BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 131537.2.226
(818 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AV557321.1|AV557321 AV557321 Arabidopsis thaliana green ... 105 1e-020
gb|CB255588.1|CB255588 37-E015391-019-006-I09-T7R MPIZ-ADIS... 105 1e-020
gb|AF130878.1|AF130878 Arabidopsis thaliana phosphoribosyla... 105 1e-020
gb|AE005172.1| Arabidopsis thaliana chromosome 1, top arm c... 105 1e-020
gb|AY070760.1| Arabidopsis thaliana At1g07790/F24B9_10 mRNA... 105 1e-020
gb|AY133638.1| Arabidopsis thaliana At1g07790/F24B9_10 mRNA... 105 1e-020
gb|AF332446.1| Arabidopsis thaliana clone C00142 (p) putati... 105 1e-020
gb|AC007583.2|F24B9 Arabidopsis thaliana chromosome 1 BAC F... 105 1e-020
ref|NM_100653.2| Arabidopsis thaliana DNA binding AT1G07790... 105 1e-020
ref|NC_003070.5| Arabidopsis thaliana chromosome 1, complet... 105 1e-020
gb|U34757.2|ATU34757 Arabidopsis thaliana phosphoribosylant... 98 3e-018
gb|AY088636.1| Arabidopsis thaliana clone 8711 mRNA, comple... 98 3e-018
gb|CK118206.1|CK118206 217m08.p1 AtM1 Arabidopsis thaliana ... 90 7e-016
emb|AL758292.1| Arabidopsis thaliana T-DNA flanking sequenc... 88 3e-015
gb|AV540331.1|AV540331 AV540331 Arabidopsis thaliana roots ... 88 3e-015
gb|BP619021.1|BP619021 BP619021 RAFL16 Arabidopsis thaliana... 88 3e-015
gb|BP787756.1|BP787756 BP787756 RAFL7 Arabidopsis thaliana ... 88 3e-015
gb|BP586960.1|BP586960 BP586960 RAFL15 Arabidopsis thaliana... 80 7e-013
gb|AY357734.1| Arabidopsis thaliana phosphoribosylanthranil... 80 7e-013
gb|BH610928.1|BH610928 SALK_018246 Arabidopsis thaliana TDN... 76 1e-011
gb|BZ288838.1|BZ288838 SALK_022228.56.00.x Arabidopsis thal... 76 1e-011
gb|BZ289176.1|BZ289176 SALK_022573.48.40.x Arabidopsis thal... 76 1e-011
gb|BZ769396.1|BZ769396 SALK_142124.48.80.x Arabidopsis thal... 76 1e-011
gb|T22855.1|T22855 4863 Lambda-PRL2 Arabidopsis thaliana cD... 76 1e-011
gb|AI999101.1|AI999101 701554459 A. thaliana, Columbia Col-... 76 1e-011
gb|BU636121.1|BU636121 045G06 Infected Arabidopsis Leaf Ara... 76 1e-011
gb|CB074430.1|CB074430 EST00945 Virulent Peronospora parasi... 76 1e-011
gb|CF652319.1|CF652319 48-L020164-066-001-O12-SP6P MPIZ-ADI... 76 1e-011
gb|AV521723.1|AV521723 AV521723 Arabidopsis thaliana aboveg... 76 1e-011
gb|AV557883.1|AV557883 AV557883 Arabidopsis thaliana green ... 76 1e-011
gb|AV559679.1|AV559679 AV559679 Arabidopsis thaliana green ... 76 1e-011
gb|AV562999.1|AV562999 AV562999 Arabidopsis thaliana green ... 76 1e-011
gb|CF773114.1|CF773114 AG_FSL_13B10 Arabidopsis ag-1 35S:AG... 76 1e-011
gb|CK117656.1|CK117656 215c08.p1 AtM1 Arabidopsis thaliana ... 76 1e-011
gb|CK117801.1|CK117801 204g20.p1 AtM1 Arabidopsis thaliana ... 76 1e-011
gb|CK118307.1|CK118307 217h22.p1 AtM1 Arabidopsis thaliana ... 76 1e-011
gb|CK118414.1|CK118414 217b16.p1 AtM1 Arabidopsis thaliana ... 76 1e-011
gb|CK118523.1|CK118523 216n23.p1 AtM1 Arabidopsis thaliana ... 76 1e-011
gb|CK119903.1|CK119903 210g05.p1 AtM1 Arabidopsis thaliana ... 76 1e-011
gb|CK120137.1|CK120137 208l20.p1 AtM1 Arabidopsis thaliana ... 76 1e-011
gb|CK120144.1|CK120144 208l13.p1 AtM1 Arabidopsis thaliana ... 76 1e-011
gb|CK121154.1|CK121154 204f20.p1 AtM1 Arabidopsis thaliana ... 76 1e-011
gb|CK121335.1|CK121335 203j20.p1 AtM1 Arabidopsis thaliana ... 76 1e-011
gb|CK121656.1|CK121656 202f07.p1 AtM1 Arabidopsis thaliana ... 76 1e-011
gb|BP581187.1|BP581187 BP581187 RAFL14 Arabidopsis thaliana... 76 1e-011
gb|BP591446.1|BP591446 BP591446 RAFL15 Arabidopsis thaliana... 76 1e-011
gb|BP591469.1|BP591469 BP591469 RAFL15 Arabidopsis thaliana... 76 1e-011
gb|BP562087.2|BP562087 BP562087 RAFL9 Arabidopsis thaliana ... 76 1e-011
gb|CB253302.1|CB253302 05-E010699-019-002-J02-T7R MPIZ-ADIS... 76 1e-011
gb|CB255379.1|CB255379 43-E012994-019-004-F11-SP6r MPIZ-ADI... 76 1e-011
gb|CB255382.1|CB255382 43-E012999-019-004-F11-T7R MPIZ-ADIS... 76 1e-011
gb|BP802897.1|BP802897 BP802897 RAFL14 Arabidopsis thaliana... 76 1e-011
gb|BP812450.1|BP812450 BP812450 RAFL19 Arabidopsis thaliana... 76 1e-011
gb|BP814260.1|BP814260 BP814260 RAFL19 Arabidopsis thaliana... 76 1e-011
gb|BP814381.1|BP814381 BP814381 RAFL19 Arabidopsis thaliana... 76 1e-011
gb|BP827738.1|BP827738 BP827738 RAFL19 Arabidopsis thaliana... 76 1e-011
gb|BP831132.1|BP831132 BP831132 RAFL19 Arabidopsis thaliana... 76 1e-011
gb|BP834415.1|BP834415 BP834415 RAFL19 Arabidopsis thaliana... 76 1e-011
gb|BP836681.1|BP836681 BP836681 RAFL19 Arabidopsis thaliana... 76 1e-011
gb|BP837073.1|BP837073 BP837073 RAFL19 Arabidopsis thaliana... 76 1e-011
gb|BP854448.1|BP854448 BP854448 RAFL21 Arabidopsis thaliana... 76 1e-011
gb|BP867288.1|BP867288 BP867288 RAFL21 Arabidopsis thaliana... 76 1e-011
gb|AY057643.1| Arabidopsis thaliana AT5g59910/mmn10_130 mRN... 76 1e-011
gb|AY086049.1| Arabidopsis thaliana clone 20822 mRNA, compl... 76 1e-011
dbj|AB015475.1| Arabidopsis thaliana genomic DNA, chromosom... 76 1e-011
emb|CQ804484.1| Sequence 895 from Patent WO2004035798 76 1e-011
dbj|BA000015.5| Arabidopsis thaliana DNA, chromosome 5, com... 76 1e-011
gb|BT020297.1| Arabidopsis thaliana At5g59910 gene, complet... 76 1e-011
ref|NM_125384.2| Arabidopsis thaliana DNA binding AT5G59910... 76 1e-011
ref|NC_003076.4| Arabidopsis thaliana chromosome 5, complet... 76 1e-011
gb|CC792902.1|CC792902 SALK_003306.56.00.n Arabidopsis thal... 74 4e-011
gb|Z29157.1|Z29157 ATTS2103 Versailles-VB Arabidopsis thali... 74 4e-011
gb|AU226784.1|AU226784 AU226784 RAFL14 Arabidopsis thaliana... 74 4e-011
gb|AU235990.1|AU235990 AU235990 RAFL14 Arabidopsis thaliana... 74 4e-011
gb|CK121749.1|CK121749 201a19.p1 AtM1 Arabidopsis thaliana ... 74 4e-011
gb|CB254707.1|CB254707 62-E012995-019-004-L16-SP6r MPIZ-ADI... 74 4e-011
gb|CB254710.1|CB254710 62-E013000-019-004-L16-T7R MPIZ-ADIS... 74 4e-011
gb|BP817957.1|BP817957 BP817957 RAFL19 Arabidopsis thaliana... 74 4e-011
gb|BP839918.1|BP839918 BP839918 RAFL19 Arabidopsis thaliana... 74 4e-011
gb|BT005206.1| Arabidopsis thaliana At2g37470 mRNA, complet... 74 4e-011
gb|AY087125.1| Arabidopsis thaliana clone 31973 mRNA, compl... 74 4e-011
gb|AC005896.3| Arabidopsis thaliana chromosome 2 clone F3G5... 74 4e-011
emb|BX821556.1|CNS0AAGB Arabidopsis thaliana Full-length cD... 74 4e-011
ref|NM_129302.2| Arabidopsis thaliana DNA binding AT2G37470... 74 4e-011
ref|NC_003071.3| Arabidopsis thaliana chromosome 2, complet... 74 4e-011
