Query: 725 gatgtctacagcttcggcgtggtgcttctggagct 759
|||||||| |||||||| || || |||||||||||
Sbjct: 12243 gatgtctatagcttcggggttgtccttctggagct 12277
>gb|AC051626.5|AC051626 Genomic Sequence For Arabidopsis thaliana Clone F20L16 From Chromosome
V, complete sequence
Length = 96050
Score = 38.2 bits (19), Expect = 3.8
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 723 gcgatgtctacagcttcgg 741
|||||||||||||||||||
Sbjct: 87777 gcgatgtctacagcttcgg 87795
>gb|AC069328.1|AC069328 Genomic Sequence For Arabidopsis thaliana Clone T28N17 From Chromosome
V, complete sequence
Length = 75593
Score = 38.2 bits (19), Expect = 3.8
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 723 gcgatgtctacagcttcgg 741
|||||||||||||||||||
Sbjct: 62639 gcgatgtctacagcttcgg 62621
>gb|AC007060.3|T5I8 Arabidopsis thaliana chromosome 1 BAC T5I8 sequence, complete sequence
Length = 96183
Score = 38.2 bits (19), Expect = 3.8
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 782 tggtatgaacaagatcagc 800
|||||||||||||||||||
Sbjct: 24862 tggtatgaacaagatcagc 24844
>gb|AC013288.7|AC013288 Arabidopsis thaliana chromosome 1 BAC F4N21 genomic sequence,
complete sequence
Length = 96899
Score = 38.2 bits (19), Expect = 3.8
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 723 gcgatgtctacagcttcgg 741
|||||||||||||||||||
Sbjct: 1900 gcgatgtctacagcttcgg 1882
>gb|AC083891.4|AC083891 Arabidopsis thaliana chromosome 1 BAC T4O24 genomic sequence, complete
sequence
Length = 35116
Score = 38.2 bits (19), Expect = 3.8
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 723 gcgatgtctacagcttcgg 741
|||||||||||||||||||
Sbjct: 31228 gcgatgtctacagcttcgg 31210
>gb|AC067754.6|AC067754 Arabidopsis thaliana chromosome 1 BAC T9N14 genomic sequence, complete
sequence
Length = 98874
Score = 38.2 bits (19), Expect = 3.8
Identities = 31/35 (88%)
Strand = Plus / Plus
Query: 725 gatgtctacagcttcggcgtggtgcttctggagct 759
||||| ||||||||||| ||||| ||||| |||||
Sbjct: 30823 gatgtgtacagcttcggtgtggttcttctagagct 30857
>gb|AC009755.7|ATAC009755 Arabidopsis thaliana chromosome III BAC F14P3 genomic sequence,
complete sequence
Length = 94369
Score = 38.2 bits (19), Expect = 3.8
Identities = 31/35 (88%)
Strand = Plus / Minus
Query: 725 gatgtctacagcttcggcgtggtgcttctggagct 759
||||| ||||||| ||| ||||||||||| |||||
Sbjct: 90996 gatgtatacagctacggagtggtgcttctagagct 90962
>gb|AC011664.10|ATAC011664 Arabidopsis thaliana chromosome III BAC F1C9 genomic sequence, complete
sequence
Length = 103960
Score = 38.2 bits (19), Expect = 3.8
Identities = 31/35 (88%)
Strand = Plus / Minus
Query: 725 gatgtctacagcttcggcgtggtgcttctggagct 759
||||| ||||||| ||| ||||||||||| |||||
Sbjct: 25452 gatgtatacagctacggagtggtgcttctagagct 25418
>emb|BX830642.1|CNS09ZZZ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTFB9ZD06 of Flowers and buds of strain col-0 of
Arabidopsis thaliana (thale cress)
Length = 1939
Score = 38.2 bits (19), Expect = 3.8
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 723 gcgatgtctacagcttcgg 741
|||||||||||||||||||
Sbjct: 1228 gcgatgtctacagcttcgg 1246
>emb|BX814972.1|CNS0AAM2 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTLS21ZB03 of Adult vegetative tissue of strain col-0
of Arabidopsis thaliana (thale cress)
Length = 2117
Score = 38.2 bits (19), Expect = 3.8
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 723 gcgatgtctacagcttcgg 741
|||||||||||||||||||
Sbjct: 1583 gcgatgtctacagcttcgg 1601
>emb|BX815753.1|CNS0ACU6 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTLS90ZC03 of Adult vegetative tissue of strain col-0
of Arabidopsis thaliana (thale cress)
Length = 1617
Score = 38.2 bits (19), Expect = 3.8
Identities = 31/35 (88%)
Strand = Plus / Plus
Query: 725 gatgtctacagcttcggcgtggtgcttctggagct 759
|||||||| |||||||| || || |||||||||||
Sbjct: 969 gatgtctatagcttcggggttgtccttctggagct 1003
>emb|BX816653.1|CNS0ADBU Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTPGH60ZE10 of Hormone Treated Callus of strain col-0
of Arabidopsis thaliana (thale cress)
Length = 1586
Score = 38.2 bits (19), Expect = 3.8
Identities = 31/35 (88%)
Strand = Plus / Plus
Query: 725 gatgtctacagcttcggcgtggtgcttctggagct 759
|||||||| |||||||| || || |||||||||||
Sbjct: 1037 gatgtctatagcttcggggttgtccttctggagct 1071
>emb|BX814924.1|CNS0ADWK Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTLS19ZD05 of Adult vegetative tissue of strain col-0
of Arabidopsis thaliana (thale cress)
Length = 3509
Score = 38.2 bits (19), Expect = 3.8
Identities = 31/35 (88%)
Strand = Plus / Plus
Query: 725 gatgtctacagcttcggcgtggtgcttctggagct 759
||||| ||||||||||| ||||| ||||| |||||
Sbjct: 3043 gatgtgtacagcttcggtgtggttcttctagagct 3077
>dbj|D12522.1|ATHAPK1A Arabidopsis thaliana APK1 gene for protein
tyrosine-serine-threonine kinase
Length = 1415
Score = 38.2 bits (19), Expect = 3.8
Identities = 31/35 (88%)
Strand = Plus / Plus
Query: 725 gatgtctacagcttcggcgtggtgcttctggagct 759
|||||||| |||||||| || || |||||||||||
Sbjct: 861 gatgtctatagcttcggggttgtccttctggagct 895
>dbj|AK117442.1| Arabidopsis thaliana At3g02130 mRNA for putative protein kinase,
complete cds, clone: RAFL17-04-I18
Length = 3083
Score = 38.2 bits (19), Expect = 3.8
Identities = 31/35 (88%)
Strand = Plus / Plus
Query: 725 gatgtctacagcttcggcgtggtgcttctggagct 759
||||| ||||||| ||| ||||||||||| |||||
Sbjct: 2667 gatgtatacagctacggagtggtgcttctagagct 2701
>dbj|AB101213.1| Arabidopsis thaliana gene for receptor-like protein kinase, complete
cds, strain:Cvi-0
Length = 2362
Score = 38.2 bits (19), Expect = 3.8
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 723 gcgatgtctacagcttcgg 741
|||||||||||||||||||
Sbjct: 1503 gcgatgtctacagcttcgg 1521
>dbj|AB101214.1| Arabidopsis thaliana gene for receptor-like protein kinase, complete
cds, strain:Xxx-0
Length = 2341
Score = 38.2 bits (19), Expect = 3.8
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 723 gcgatgtctacagcttcgg 741
|||||||||||||||||||
Sbjct: 1481 gcgatgtctacagcttcgg 1499
>dbj|AB101216.1| Arabidopsis thaliana gene for receptor-like protein kinase, complete
cds, strain:Yo-0
Length = 2387
Score = 38.2 bits (19), Expect = 3.8
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 723 gcgatgtctacagcttcgg 741
|||||||||||||||||||
Sbjct: 1453 gcgatgtctacagcttcgg 1471
>dbj|AB101217.1| Arabidopsis thaliana gene for receptor-like protein kinase, complete
cds, strain:Gr-1
Length = 2362
Score = 38.2 bits (19), Expect = 3.8
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 723 gcgatgtctacagcttcgg 741
|||||||||||||||||||
Sbjct: 1503 gcgatgtctacagcttcgg 1521
>dbj|AB101218.1| Arabidopsis thaliana gene for receptor-like protein kinase, complete