gb|BH617416.1|BH617416 SALK_036467 Arabidopsis thaliana TDN... 72 2e-010
gb|C99813.1|C99813 C99813 YAC clone CIC8B11 region-specific... 72 2e-010
gb|CK120461.1|CK120461 218k04.p1 AtM1 Arabidopsis thaliana ... 72 2e-010
gb|CK120549.1|CK120549 207d05.p1 AtM1 Arabidopsis thaliana ... 72 2e-010
gb|AF471815.1| Arabidopsis thaliana ecotype HODJA chromosom... 72 2e-010
gb|AF471816.1| Arabidopsis thaliana ecotype CAL-0 chromosom... 72 2e-010
gb|AF471817.1| Arabidopsis thaliana ecotype MRK-0 chromosom... 72 2e-010
gb|AF471818.1| Arabidopsis thaliana ecotype CVI-0 chromosom... 72 2e-010
gb|AF471819.1| Arabidopsis thaliana ecotype PA-1 chromosome... 72 2e-010
gb|AF471820.1| Arabidopsis thaliana ecotype CNT-1 chromosom... 72 2e-010
gb|AF471821.1| Arabidopsis thaliana ecotype POG-0 chromosom... 72 2e-010
gb|AF471822.1| Arabidopsis thaliana ecotype CAN-0 chromosom... 72 2e-010
gb|AF471823.1| Arabidopsis thaliana ecotype DIJON_G chromos... 72 2e-010
gb|AF471824.1| Arabidopsis thaliana ecotype PETERGOF chromo... 72 2e-010
gb|AF471825.1| Arabidopsis thaliana ecotype LIP-0 chromosom... 72 2e-010
gb|AF471826.1| Arabidopsis thaliana ecotype LER-0 chromosom... 72 2e-010
gb|AF471827.1| Arabidopsis thaliana ecotype EI-2 chromosome... 72 2e-010
gb|AF471828.1| Arabidopsis thaliana ecotype SORBO chromosom... 72 2e-010
gb|AF471829.1| Arabidopsis thaliana ecotype KAS-1 chromosom... 72 2e-010
gb|AF471830.1| Arabidopsis thaliana ecotype TAC chromosome ... 72 2e-010
gb|AF471831.1| Arabidopsis thaliana ecotype KONDARA chromos... 72 2e-010
gb|AF471832.1| Arabidopsis thaliana ecotype ITA-0 chromosom... 72 2e-010
gb|R30263.1|R30263 12868 Lambda-PRL2 Arabidopsis thaliana c... 68 3e-009
gb|CB185859.1|CB185859 EST01050 Arabidopsis virulent Pseudo... 68 3e-009
gb|BP803510.1|BP803510 BP803510 RAFL14 Arabidopsis thaliana... 68 3e-009
gb|BP822410.1|BP822410 BP822410 RAFL19 Arabidopsis thaliana... 68 3e-009
gb|BP823124.1|BP823124 BP823124 RAFL19 Arabidopsis thaliana... 68 3e-009
gb|BP824782.1|BP824782 BP824782 RAFL19 Arabidopsis thaliana... 68 3e-009
gb|BP835400.1|BP835400 BP835400 RAFL19 Arabidopsis thaliana... 68 3e-009
gb|BP837675.1|BP837675 BP837675 RAFL19 Arabidopsis thaliana... 68 3e-009
gb|Z18202.1|Z18202 ATTS0707 Grenoble-B Arabidopsis thaliana... 68 3e-009
gb|U18970.1|ATU18970 Arabidopsis thaliana phosphoribosylant... 68 3e-009
gb|AF471833.1| Arabidopsis thaliana ecotype PLA-0 chromosom... 68 3e-009
gb|AF471834.1| Arabidopsis thaliana ecotype BLA-10 chromoso... 68 3e-009
gb|BP652615.1|BP652615 BP652615 RAFL19 Arabidopsis thaliana... 66 1e-008
gb|CL489531.1|CL489531 SAIL_525_F04.v1 SAIL Collection Arab... 64 4e-008
gb|AF471806.1| Arabidopsis thaliana ecotype BL-1 chromosome... 64 4e-008
gb|AF471807.1| Arabidopsis thaliana ecotype NO-0 chromosome... 64 4e-008
gb|AF471808.1| Arabidopsis thaliana ecotype TSU-1 chromosom... 64 4e-008
gb|AF471809.1| Arabidopsis thaliana ecotype YO-0 chromosome... 64 4e-008
gb|AF471810.1| Arabidopsis thaliana ecotype WL-0 chromosome... 64 4e-008
gb|AF471811.1| Arabidopsis thaliana ecotype SEI-0 chromosom... 64 4e-008
gb|AF471812.1| Arabidopsis thaliana ecotype PI-0 chromosome... 64 4e-008
gb|AF471813.1| Arabidopsis thaliana ecotype KA-0 chromosome... 64 4e-008
gb|AF471814.1| Arabidopsis thaliana ecotype SU-0 chromosome... 64 4e-008
gb|T13853.1|T13853 2018 Lambda-PRL2 Arabidopsis thaliana cD... 62 2e-007
gb|BP819311.1|BP819311 BP819311 RAFL19 Arabidopsis thaliana... 62 2e-007
gb|AF471835.1| Arabidopsis thaliana ecotype DI-1 chromosome... 62 2e-007
gb|AF471836.1| Arabidopsis thaliana ecotype LM-2 chromosome... 62 2e-007
gb|AF471844.1| Arabidopsis thaliana ecotype KIL-0 chromosom... 62 2e-007
gb|CL469572.1|CL469572 SAIL_1307_B05.v1 SAIL Collection Ara... 60 6e-007
emb|CR401647.1| Arabidopsis thaliana T-DNA flanking sequenc... 60 6e-007
emb|CR401648.1| Arabidopsis thaliana T-DNA flanking sequenc... 60 6e-007
emb|CR401845.1| Arabidopsis thaliana T-DNA flanking sequenc... 60 6e-007
emb|CR401846.1| Arabidopsis thaliana T-DNA flanking sequenc... 60 6e-007
gb|Z26871.1|Z26871 ATTS1876 AC16H Arabidopsis thaliana cDNA... 60 6e-007
gb|Z47622.1|Z47622 ATTS4478 AC16H Arabidopsis thaliana cDNA... 60 6e-007
gb|AU235967.1|AU235967 AU235967 RAFL14 Arabidopsis thaliana... 60 6e-007
gb|CA963968.1|CA963968 cATI008B02AF Infected Arabidopsis Le... 60 6e-007
gb|CK117669.1|CK117669 214j19.p1 AtM1 Arabidopsis thaliana ... 60 6e-007
gb|CK118019.1|CK118019 207g23.p1 AtM1 Arabidopsis thaliana ... 60 6e-007
gb|CK119044.1|CK119044 214l11.p1 AtM1 Arabidopsis thaliana ... 60 6e-007
gb|CK119663.1|CK119663 211c17.p1 AtM1 Arabidopsis thaliana ... 60 6e-007
gb|BP585021.1|BP585021 BP585021 RAFL15 Arabidopsis thaliana... 60 6e-007
gb|CB252338.1|CB252338 29-E010007-019-001-I04-T7R MPIZ-ADIS... 60 6e-007
gb|CB253051.1|CB253051 10-E018437-019-009-C03-T7R MPIZ-ADIS... 60 6e-007
gb|CB253829.1|CB253829 87-E012997-019-004-M21-T7R MPIZ-ADIS... 60 6e-007
gb|CB255418.1|CB255418 42-E010007-019-001-C06-T7R MPIZ-ADIS... 60 6e-007
gb|BP821530.1|BP821530 BP821530 RAFL19 Arabidopsis thaliana... 60 6e-007
gb|BP822970.1|BP822970 BP822970 RAFL19 Arabidopsis thaliana... 60 6e-007
gb|BP826014.1|BP826014 BP826014 RAFL19 Arabidopsis thaliana... 60 6e-007
gb|BP829410.1|BP829410 BP829410 RAFL19 Arabidopsis thaliana... 60 6e-007
gb|BP839371.1|BP839371 BP839371 RAFL19 Arabidopsis thaliana... 60 6e-007
gb|BP840507.1|BP840507 BP840507 RAFL19 Arabidopsis thaliana... 60 6e-007
gb|BP856858.1|BP856858 BP856858 RAFL21 Arabidopsis thaliana... 60 6e-007
gb|AF471837.1| Arabidopsis thaliana ecotype MT-0 chromosome... 60 6e-007
gb|AF471838.1| Arabidopsis thaliana ecotype COL-0 chromosom... 60 6e-007
gb|AF471839.1| Arabidopsis thaliana ecotype AG-0 chromosome... 60 6e-007
gb|AF471840.1| Arabidopsis thaliana ecotype GY-0 chromosome... 60 6e-007
gb|AF471841.1| Arabidopsis thaliana ecotype AA-0 chromosome... 60 6e-007
gb|AF471842.1| Arabidopsis thaliana ecotype DI-0 chromosome... 60 6e-007
gb|AF471843.1| Arabidopsis thaliana ecotype MA-0 chromosome... 60 6e-007
emb|AX506052.1| Sequence 747 from Patent WO0216655 60 6e-007
emb|BX833190.1|CNS0A0CG Arabidopsis thaliana Full-length cD... 60 6e-007
dbj|AB005243.1| Arabidopsis thaliana genomic DNA, chromosom... 60 6e-007
emb|CQ804822.1| Sequence 1233 from Patent WO2004035798 60 6e-007
emb|AJ839038.1| Arabidopsis thaliana T-DNA flanking sequenc... 60 6e-007