cds, strain:Pog-0
Length = 2274
Score = 38.2 bits (19), Expect = 3.8
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 723 gcgatgtctacagcttcgg 741
|||||||||||||||||||
Sbjct: 1498 gcgatgtctacagcttcgg 1516
>dbj|AB101219.1| Arabidopsis thaliana gene for receptor-like protein kinase, complete
cds, strain:Ita-0
Length = 2366
Score = 38.2 bits (19), Expect = 3.8
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 723 gcgatgtctacagcttcgg 741
|||||||||||||||||||
Sbjct: 1505 gcgatgtctacagcttcgg 1523
>dbj|AB101220.1| Arabidopsis thaliana gene for receptor-like protein kinase, complete
cds, strain:Ts-1
Length = 2275
Score = 38.2 bits (19), Expect = 3.8
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 723 gcgatgtctacagcttcgg 741
|||||||||||||||||||
Sbjct: 1498 gcgatgtctacagcttcgg 1516
>dbj|AB101221.1| Arabidopsis thaliana gene for receptor-like protein kinase, complete
cds, strain:Kas-1
Length = 2366
Score = 38.2 bits (19), Expect = 3.8
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 723 gcgatgtctacagcttcgg 741
|||||||||||||||||||
Sbjct: 1504 gcgatgtctacagcttcgg 1522
>dbj|AB101224.1| Arabidopsis thaliana gene for receptor-like protein kinase, complete
cds, strain:In-0
Length = 2248
Score = 38.2 bits (19), Expect = 3.8
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 723 gcgatgtctacagcttcgg 741
|||||||||||||||||||
Sbjct: 1471 gcgatgtctacagcttcgg 1489
>dbj|AB101226.1| Arabidopsis thaliana gene for receptor-like protein kinase, complete
cds, strain:Bs-1
Length = 2273
Score = 38.2 bits (19), Expect = 3.8
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 723 gcgatgtctacagcttcgg 741
|||||||||||||||||||
Sbjct: 1496 gcgatgtctacagcttcgg 1514
>dbj|AB101227.1| Arabidopsis thaliana gene for receptor-like protein kinase, complete
cds, strain:Hau-0
Length = 2251
Score = 38.2 bits (19), Expect = 3.8
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 723 gcgatgtctacagcttcgg 741
|||||||||||||||||||
Sbjct: 1472 gcgatgtctacagcttcgg 1490
>dbj|AB101228.1| Arabidopsis thaliana gene for receptor-like protein kinase, complete
cds, strain:UK-2
Length = 2368
Score = 38.2 bits (19), Expect = 3.8
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 723 gcgatgtctacagcttcgg 741
|||||||||||||||||||
Sbjct: 1448 gcgatgtctacagcttcgg 1466
>dbj|AB101229.1| Arabidopsis thaliana gene for receptor-like protein kinase, complete
cds, strain:Rou-0
Length = 2429
Score = 38.2 bits (19), Expect = 3.8
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 723 gcgatgtctacagcttcgg 741
|||||||||||||||||||
Sbjct: 1492 gcgatgtctacagcttcgg 1510
>emb|CQ804206.1| Sequence 617 from Patent WO2004035798
Length = 2934
Score = 38.2 bits (19), Expect = 3.8
Identities = 31/35 (88%)
Strand = Plus / Plus
Query: 725 gatgtctacagcttcggcgtggtgcttctggagct 759
||||| ||||||||||| ||||| ||||| |||||
Sbjct: 2608 gatgtgtacagcttcggtgtggttcttctagagct 2642
>dbj|BA000014.8| Arabidopsis thaliana, chromosome 3, complete sequence
Length = 23403063
Score = 38.2 bits (19), Expect = 3.8
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 723 gcgatgtctacagcttcgg 741
|||||||||||||||||||
Sbjct: 17044355 gcgatgtctacagcttcgg 17044373
Score = 38.2 bits (19), Expect = 3.8
Identities = 31/35 (88%)
Strand = Plus / Minus
Query: 725 gatgtctacagcttcggcgtggtgcttctggagct 759
||||| ||||||| ||| ||||||||||| |||||
Sbjct: 471517 gatgtatacagctacggagtggtgcttctagagct 471483
>emb|AL133298.1|ATF18L15 Arabidopsis thaliana DNA chromosome 3, BAC clone F18L15
Length = 100328
Score = 38.2 bits (19), Expect = 3.8
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 723 gcgatgtctacagcttcgg 741
|||||||||||||||||||
Sbjct: 66494 gcgatgtctacagcttcgg 66512
>gb|AE005173.1| Arabidopsis thaliana chromosome 1, bottom arm complete sequence
Length = 14668883
Score = 38.2 bits (19), Expect = 3.8
Identities = 31/35 (88%)
Strand = Plus / Plus
Query: 725 gatgtctacagcttcggcgtggtgcttctggagct 759
||||| ||||||||||| ||||| ||||| |||||
Sbjct: 11408200 gatgtgtacagcttcggtgtggttcttctagagct 11408234
Score = 38.2 bits (19), Expect = 3.8
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 723 gcgatgtctacagcttcgg 741
|||||||||||||||||||
Sbjct: 9196304 gcgatgtctacagcttcgg 9196322
>ref|NM_102798.1| Arabidopsis thaliana EMB2279 AT1G30610 (EMB2279) mRNA, complete cds
Length = 3021
Score = 38.2 bits (19), Expect = 3.8
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 782 tggtatgaacaagatcagc 800
|||||||||||||||||||
Sbjct: 2230 tggtatgaacaagatcagc 2212
>ref|NM_114508.1| Arabidopsis thaliana ATP binding / kinase/ protein kinase/ protein
serine/threonine kinase/ protein-tyrosine kinase
AT3G46410 mRNA, complete cds
Length = 876
Score = 38.2 bits (19), Expect = 3.8
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 723 gcgatgtctacagcttcgg 741
|||||||||||||||||||
Sbjct: 500 gcgatgtctacagcttcgg 518
>ref|NM_111080.2| Arabidopsis thaliana ATP binding / kinase/ protein serine/threonine
kinase AT3G02130 mRNA, complete cds
Length = 3224
Score = 38.2 bits (19), Expect = 3.8
Identities = 31/35 (88%)
Strand = Plus / Plus
Query: 725 gatgtctacagcttcggcgtggtgcttctggagct 759
||||| ||||||| ||| ||||||||||| |||||
Sbjct: 2667 gatgtatacagctacggagtggtgcttctagagct 2701
>ref|NM_121855.2| Arabidopsis thaliana ATP binding / kinase/ protein kinase/ protein
serine/threonine kinase/ protein-tyrosine kinase
AT5G18500 transcript variant AT5G18500.1 mRNA, complete
cds
Length = 2007
Score = 38.2 bits (19), Expect = 3.8
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 723 gcgatgtctacagcttcgg 741
|||||||||||||||||||
Sbjct: 1251 gcgatgtctacagcttcgg 1269
>ref|NM_105359.2| Arabidopsis thaliana ATP binding / protein kinase/ protein
serine/threonine kinase/ protein-tyrosine kinase
AT1G66880 mRNA, complete cds
Length = 4064
Score = 38.2 bits (19), Expect = 3.8
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 723 gcgatgtctacagcttcgg 741
|||||||||||||||||||
Sbjct: 3443 gcgatgtctacagcttcgg 3461
>ref|NM_105878.2| Arabidopsis thaliana oxidoreductase/ oxidoreductase, acting on the
CH-OH group of donors, NAD or NADP as acceptor AT1G72190
mRNA, complete cds
Length = 1730
Score = 38.2 bits (19), Expect = 3.8
Identities = 31/35 (88%)
Strand = Plus / Minus
Query: 725 gatgtctacagcttcggcgtggtgcttctggagct 759
||||| ||||||||||| ||||| ||||| |||||
Sbjct: 1723 gatgtgtacagcttcggtgtggttcttctagagct 1689
>ref|NM_100631.3| Arabidopsis thaliana APK1A; kinase AT1G07570 (APK1A) transcript
variant AT1G07570.1 mRNA, complete cds
Length = 1617
Score = 38.2 bits (19), Expect = 3.8
Identities = 31/35 (88%)
Strand = Plus / Plus
Query: 725 gatgtctacagcttcggcgtggtgcttctggagct 759
|||||||| |||||||| || || |||||||||||