emb|Y07745.1|ATHISH2BL A.thaliana mRNA histone H2B like pro... 60 6e-007
ref|NM_122194.2| Arabidopsis thaliana DNA binding AT5G22880... 60 6e-007
gb|CL470783.1|CL470783 SAIL_148_C12.v1 SAIL Collection Arab... 58 2e-006
gb|CL491089.1|CL491089 SAIL_551_H02.v1 SAIL Collection Arab... 58 2e-006
gb|CW801553.1|CW801553 WiscDsLox494B05 Arabidopsis thaliana... 58 2e-006
gb|AY202019.1|AY202019 AY202019 Arabidopsis thaliana Landsb... 58 2e-006
gb|AY202020.1|AY202020 AY202020 Arabidopsis thaliana Landsb... 58 2e-006
gb|T04097.1|T04097 47 Lambda-PRL1 Arabidopsis thaliana cDNA... 58 2e-006
gb|AA712800.1|AA712800 32359 Lambda-PRL2 Arabidopsis thalia... 58 2e-006
gb|T14148.1|T14148 2313 Lambda-PRL2 Arabidopsis thaliana cD... 58 2e-006
gb|AU226337.1|AU226337 AU226337 RAFL14 Arabidopsis thaliana... 58 2e-006
gb|AV821359.1|AV821359 AV821359 RAFL4 Arabidopsis thaliana ... 58 2e-006
gb|AU235602.1|AU235602 AU235602 RAFL14 Arabidopsis thaliana... 58 2e-006
gb|CB262791.1|CB262791 46-E8976-008-017-L11-pBl2 MPIZ-ADIS-... 58 2e-006
gb|CB263874.1|CB263874 06-E9721-008-016-K01-pBl2 MPIZ-ADIS-... 58 2e-006
gb|CF651964.1|CF651964 25-L020578-066-004-A08-SP6P MPIZ-ADI... 58 2e-006
gb|CF652901.1|CF652901 83-L020526w-066-003-F22-SP6P MPIZ-AD... 58 2e-006
gb|AV552384.1|AV552384 AV552384 Arabidopsis thaliana roots ... 58 2e-006
gb|CK117943.1|CK117943 209b05.p1 AtM1 Arabidopsis thaliana ... 58 2e-006
gb|CK117978.1|CK117978 208m23.p1 AtM1 Arabidopsis thaliana ... 58 2e-006
gb|CK117979.1|CK117979 208m24.p1 AtM1 Arabidopsis thaliana ... 58 2e-006
gb|CK118052.1|CK118052 218h23.p1 AtM1 Arabidopsis thaliana ... 58 2e-006
gb|CK118120.1|CK118120 218a09.p1 AtM1 Arabidopsis thaliana ... 58 2e-006
gb|CK119134.1|CK119134 214b21.p1 AtM1 Arabidopsis thaliana ... 58 2e-006
gb|CK119155.1|CK119155 214a19.p1 AtM1 Arabidopsis thaliana ... 58 2e-006
gb|CK121285.1|CK121285 203m24.p1 AtM1 Arabidopsis thaliana ... 58 2e-006
gb|CK121397.1|CK121397 203f14.p1 AtM1 Arabidopsis thaliana ... 58 2e-006
gb|CK121854.1|CK121854 212m17.p1 AtM1 Arabidopsis thaliana ... 58 2e-006
gb|BP561503.1|BP561503 BP561503 RAFL7 Arabidopsis thaliana ... 58 2e-006
gb|BP592573.1|BP592573 BP592573 RAFL15 Arabidopsis thaliana... 58 2e-006
gb|BP642219.1|BP642219 BP642219 RAFL19 Arabidopsis thaliana... 58 2e-006
gb|BP796377.1|BP796377 BP796377 RAFL5 Arabidopsis thaliana ... 58 2e-006
gb|BP801969.1|BP801969 BP801969 RAFL14 Arabidopsis thaliana... 58 2e-006
gb|BP803966.1|BP803966 BP803966 RAFL14 Arabidopsis thaliana... 58 2e-006
gb|BP805281.1|BP805281 BP805281 RAFL16 Arabidopsis thaliana... 58 2e-006
gb|BP810218.1|BP810218 BP810218 RAFL16 Arabidopsis thaliana... 58 2e-006
gb|BP815361.1|BP815361 BP815361 RAFL19 Arabidopsis thaliana... 58 2e-006
gb|BP815526.1|BP815526 BP815526 RAFL19 Arabidopsis thaliana... 58 2e-006
gb|BP823037.1|BP823037 BP823037 RAFL19 Arabidopsis thaliana... 58 2e-006
gb|BP823425.1|BP823425 BP823425 RAFL19 Arabidopsis thaliana... 58 2e-006
gb|BP826623.1|BP826623 BP826623 RAFL19 Arabidopsis thaliana... 58 2e-006
gb|BP834871.1|BP834871 BP834871 RAFL19 Arabidopsis thaliana... 58 2e-006
gb|BP836150.1|BP836150 BP836150 RAFL19 Arabidopsis thaliana... 58 2e-006
gb|BP840182.1|BP840182 BP840182 RAFL19 Arabidopsis thaliana... 58 2e-006
gb|BP846772.1|BP846772 BP846772 RAFL21 Arabidopsis thaliana... 58 2e-006
gb|AF102173.1|AF102173 Arabidopsis thaliana actin depolymer... 58 2e-006
gb|AY084352.1| Arabidopsis thaliana clone 10517 mRNA, compl... 58 2e-006
gb|AY087219.1| Arabidopsis thaliana clone 32930 mRNA, compl... 58 2e-006
gb|BT006400.1| Arabidopsis thaliana At3g45980 gene, complet... 58 2e-006
emb|BX822784.1|CNS0A4UQ Arabidopsis thaliana Full-length cD... 58 2e-006
emb|BX824094.1|CNS0A6W9 Arabidopsis thaliana Full-length cD... 58 2e-006
emb|BX816118.1|CNS0ABRU Arabidopsis thaliana Full-length cD... 58 2e-006
emb|BX816346.1|CNS0ABM4 Arabidopsis thaliana Full-length cD... 58 2e-006
dbj|BA000014.8| Arabidopsis thaliana, chromosome 3, complet... 58 2e-006
emb|AL132966.1|ATF4P12 Arabidopsis thaliana DNA chromosome ... 58 2e-006
emb|AL162459.2|ATF16L2 Arabidopsis thaliana DNA chromosome ... 58 2e-006
emb|Y12576.1|ATH2B Arabidopsis thaliana mRNA for histone H2B 58 2e-006
ref|NM_115225.1| Arabidopsis thaliana DNA binding AT3G53650... 58 2e-006
ref|NM_114472.2| Arabidopsis thaliana DNA binding AT3G46030... 58 2e-006
ref|NM_114467.3| Arabidopsis thaliana DNA binding AT3G45980... 58 2e-006
ref|NC_003074.4| Arabidopsis thaliana chromosome 3, complet... 58 2e-006
emb|AL952711.1| Arabidopsis thaliana T-DNA flanking sequenc... 56 1e-005
gb|T45496.1|T45496 8759 Lambda-PRL2 Arabidopsis thaliana cD... 56 1e-005
gb|BP565667.1|BP565667 BP565667 RAFL14 Arabidopsis thaliana... 56 1e-005
gb|CL491150.1|CL491150 SAIL_553_B04.v3 SAIL Collection Arab... 54 4e-005
gb|R29809.1|R29809 12414 Lambda-PRL2 Arabidopsis thaliana c... 54 4e-005
gb|BP641660.1|BP641660 BP641660 RAFL19 Arabidopsis thaliana... 54 4e-005
gb|BP643336.1|BP643336 BP643336 RAFL19 Arabidopsis thaliana... 54 4e-005
gb|B76780.1|B76780 T26G2TR TAMU Arabidopsis thaliana genomi... 52 2e-004
gb|AY202021.1|AY202021 AY202021 Arabidopsis thaliana Landsb... 52 2e-004
gb|T22899.1|T22899 4907 Lambda-PRL2 Arabidopsis thaliana cD... 52 2e-004
gb|T43468.1|T43468 6731 Lambda-PRL2 Arabidopsis thaliana cD... 52 2e-004
gb|T88557.1|T88557 12253 Lambda-PRL2 Arabidopsis thaliana c... 52 2e-004
gb|AI992655.1|AI992655 701558589 A. thaliana, Ohio State cl... 52 2e-004
gb|AI999726.1|AI999726 701557189 A. thaliana, Columbia Col-... 52 2e-004
gb|AV828931.1|AV828931 AV828931 RAFL9 Arabidopsis thaliana ... 52 2e-004
gb|BU635121.1|BU635121 016A12 Infected Arabidopsis Leaf Ara... 52 2e-004
gb|CB263606.1|CB263606 14-E8975-008-017-K04-pBl2 MPIZ-ADIS-... 52 2e-004
gb|CF651258.1|CF651258 41-E009213w-013-001-A11-T7R MPIZ-ADI... 52 2e-004
gb|CF651259.1|CF651259 41-E021106-013-001-A11-T7R MPIZ-ADIS... 52 2e-004
gb|BP564421.1|BP564421 BP564421 RAFL14 Arabidopsis thaliana... 52 2e-004
gb|BP565885.1|BP565885 BP565885 RAFL14 Arabidopsis thaliana... 52 2e-004
gb|BP579872.1|BP579872 BP579872 RAFL14 Arabidopsis thaliana... 52 2e-004
gb|BP596496.1|BP596496 BP596496 RAFL15 Arabidopsis thaliana... 52 2e-004
gb|BP597674.1|BP597674 BP597674 RAFL15 Arabidopsis thaliana... 52 2e-004
gb|BP816537.1|BP816537 BP816537 RAFL19 Arabidopsis thaliana... 52 2e-004