Sbjct: 969 gatgtctatagcttcggggttgtccttctggagct 1003
>ref|NM_105877.3| Arabidopsis thaliana ATP binding / kinase/ protein serine/threonine
kinase AT1G72180 mRNA, complete cds
Length = 3593
Score = 38.2 bits (19), Expect = 3.8
Identities = 31/35 (88%)
Strand = Plus / Plus
Query: 725 gatgtctacagcttcggcgtggtgcttctggagct 759
||||| ||||||||||| ||||| ||||| |||||
Sbjct: 3041 gatgtgtacagcttcggtgtggttcttctagagct 3075
>ref|NM_202049.1| Arabidopsis thaliana APK1A; kinase AT1G07570 (APK1A) transcript
variant AT1G07570.2 mRNA, complete cds
Length = 1631
Score = 38.2 bits (19), Expect = 3.8
Identities = 31/35 (88%)
Strand = Plus / Plus
Query: 725 gatgtctacagcttcggcgtggtgcttctggagct 759
|||||||| |||||||| || || |||||||||||
Sbjct: 1039 gatgtctatagcttcggggttgtccttctggagct 1073
>ref|NM_001036821.1| Arabidopsis thaliana ATP binding / kinase/ protein kinase/ protein
serine/threonine kinase/ protein-tyrosine kinase
AT5G18500 transcript variant AT5G18500.2 mRNA, complete
cds
Length = 1971
Score = 38.2 bits (19), Expect = 3.8
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 723 gcgatgtctacagcttcgg 741
|||||||||||||||||||
Sbjct: 1215 gcgatgtctacagcttcgg 1233
>ref|NC_003074.4| Arabidopsis thaliana chromosome 3, complete sequence
Length = 23470805
Score = 38.2 bits (19), Expect = 3.8
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 723 gcgatgtctacagcttcgg 741
|||||||||||||||||||
Sbjct: 17091293 gcgatgtctacagcttcgg 17091311
Score = 38.2 bits (19), Expect = 3.8
Identities = 31/35 (88%)
Strand = Plus / Plus
Query: 725 gatgtctacagcttcggcgtggtgcttctggagct 759
||||| ||||||| ||| ||||||||||| |||||
Sbjct: 383892 gatgtatacagctacggagtggtgcttctagagct 383926
>ref|NC_003070.5| Arabidopsis thaliana chromosome 1, complete sequence
Length = 30432563
Score = 38.2 bits (19), Expect = 3.8
Identities = 31/35 (88%)
Strand = Plus / Plus
Query: 725 gatgtctacagcttcggcgtggtgcttctggagct 759
||||| ||||||||||| ||||| ||||| |||||
Sbjct: 27170540 gatgtgtacagcttcggtgtggttcttctagagct 27170574
Score = 38.2 bits (19), Expect = 3.8
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 723 gcgatgtctacagcttcgg 741
|||||||||||||||||||
Sbjct: 24958653 gcgatgtctacagcttcgg 24958671
Score = 38.2 bits (19), Expect = 3.8
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 782 tggtatgaacaagatcagc 800
|||||||||||||||||||
Sbjct: 10849593 tggtatgaacaagatcagc 10849575
Score = 38.2 bits (19), Expect = 3.8
Identities = 31/35 (88%)
Strand = Plus / Minus
Query: 725 gatgtctacagcttcggcgtggtgcttctggagct 759
|||||||| |||||||| || || |||||||||||
Sbjct: 2331815 gatgtctatagcttcggggttgtccttctggagct 2331781
Database: At_nucl_with_EST.fasta
Posted date: May 2, 2006 2:53 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 622,260
Number of Sequences: 1013581
Number of extensions: 622260
Number of successful extensions: 49704
Number of sequences better than 10.0: 72
Number of HSP's better than 10.0 without gapping: 82
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 44886
Number of HSP's gapped (non-prelim): 4818
length of query: 1348
length of database: 908,940,872
effective HSP length: 21
effective length of query: 1327
effective length of database: 887,655,671
effective search space: 1177919075417
effective search space used: 1177919075417
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)