gb|BP834170.1|BP834170 BP834170 RAFL19 Arabidopsis thaliana... 52 2e-004
gb|BP855856.1|BP855856 BP855856 RAFL21 Arabidopsis thaliana... 52 2e-004
gb|BP864961.1|BP864961 BP864961 RAFL21 Arabidopsis thaliana... 52 2e-004
gb|BP866899.1|BP866899 BP866899 RAFL21 Arabidopsis thaliana... 52 2e-004
gb|AY057605.1| Arabidopsis thaliana At2g28720/T11P11.3 mRNA... 52 2e-004
gb|AF325075.1|AF325075 Arabidopsis thaliana putative histon... 52 2e-004
gb|AY124835.1| Arabidopsis thaliana At2g28720/T11P11.3 mRNA... 52 2e-004
emb|AX507201.1| Sequence 1896 from Patent WO0216655 52 2e-004
gb|AY085391.1| Arabidopsis thaliana clone 14965 mRNA, compl... 52 2e-004
gb|AC007184.4| Arabidopsis thaliana chromosome 2 clone T11P... 52 2e-004
emb|BX819107.1|CNS0AA81 Arabidopsis thaliana Full-length cD... 52 2e-004
emb|BX813779.1|CNS0AEHZ Arabidopsis thaliana Full-length cD... 52 2e-004
ref|NM_128433.3| Arabidopsis thaliana DNA binding AT2G28720... 52 2e-004
emb|AL094930.1|CNS00XIS Arabidopsis thaliana genome survey ... 50 6e-004
gb|CL494398.1|CL494398 SAIL_594_A07.v1 SAIL Collection Arab... 50 6e-004
gb|CL499371.1|CL499371 SAIL_667_G10.v1 SAIL Collection Arab... 50 6e-004
gb|BP570834.1|BP570834 BP570834 RAFL14 Arabidopsis thaliana... 50 6e-004
gb|BP608591.1|BP608591 BP608591 RAFL16 Arabidopsis thaliana... 50 6e-004
gb|BP647465.1|BP647465 BP647465 RAFL19 Arabidopsis thaliana... 50 6e-004
gb|CB252613.1|CB252613 21-E018362-019-007-J05-T7R MPIZ-ADIS... 50 6e-004
gb|BP804090.1|BP804090 BP804090 RAFL14 Arabidopsis thaliana... 50 6e-004
gb|R83948.1|R83948 15907 Lambda-PRL2 Arabidopsis thaliana c... 48 0.002
gb|T21790.1|T21790 3798 Lambda-PRL2 Arabidopsis thaliana cD... 48 0.002
gb|BP595243.1|BP595243 BP595243 RAFL15 Arabidopsis thaliana... 48 0.002
gb|BP595772.1|BP595772 BP595772 RAFL15 Arabidopsis thaliana... 48 0.002
gb|BP624380.1|BP624380 BP624380 RAFL17 Arabidopsis thaliana... 48 0.002
gb|BP812005.1|BP812005 BP812005 RAFL19 Arabidopsis thaliana... 48 0.002
emb|CR399380.1| Arabidopsis thaliana T-DNA flanking sequenc... 46 0.009
gb|CW796725.1|CW796725 WiscDsLox465C5 Arabidopsis thaliana ... 46 0.009
gb|AA720269.1|AA720269 33462 Lambda-PRL2 Arabidopsis thalia... 46 0.009
gb|T42349.1|T42349 5612 Lambda-PRL2 Arabidopsis thaliana cD... 46 0.009
gb|AI100688.1|AI100688 34385 Lambda-PRL2 Arabidopsis thalia... 46 0.009
gb|BP568688.1|BP568688 BP568688 RAFL14 Arabidopsis thaliana... 46 0.009
gb|BP571003.1|BP571003 BP571003 RAFL14 Arabidopsis thaliana... 46 0.009
gb|BP571920.1|BP571920 BP571920 RAFL14 Arabidopsis thaliana... 46 0.009
gb|BP576224.1|BP576224 BP576224 RAFL14 Arabidopsis thaliana... 46 0.009
gb|BP599053.1|BP599053 BP599053 RAFL16 Arabidopsis thaliana... 46 0.009
gb|BP636328.1|BP636328 BP636328 RAFL18 Arabidopsis thaliana... 46 0.009
gb|BP645624.1|BP645624 BP645624 RAFL19 Arabidopsis thaliana... 46 0.009
gb|BP665269.1|BP665269 BP665269 RAFL21 Arabidopsis thaliana... 46 0.009
gb|BP836709.1|BP836709 BP836709 RAFL19 Arabidopsis thaliana... 46 0.009
gb|BP593701.1|BP593701 BP593701 RAFL15 Arabidopsis thaliana... 44 0.037
gb|BP597022.1|BP597022 BP597022 RAFL15 Arabidopsis thaliana... 44 0.037
gb|BP660296.1|BP660296 BP660296 RAFL19 Arabidopsis thaliana... 44 0.037
gb|CB253825.1|CB253825 87-E012992-019-004-M21-SP6r MPIZ-ADI... 44 0.037
gb|BP813666.1|BP813666 BP813666 RAFL19 Arabidopsis thaliana... 44 0.037
gb|BP816452.1|BP816452 BP816452 RAFL19 Arabidopsis thaliana... 44 0.037
gb|BP841779.1|BP841779 BP841779 RAFL21 Arabidopsis thaliana... 44 0.037
gb|BP580308.1|BP580308 BP580308 RAFL14 Arabidopsis thaliana... 42 0.15
gb|BP596859.1|BP596859 BP596859 RAFL15 Arabidopsis thaliana... 42 0.15
gb|BP831315.1|BP831315 BP831315 RAFL19 Arabidopsis thaliana... 42 0.15
gb|BP836915.1|BP836915 BP836915 RAFL19 Arabidopsis thaliana... 42 0.15
emb|AL162971.1|ATT22P11 Arabidopsis thaliana DNA chromosome... 42 0.15
ref|NM_120335.1| Arabidopsis thaliana DNA binding AT5G02570... 42 0.15
>gb|AV557321.1|AV557321 AV557321 Arabidopsis thaliana green siliques Columbia Arabidopsis
thaliana cDNA clone SQ065f12F 3', mRNA sequence
Length = 476
Score = 105 bits (53), Expect = 1e-020
Identities = 206/257 (80%)
Strand = Plus / Plus
Query: 288 aacttggtgaccgcctttgtgccttcagagacggcgtgcttggcgagctcgccgggtagg 347
|||||||| |||||||| || ||||||||||||||||| || ||||| || ||||| |||
Sbjct: 187 aacttggtaaccgccttggtaccttcagagacggcgtgtttagcgagttcaccggggagg 246
Query: 348 acgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgtagcgg 407
||||| | || | |||||||||||||| || || ||||| |||||||||||||| |
Sbjct: 247 acgagtctcacagccgtctggatctcgcgagatgtaatggtcggcttcttgttgtaccta 306
Query: 408 gcgagcttggcggcctccgcggcgagcttctcgaagatgtcgttgatgaaggaattcatg 467
||||| || | | ||| || ||||||||||| |||||||||||||| |||||
Sbjct: 307 gcgagtttcgaagattcctgagctagcttctcgaatatgtcgttgatgaaactgttcata 366
Query: 468 atggacatggccttggacgagatgccgatgtcggggtgcacctgcttgagcaccttgaag 527
|| |||||| ||| || || ||||| || || || |||||||| ||||||||||||
Sbjct: 367 atccccatggctttgcttgaaattccgatatctggatgaacctgcttcagcaccttgaag 426
Query: 528 atgtagatcttgtaggt 544
|||||||||||||||||
Sbjct: 427 atgtagatcttgtaggt 443
>gb|CB255588.1|CB255588 37-E015391-019-006-I09-T7R MPIZ-ADIS-019 Arabidopsis thaliana cDNA
clone MPIZp768I096Q 5-PRIME, mRNA sequence
Length = 677
Score = 105 bits (53), Expect = 1e-020
Identities = 206/257 (80%)
Strand = Plus / Minus
Query: 288 aacttggtgaccgcctttgtgccttcagagacggcgtgcttggcgagctcgccgggtagg 347
|||||||| |||||||| || ||||||||||||||||| || ||||| || ||||| |||
Sbjct: 468 aacttggtaaccgccttggtaccttcagagacggcgtgtttagcgagttcaccggggagg 409
Query: 348 acgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgtagcgg 407
||||| | || | |||||||||||||| || || ||||| |||||||||||||| |
Sbjct: 408 acgagtctcacagccgtctggatctcgcgagatgtaatggtcggcttcttgttgtaccta 349
Query: 408 gcgagcttggcggcctccgcggcgagcttctcgaagatgtcgttgatgaaggaattcatg 467
||||| || | | ||| || ||||||||||| |||||||||||||| |||||
Sbjct: 348 gcgagtttcgaagattcctgagctagcttctcgaatatgtcgttgatgaaactgttcata 289
Query: 468 atggacatggccttggacgagatgccgatgtcggggtgcacctgcttgagcaccttgaag 527
|| |||||| ||| || || ||||| || || || |||||||| ||||||||||||
Sbjct: 288 atccccatggctttgcttgaaattccgatatctggatgaacctgcttcagcaccttgaag 229
Query: 528 atgtagatcttgtaggt 544
|||||||||||||||||
Sbjct: 228 atgtagatcttgtaggt 212
>gb|AF130878.1|AF130878 Arabidopsis thaliana phosphoribosylanthranilate isomerase (PAI1)
gene, complete cds
Length = 7484
Score = 105 bits (53), Expect = 1e-020
Identities = 206/257 (80%)
Strand = Plus / Plus
Query: 288 aacttggtgaccgcctttgtgccttcagagacggcgtgcttggcgagctcgccgggtagg 347
|||||||| |||||||| || ||||||||||||||||| || ||||| || ||||| |||
Sbjct: 2875 aacttggtaaccgccttggtaccttcagagacggcgtgtttagcgagttcaccggggagg 2934
Query: 348 acgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgtagcgg 407
||||| | || | |||||||||||||| || || ||||| |||||||||||||| |
Sbjct: 2935 acgagtctcacagccgtctggatctcgcgagatgtaatggtcggcttcttgttgtaccta 2994
Query: 408 gcgagcttggcggcctccgcggcgagcttctcgaagatgtcgttgatgaaggaattcatg 467
||||| || | | ||| || ||||||||||| |||||||||||||| |||||
Sbjct: 2995 gcgagtttcgaagattcctgagctagcttctcgaatatgtcgttgatgaaactgttcata 3054
Query: 468 atggacatggccttggacgagatgccgatgtcggggtgcacctgcttgagcaccttgaag 527
|| |||||| ||| || || ||||| || || || |||||||| ||||||||||||
Sbjct: 3055 atccccatggctttgcttgaaattccgatatctggatgaacctgcttcagcaccttgaag 3114
Query: 528 atgtagatcttgtaggt 544
|||||||||||||||||
Sbjct: 3115 atgtagatcttgtaggt 3131
>gb|AE005172.1| Arabidopsis thaliana chromosome 1, top arm complete sequence
Length = 14221815
Score = 105 bits (53), Expect = 1e-020
Identities = 206/257 (80%)
Strand = Plus / Minus
Query: 288 aacttggtgaccgcctttgtgccttcagagacggcgtgcttggcgagctcgccgggtagg 347
|||||||| |||||||| || ||||||||||||||||| || ||||| || ||||| |||
Sbjct: 2413326 aacttggtaaccgccttggtaccttcagagacggcgtgtttagcgagttcaccggggagg 2413267
Query: 348 acgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgtagcgg 407
||||| | || | |||||||||||||| || || ||||| |||||||||||||| |
Sbjct: 2413266 acgagtctcacagccgtctggatctcgcgagatgtaatggtcggcttcttgttgtaccta 2413207
Query: 408 gcgagcttggcggcctccgcggcgagcttctcgaagatgtcgttgatgaaggaattcatg 467
||||| || | | ||| || ||||||||||| |||||||||||||| |||||
Sbjct: 2413206 gcgagtttcgaagattcctgagctagcttctcgaatatgtcgttgatgaaactgttcata 2413147
Query: 468 atggacatggccttggacgagatgccgatgtcggggtgcacctgcttgagcaccttgaag 527
|| |||||| ||| || || ||||| || || || |||||||| ||||||||||||
Sbjct: 2413146 atccccatggctttgcttgaaattccgatatctggatgaacctgcttcagcaccttgaag 2413087
Query: 528 atgtagatcttgtaggt 544
|||||||||||||||||
Sbjct: 2413086 atgtagatcttgtaggt 2413070
>gb|AY070760.1| Arabidopsis thaliana At1g07790/F24B9_10 mRNA, complete cds
Length = 709
Score = 105 bits (53), Expect = 1e-020
Identities = 206/257 (80%)
Strand = Plus / Minus
Query: 288 aacttggtgaccgcctttgtgccttcagagacggcgtgcttggcgagctcgccgggtagg 347
|||||||| |||||||| || ||||||||||||||||| || ||||| || ||||| |||
Sbjct: 482 aacttggtaaccgccttggtaccttcagagacggcgtgtttagcgagttcaccggggagg 423
Query: 348 acgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgtagcgg 407
||||| | || | |||||||||||||| || || ||||| |||||||||||||| |
Sbjct: 422 acgagtctcacagccgtctggatctcgcgagatgtaatggtcggcttcttgttgtaccta 363
Query: 408 gcgagcttggcggcctccgcggcgagcttctcgaagatgtcgttgatgaaggaattcatg 467
||||| || | | ||| || ||||||||||| |||||||||||||| |||||
Sbjct: 362 gcgagtttcgaagattcctgagctagcttctcgaatatgtcgttgatgaaactgttcata 303
Query: 468 atggacatggccttggacgagatgccgatgtcggggtgcacctgcttgagcaccttgaag 527
|| |||||| ||| || || ||||| || || || |||||||| ||||||||||||
Sbjct: 302 atccccatggctttgcttgaaattccgatatctggatgaacctgcttcagcaccttgaag 243
Query: 528 atgtagatcttgtaggt 544
|||||||||||||||||
Sbjct: 242 atgtagatcttgtaggt 226
>gb|AY133638.1| Arabidopsis thaliana At1g07790/F24B9_10 mRNA, complete cds
Length = 447
Score = 105 bits (53), Expect = 1e-020
Identities = 206/257 (80%)
Strand = Plus / Minus
Query: 288 aacttggtgaccgcctttgtgccttcagagacggcgtgcttggcgagctcgccgggtagg 347
|||||||| |||||||| || ||||||||||||||||| || ||||| || ||||| |||
Sbjct: 434 aacttggtaaccgccttggtaccttcagagacggcgtgtttagcgagttcaccggggagg 375
Query: 348 acgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgtagcgg 407
||||| | || | |||||||||||||| || || ||||| |||||||||||||| |
Sbjct: 374 acgagtctcacagccgtctggatctcgcgagatgtaatggtcggcttcttgttgtaccta 315
Query: 408 gcgagcttggcggcctccgcggcgagcttctcgaagatgtcgttgatgaaggaattcatg 467
||||| || | | ||| || ||||||||||| |||||||||||||| |||||
Sbjct: 314 gcgagtttcgaagattcctgagctagcttctcgaatatgtcgttgatgaaactgttcata 255
Query: 468 atggacatggccttggacgagatgccgatgtcggggtgcacctgcttgagcaccttgaag 527
|| |||||| ||| || || ||||| || || || |||||||| ||||||||||||
Sbjct: 254 atccccatggctttgcttgaaattccgatatctggatgaacctgcttcagcaccttgaag 195
Query: 528 atgtagatcttgtaggt 544
|||||||||||||||||
Sbjct: 194 atgtagatcttgtaggt 178
>gb|AF332446.1| Arabidopsis thaliana clone C00142 (p) putative histone H2B protein
(At1g07790) mRNA, complete cds
Length = 447
Score = 105 bits (53), Expect = 1e-020
Identities = 206/257 (80%)
Strand = Plus / Minus
Query: 288 aacttggtgaccgcctttgtgccttcagagacggcgtgcttggcgagctcgccgggtagg 347
|||||||| |||||||| || ||||||||||||||||| || ||||| || ||||| |||
Sbjct: 434 aacttggtaaccgccttggtaccttcagagacggcgtgtttagcgagttcaccggggagg 375
Query: 348 acgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgtagcgg 407
||||| | || | |||||||||||||| || || ||||| |||||||||||||| |
Sbjct: 374 acgagtctcacagccgtctggatctcgcgagatgtaatggtcggcttcttgttgtaccta 315
Query: 408 gcgagcttggcggcctccgcggcgagcttctcgaagatgtcgttgatgaaggaattcatg 467
||||| || | | ||| || ||||||||||| |||||||||||||| |||||
Sbjct: 314 gcgagtttcgaagattcctgagctagcttctcgaatatgtcgttgatgaaactgttcata 255
Query: 468 atggacatggccttggacgagatgccgatgtcggggtgcacctgcttgagcaccttgaag 527
|| |||||| ||| || || ||||| || || || |||||||| ||||||||||||
Sbjct: 254 atccccatggctttgcttgaaattccgatatctggatgaacctgcttcagcaccttgaag 195
Query: 528 atgtagatcttgtaggt 544
|||||||||||||||||
Sbjct: 194 atgtagatcttgtaggt 178
>gb|AC007583.2|F24B9 Arabidopsis thaliana chromosome 1 BAC F24B9 sequence, complete sequence
Length = 107234
Score = 105 bits (53), Expect = 1e-020
Identities = 206/257 (80%)
Strand = Plus / Plus
Query: 288 aacttggtgaccgcctttgtgccttcagagacggcgtgcttggcgagctcgccgggtagg 347
|||||||| |||||||| || ||||||||||||||||| || ||||| || ||||| |||
Sbjct: 31750 aacttggtaaccgccttggtaccttcagagacggcgtgtttagcgagttcaccggggagg 31809
Query: 348 acgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgtagcgg 407
||||| | || | |||||||||||||| || || ||||| |||||||||||||| |
Sbjct: 31810 acgagtctcacagccgtctggatctcgcgagatgtaatggtcggcttcttgttgtaccta 31869
Query: 408 gcgagcttggcggcctccgcggcgagcttctcgaagatgtcgttgatgaaggaattcatg 467
||||| || | | ||| || ||||||||||| |||||||||||||| |||||
Sbjct: 31870 gcgagtttcgaagattcctgagctagcttctcgaatatgtcgttgatgaaactgttcata 31929
Query: 468 atggacatggccttggacgagatgccgatgtcggggtgcacctgcttgagcaccttgaag 527
|| |||||| ||| || || ||||| || || || |||||||| ||||||||||||
Sbjct: 31930 atccccatggctttgcttgaaattccgatatctggatgaacctgcttcagcaccttgaag 31989
Query: 528 atgtagatcttgtaggt 544
|||||||||||||||||
Sbjct: 31990 atgtagatcttgtaggt 32006
>ref|NM_100653.2| Arabidopsis thaliana DNA binding AT1G07790 mRNA, complete cds
Length = 729
Score = 105 bits (53), Expect = 1e-020
Identities = 206/257 (80%)
Strand = Plus / Minus
Query: 288 aacttggtgaccgcctttgtgccttcagagacggcgtgcttggcgagctcgccgggtagg 347
|||||||| |||||||| || ||||||||||||||||| || ||||| || ||||| |||
Sbjct: 503 aacttggtaaccgccttggtaccttcagagacggcgtgtttagcgagttcaccggggagg 444
Query: 348 acgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgtagcgg 407
||||| | || | |||||||||||||| || || ||||| |||||||||||||| |
Sbjct: 443 acgagtctcacagccgtctggatctcgcgagatgtaatggtcggcttcttgttgtaccta 384
Query: 408 gcgagcttggcggcctccgcggcgagcttctcgaagatgtcgttgatgaaggaattcatg 467
||||| || | | ||| || ||||||||||| |||||||||||||| |||||
Sbjct: 383 gcgagtttcgaagattcctgagctagcttctcgaatatgtcgttgatgaaactgttcata 324
Query: 468 atggacatggccttggacgagatgccgatgtcggggtgcacctgcttgagcaccttgaag 527
|| |||||| ||| || || ||||| || || || |||||||| ||||||||||||
Sbjct: 323 atccccatggctttgcttgaaattccgatatctggatgaacctgcttcagcaccttgaag 264
Query: 528 atgtagatcttgtaggt 544
|||||||||||||||||
Sbjct: 263 atgtagatcttgtaggt 247
>ref|NC_003070.5| Arabidopsis thaliana chromosome 1, complete sequence
Length = 30432563
Score = 105 bits (53), Expect = 1e-020
Identities = 206/257 (80%)
Strand = Plus / Minus
Query: 288 aacttggtgaccgcctttgtgccttcagagacggcgtgcttggcgagctcgccgggtagg 347
|||||||| |||||||| || ||||||||||||||||| || ||||| || ||||| |||
Sbjct: 2413479 aacttggtaaccgccttggtaccttcagagacggcgtgtttagcgagttcaccggggagg 2413420
Query: 348 acgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgtagcgg 407
||||| | || | |||||||||||||| || || ||||| |||||||||||||| |
Sbjct: 2413419 acgagtctcacagccgtctggatctcgcgagatgtaatggtcggcttcttgttgtaccta 2413360
Query: 408 gcgagcttggcggcctccgcggcgagcttctcgaagatgtcgttgatgaaggaattcatg 467
||||| || | | ||| || ||||||||||| |||||||||||||| |||||
Sbjct: 2413359 gcgagtttcgaagattcctgagctagcttctcgaatatgtcgttgatgaaactgttcata 2413300
Query: 468 atggacatggccttggacgagatgccgatgtcggggtgcacctgcttgagcaccttgaag 527
|| |||||| ||| || || ||||| || || || |||||||| ||||||||||||
Sbjct: 2413299 atccccatggctttgcttgaaattccgatatctggatgaacctgcttcagcaccttgaag 2413240
Query: 528 atgtagatcttgtaggt 544
|||||||||||||||||
Sbjct: 2413239 atgtagatcttgtaggt 2413223
>gb|U34757.2|ATU34757 Arabidopsis thaliana phosphoribosylanthranilate isomerase (PAI1) and
(PAI4) genes, complete cds
Length = 10784
Score = 97.6 bits (49), Expect = 3e-018
Identities = 205/257 (79%)
Strand = Plus / Plus
Query: 288 aacttggtgaccgcctttgtgccttcagagacggcgtgcttggcgagctcgccgggtagg 347
|||||||| |||||||| || ||||||||||||||||| || ||||| || ||||| |||
Sbjct: 9236 aacttggtaaccgccttggtaccttcagagacggcgtgtttagcgagttcaccggggagg 9295
Query: 348 acgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgtagcgg 407
||||| | || | |||||||||||||| || || ||||| |||||||||||||| |
Sbjct: 9296 acgagtctcacagccgtctggatctcgcgagatgtaatggtcggcttcttgttgtaccta 9355
Query: 408 gcgagcttggcggcctccgcggcgagcttctcgaagatgtcgttgatgaaggaattcatg 467
||||| || | | ||| || ||||||||||| |||||||||||||| |||||
Sbjct: 9356 gcgagtttcgaagattcctgagctagcttctcgaatatgtcgttgatgaaactgttcata 9415
Query: 468 atggacatggccttggacgagatgccgatgtcggggtgcacctgcttgagcaccttgaag 527
|| |||||| ||| || || ||||| || || || |||||||| || |||||||||
Sbjct: 9416 atccccatggctttgcttgaaattccgatatctggatgaacctgcttcagaaccttgaag 9475
Query: 528 atgtagatcttgtaggt 544
|||||||||||||||||
Sbjct: 9476 atgtagatcttgtaggt 9492
Score = 97.6 bits (49), Expect = 3e-018
Identities = 205/257 (79%)
Strand = Plus / Plus
Query: 288 aacttggtgaccgcctttgtgccttcagagacggcgtgcttggcgagctcgccgggtagg 347
|||||||| |||||||| || ||||||||||||||||| || ||||| || ||||| |||
Sbjct: 2414 aacttggtaaccgccttggtaccttcagagacggcgtgtttagcgagttcaccggggagg 2473
Query: 348 acgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgtagcgg 407
||||| | || | |||||||||||||| || || ||||| |||||||||||||| |
Sbjct: 2474 acgagtctcacagccgtctggatctcgcgagatgtaatggtcggcttcttgttgtaccta 2533
Query: 408 gcgagcttggcggcctccgcggcgagcttctcgaagatgtcgttgatgaaggaattcatg 467
||||| || | | ||| || ||||||||||| |||||||||||||| |||||
Sbjct: 2534 gcgagtttcgaagattcctgagctagcttctcgaatatgtcgttgatgaaactgttcata 2593
Query: 468 atggacatggccttggacgagatgccgatgtcggggtgcacctgcttgagcaccttgaag 527
|| |||||| ||| || || ||||| || || || |||||||| || |||||||||
Sbjct: 2594 atccccatggctttgcttgaaattccgatatctggatgaacctgcttcagaaccttgaag 2653
Query: 528 atgtagatcttgtaggt 544
|||||||||||||||||
Sbjct: 2654 atgtagatcttgtaggt 2670
>gb|AY088636.1| Arabidopsis thaliana clone 8711 mRNA, complete sequence
Length = 704
Score = 97.6 bits (49), Expect = 3e-018
Identities = 205/257 (79%)
Strand = Plus / Minus
Query: 288 aacttggtgaccgcctttgtgccttcagagacggcgtgcttggcgagctcgccgggtagg 347
|||||||| |||||||| || ||||||||||||||||| || ||||| || ||||| |||
Sbjct: 504 aacttggtaaccgccttggtaccttcagagacggcgtgtttagcgagttcaccggggagg 445
Query: 348 acgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgtagcgg 407
||||| | || | |||||||||||||| || || ||||| |||||||||||||| |
Sbjct: 444 acgagtctcacagccgtctggatctcgcgagatgtaatggtcggcttcttgttgtaccta 385
Query: 408 gcgagcttggcggcctccgcggcgagcttctcgaagatgtcgttgatgaaggaattcatg 467
||||| || | | ||| || ||||||||||| |||||||||||||| |||||
Sbjct: 384 gcgagtttcgaagattcctgagctagcttctcgaatatgtcgttgatgaaactgttcata 325
Query: 468 atggacatggccttggacgagatgccgatgtcggggtgcacctgcttgagcaccttgaag 527
|| |||||| ||| || || ||||| || || || |||||||| || |||||||||
Sbjct: 324 atccccatggctttgcttgaaattccgatatctggatgaacctgcttcagaaccttgaag 265
Query: 528 atgtagatcttgtaggt 544
|||||||||||||||||
Sbjct: 264 atgtagatcttgtaggt 248
>gb|CK118206.1|CK118206 217m08.p1 AtM1 Arabidopsis thaliana cDNA clone MPMGp2011M08217
5-PRIME, mRNA sequence
Length = 466
Score = 89.7 bits (45), Expect = 7e-016
Identities = 204/257 (79%)
Strand = Plus / Minus
Query: 288 aacttggtgaccgcctttgtgccttcagagacggcgtgcttggcgagctcgccgggtagg 347
|||||||| || |||| || ||||||||||||||||| || ||||| || ||||| |||
Sbjct: 459 aacttggtaacgcccttggtaccttcagagacggcgtgtttagcgagttcaccggggagg 400
Query: 348 acgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgtagcgg 407
||||| | || | |||||||||||||| || || ||||| |||||||||||||| |
Sbjct: 399 acgagtctcacagccgtctggatctcgcgagatgtaatggtcggcttcttgttgtaccta 340
Query: 408 gcgagcttggcggcctccgcggcgagcttctcgaagatgtcgttgatgaaggaattcatg 467
||||| || | | ||| || ||||||||||| |||||||||||||| |||||
Sbjct: 339 gcgagtttcgaagattcctgagctagcttctcgaatatgtcgttgatgaaactgttcata 280
Query: 468 atggacatggccttggacgagatgccgatgtcggggtgcacctgcttgagcaccttgaag 527
|| |||||| ||| || || ||||| || || || |||||||| ||||||||||||
Sbjct: 279 atccccatggctttgcttgaaattccgatatctggatgaacctgcttcagcaccttgaag 220
Query: 528 atgtagatcttgtaggt 544
|||||||||||||||||
Sbjct: 219 atgtagatcttgtaggt 203
>emb|AL758292.1| Arabidopsis thaliana T-DNA flanking sequence GK-157C10-013241,
genomic survey sequence
Length = 138
Score = 87.7 bits (44), Expect = 3e-015
Identities = 98/116 (84%)
Strand = Plus / Plus
Query: 288 aacttggtgaccgcctttgtgccttcagagacggcgtgcttggcgagctcgccgggtagg 347
|||||||| |||||||| || ||||||||||||||||| || ||||| || ||||| |||
Sbjct: 19 aacttggtaaccgccttggtaccttcagagacggcgtgtttagcgagttcaccggggagg 78
Query: 348 acgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 403
||||| | || | |||||||||||||| || || ||||| ||||||||||||||
Sbjct: 79 acgagtctcacagccgtctggatctcgcgagatgtaatggtcggcttcttgttgta 134
>gb|AV540331.1|AV540331 AV540331 Arabidopsis thaliana roots Columbia Arabidopsis thaliana
cDNA clone RZ149b03F 3', mRNA sequence
Length = 204
Score = 87.7 bits (44), Expect = 3e-015
Identities = 98/116 (84%)
Strand = Plus / Plus
Query: 288 aacttggtgaccgcctttgtgccttcagagacggcgtgcttggcgagctcgccgggtagg 347
|||||||| |||||||| || ||||||||||||||||| || ||||| || ||||| |||
Sbjct: 44 aacttggtaaccgccttggtaccttcagagacggcgtgtttagcgagttcaccggggagg 103
Query: 348 acgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 403
||||| | || | |||||||||||||| || || ||||| ||||||||||||||
Sbjct: 104 acgagtctcacagccgtctggatctcgcgagatgtaatggtcggcttcttgttgta 159
>gb|BP619021.1|BP619021 BP619021 RAFL16 Arabidopsis thaliana cDNA clone RAFL16-30-L06 3',
mRNA sequence
Length = 447
Score = 87.7 bits (44), Expect = 3e-015
Identities = 98/116 (84%)
Strand = Plus / Plus
Query: 288 aacttggtgaccgcctttgtgccttcagagacggcgtgcttggcgagctcgccgggtagg 347
|||||||| |||||||| || ||||||||||||||||| || ||||| || ||||| |||
Sbjct: 176 aacttggtaaccgccttggtaccttcagagacggcgtgtttagcgagttcaccggggagg 235
Query: 348 acgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 403
||||| | || | |||||||||||||| || || ||||| ||||||||||||||
Sbjct: 236 acgagtctcacagccgtctggatctcgcgagatgtaatggtcggcttcttgttgta 291
Score = 67.9 bits (34), Expect = 3e-009
Identities = 37/38 (97%)
Strand = Plus / Plus
Query: 507 acctgcttgagcaccttgaagatgtagatcttgtaggt 544
|||||||| |||||||||||||||||||||||||||||
Sbjct: 395 acctgcttcagcaccttgaagatgtagatcttgtaggt 432
Score = 44.1 bits (22), Expect = 0.037
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 432 agcttctcgaagatgtcgttgatgaa 457
||||||||||| ||||||||||||||
Sbjct: 321 agcttctcgaatatgtcgttgatgaa 346
>gb|BP787756.1|BP787756 BP787756 RAFL7 Arabidopsis thaliana cDNA clone RAFL26-05-I12 3',
mRNA sequence
Length = 388
Score = 87.7 bits (44), Expect = 3e-015
Identities = 98/116 (84%)
Strand = Plus / Plus
Query: 288 aacttggtgaccgcctttgtgccttcagagacggcgtgcttggcgagctcgccgggtagg 347
|||||||| |||||||| || ||||||||||||||||| || ||||| || ||||| |||
Sbjct: 193 aacttggtaaccgccttggtaccttcagagacggcgtgtttagcgagttcaccggggagg 252
Query: 348 acgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 403
||||| | || | |||||||||||||| || || ||||| ||||||||||||||
Sbjct: 253 acgagtctcacagccgtctggatctcgcgagatgtaatggtcggcttcttgttgta 308
>gb|BP586960.1|BP586960 BP586960 RAFL15 Arabidopsis thaliana cDNA clone RAFL15-08-E08 3',
mRNA sequence
Length = 422
Score = 79.8 bits (40), Expect = 7e-013
Identities = 97/116 (83%)
Strand = Plus / Plus
Query: 288 aacttggtgaccgcctttgtgccttcagagacggcgtgcttggcgagctcgccgggtagg 347
|||||||| |||| ||| || ||||||||||||||||| || ||||| || ||||| |||
Sbjct: 207 aacttggtaaccggcttggtaccttcagagacggcgtgtttagcgagttcaccggggagg 266
Query: 348 acgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 403
||||| | || | |||||||||||||| || || ||||| ||||||||||||||
Sbjct: 267 acgagtctcacagccgtctggatctcgcgagatgtaatggtcggcttcttgttgta 322
Score = 44.1 bits (22), Expect = 0.037
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 432 agcttctcgaagatgtcgttgatgaa 457
||||||||||| ||||||||||||||
Sbjct: 350 agcttctcgaatatgtcgttgatgaa 375
>gb|AY357734.1| Arabidopsis thaliana phosphoribosylanthranilate isomerase (PAI1)
gene, PAI1-invpai1 allele, complete cds
Length = 6309
Score = 79.8 bits (40), Expect = 7e-013
Identities = 187/236 (79%)
Strand = Plus / Plus
Query: 309 ccttcagagacggcgtgcttggcgagctcgccgggtaggacgaggcggacggaggtctgg 368
||||||||||||||||| || ||||| || ||||| |||||||| | || | ||||||
Sbjct: 5 ccttcagagacggcgtgtttagcgagttcaccggggaggacgagtctcacagccgtctgg 64
Query: 369 atctcgcgggaggtgatggtgggcttcttgttgtagcgggcgagcttggcggcctccgcg 428
|||||||| || || ||||| |||||||||||||| | ||||| || | | |||
Sbjct: 65 atctcgcgagatgtaatggtcggcttcttgttgtacctagcgagtttcgaagattcctga 124
Query: 429 gcgagcttctcgaagatgtcgttgatgaaggaattcatgatggacatggccttggacgag 488
|| ||||||||||| |||||||||||||| ||||| || |||||| ||| ||
Sbjct: 125 gctagcttctcgaatatgtcgttgatgaaactgttcataatccccatggctttgcttgaa 184
Query: 489 atgccgatgtcggggtgcacctgcttgagcaccttgaagatgtagatcttgtaggt 544
|| ||||| || || || |||||||| || ||||||||||||||||||||||||||
Sbjct: 185 attccgatatctggatgaacctgcttcagaaccttgaagatgtagatcttgtaggt 240
>gb|BH610928.1|BH610928 SALK_018246 Arabidopsis thaliana TDNA insertion lines Arabidopsis
thaliana genomic clone SALK_018246, DNA sequence
Length = 470
Score = 75.8 bits (38), Expect = 1e-011
Identities = 65/74 (87%)
Strand = Plus / Minus
Query: 486 gagatgccgatgtcggggtgcacctgcttgagcaccttgaagatgtagatcttgtaggtc 545
||||| ||||| ||||| || || ||||| |||||||||||||||||||||||||| |||
Sbjct: 348 gagattccgatatcgggatgaacttgcttaagcaccttgaagatgtagatcttgtaagtc 289
Query: 546 tccacgctcttctt 559
|| || ||||||||
Sbjct: 288 tcgacactcttctt 275
>gb|BZ288838.1|BZ288838 SALK_022228.56.00.x Arabidopsis thaliana TDNA insertion lines
Arabidopsis thaliana genomic clone SALK_022228.56.00.x,
DNA sequence
Length = 369
Score = 75.8 bits (38), Expect = 1e-011
Identities = 65/74 (87%)
Strand = Plus / Minus
Query: 486 gagatgccgatgtcggggtgcacctgcttgagcaccttgaagatgtagatcttgtaggtc 545
||||| ||||| ||||| || || ||||| |||||||||||||||||||||||||| |||
Sbjct: 315 gagattccgatatcgggatgaacttgcttaagcaccttgaagatgtagatcttgtaagtc 256
Query: 546 tccacgctcttctt 559
|| || ||||||||
Sbjct: 255 tcgacactcttctt 242
>gb|BZ289176.1|BZ289176 SALK_022573.48.40.x Arabidopsis thaliana TDNA insertion lines
Arabidopsis thaliana genomic clone SALK_022573.48.40.x,
DNA sequence
Length = 306
Score = 75.8 bits (38), Expect = 1e-011
Identities = 65/74 (87%)
Strand = Plus / Minus
Query: 486 gagatgccgatgtcggggtgcacctgcttgagcaccttgaagatgtagatcttgtaggtc 545
||||| ||||| ||||| || || ||||| |||||||||||||||||||||||||| |||
Sbjct: 252 gagattccgatatcgggatgaacttgcttaagcaccttgaagatgtagatcttgtaagtc 193
Query: 546 tccacgctcttctt 559
|| || ||||||||
Sbjct: 192 tcgacactcttctt 179
>gb|BZ769396.1|BZ769396 SALK_142124.48.80.x Arabidopsis thaliana TDNA insertion lines
Arabidopsis thaliana genomic clone SALK_142124.48.80.x,
DNA sequence
Length = 212
Score = 75.8 bits (38), Expect = 1e-011
Identities = 65/74 (87%)
Strand = Plus / Minus
Query: 486 gagatgccgatgtcggggtgcacctgcttgagcaccttgaagatgtagatcttgtaggtc 545
||||| ||||| ||||| || || ||||| |||||||||||||||||||||||||| |||
Sbjct: 158 gagattccgatatcgggatgaacttgcttaagcaccttgaagatgtagatcttgtaagtc 99
Query: 546 tccacgctcttctt 559
|| || ||||||||
Sbjct: 98 tcgacactcttctt 85
>gb|T22855.1|T22855 4863 Lambda-PRL2 Arabidopsis thaliana cDNA clone 107L1T7, mRNA
sequence
Length = 522
Score = 75.8 bits (38), Expect = 1e-011
Identities = 65/74 (87%)
Strand = Plus / Minus
Query: 486 gagatgccgatgtcggggtgcacctgcttgagcaccttgaagatgtagatcttgtaggtc 545
||||| ||||| ||||| || || ||||| |||||||||||||||||||||||||| |||
Sbjct: 305 gagattccgatatcgggatgaacttgcttaagcaccttgaagatgtagatcttgtaagtc 246
Query: 546 tccacgctcttctt 559
|| || ||||||||
Sbjct: 245 tcgacactcttctt 232
>gb|AI999101.1|AI999101 701554459 A. thaliana, Columbia Col-0, rosette-3 Arabidopsis
thaliana cDNA clone 701554459, mRNA sequence
Length = 586
Score = 75.8 bits (38), Expect = 1e-011
Identities = 65/74 (87%)
Strand = Plus / Plus
Query: 486 gagatgccgatgtcggggtgcacctgcttgagcaccttgaagatgtagatcttgtaggtc 545
||||| ||||| ||||| || || ||||| |||||||||||||||||||||||||| |||
Sbjct: 403 gagattccgatatcgggatgaacttgcttaagcaccttgaagatgtagatcttgtaagtc 462
Query: 546 tccacgctcttctt 559
|| || ||||||||
Sbjct: 463 tcgacactcttctt 476
>gb|BU636121.1|BU636121 045G06 Infected Arabidopsis Leaf Arabidopsis thaliana cDNA, mRNA
sequence
Length = 652
Score = 75.8 bits (38), Expect = 1e-011
Identities = 65/74 (87%)
Strand = Plus / Minus
Query: 486 gagatgccgatgtcggggtgcacctgcttgagcaccttgaagatgtagatcttgtaggtc 545
||||| ||||| ||||| || || ||||| |||||||||||||||||||||||||| |||
Sbjct: 257 gagattccgatatcgggatgaacttgcttaagcaccttgaagatgtagatcttgtaagtc 198
Query: 546 tccacgctcttctt 559
|| || ||||||||
Sbjct: 197 tcgacactcttctt 184
>gb|CB074430.1|CB074430 EST00945 Virulent Peronospora parasitica Infected Arabidopsis
Forward-Subtracted Library Arabidopsis thaliana cDNA
clone VPP-GA6 similar to PUTATIVE HISTONE h2b FRAGMENT,
mRNA sequence
Length = 336
Score = 75.8 bits (38), Expect = 1e-011
Identities = 65/74 (87%)
Strand = Plus / Minus
Query: 486 gagatgccgatgtcggggtgcacctgcttgagcaccttgaagatgtagatcttgtaggtc 545
||||| ||||| ||||| || || ||||| |||||||||||||||||||||||||| |||
Sbjct: 253 gagattccgatatcgggatgaacttgcttaagcaccttgaagatgtagatcttgtaagtc 194
Query: 546 tccacgctcttctt 559
|| || ||||||||
Sbjct: 193 tcgacactcttctt 180
>gb|CF652319.1|CF652319 48-L020164-066-001-O12-SP6P MPIZ-ADIS-066 Arabidopsis thaliana cDNA
clone MPIZp2001O121Q 5-PRIME, mRNA sequence
Length = 396
Score = 75.8 bits (38), Expect = 1e-011
Identities = 65/74 (87%)
Strand = Plus / Minus
Query: 486 gagatgccgatgtcggggtgcacctgcttgagcaccttgaagatgtagatcttgtaggtc 545
||||| ||||| ||||| || || ||||| |||||||||||||||||||||||||| |||
Sbjct: 307 gagattccgatatcgggatgaacttgcttaagcaccttgaagatgtagatcttgtaagtc 248
Query: 546 tccacgctcttctt 559
|| || ||||||||
Sbjct: 247 tcgacactcttctt 234
>gb|AV521723.1|AV521723 AV521723 Arabidopsis thaliana aboveground organs two to six-week
old Arabidopsis thaliana cDNA clone APZ65f01F 3', mRNA
sequence
Length = 529
Score = 75.8 bits (38), Expect = 1e-011
Identities = 65/74 (87%)
Strand = Plus / Plus
Query: 486 gagatgccgatgtcggggtgcacctgcttgagcaccttgaagatgtagatcttgtaggtc 545
||||| ||||| ||||| || || ||||| |||||||||||||||||||||||||| |||
Sbjct: 394 gagattccgatatcgggatgaacttgcttaagcaccttgaagatgtagatcttgtaagtc 453
Query: 546 tccacgctcttctt 559
|| || ||||||||
Sbjct: 454 tcgacactcttctt 467
>gb|AV557883.1|AV557883 AV557883 Arabidopsis thaliana green siliques Columbia Arabidopsis
thaliana cDNA clone SQ083c05F 3', mRNA sequence
Length = 637
Score = 75.8 bits (38), Expect = 1e-011
Identities = 65/74 (87%)
Strand = Plus / Minus
Query: 486 gagatgccgatgtcggggtgcacctgcttgagcaccttgaagatgtagatcttgtaggtc 545
||||| ||||| ||||| || || ||||| |||||||||||||||||||||||||| |||
Sbjct: 298 gagattccgatatcgggatgaacttgcttaagcaccttgaagatgtagatcttgtaagtc 239
Query: 546 tccacgctcttctt 559
|| || ||||||||
Sbjct: 238 tcgacactcttctt 225
>gb|AV559679.1|AV559679 AV559679 Arabidopsis thaliana green siliques Columbia Arabidopsis
thaliana cDNA clone SQ121g01F 3', mRNA sequence
Length = 419
Score = 75.8 bits (38), Expect = 1e-011
Identities = 65/74 (87%)
Strand = Plus / Minus
Query: 486 gagatgccgatgtcggggtgcacctgcttgagcaccttgaagatgtagatcttgtaggtc 545
||||| ||||| ||||| || || ||||| |||||||||||||||||||||||||| |||
Sbjct: 298 gagattccgatatcgggatgaacttgcttaagcaccttgaagatgtagatcttgtaagtc 239
Query: 546 tccacgctcttctt 559
|| || ||||||||
Sbjct: 238 tcgacactcttctt 225
>gb|AV562999.1|AV562999 AV562999 Arabidopsis thaliana green siliques Columbia Arabidopsis
thaliana cDNA clone SQ179g04F 3', mRNA sequence
Length = 309
Score = 75.8 bits (38), Expect = 1e-011
Identities = 65/74 (87%)
Strand = Plus / Minus
Query: 486 gagatgccgatgtcggggtgcacctgcttgagcaccttgaagatgtagatcttgtaggtc 545
||||| ||||| ||||| || || ||||| |||||||||||||||||||||||||| |||
Sbjct: 305 gagattccgatatcgggatgaacttgcttaagcaccttgaagatgtagatcttgtaagtc 246
Query: 546 tccacgctcttctt 559
|| || ||||||||
Sbjct: 245 tcgacactcttctt 232
>gb|CF773114.1|CF773114 AG_FSL_13B10 Arabidopsis ag-1 35S:AG-GR forward subtraction library
Arabidopsis thaliana cDNA clone 13B10, mRNA sequence
Length = 273
Score = 75.8 bits (38), Expect = 1e-011
Identities = 65/74 (87%)
Strand = Plus / Plus
Query: 486 gagatgccgatgtcggggtgcacctgcttgagcaccttgaagatgtagatcttgtaggtc 545
||||| ||||| ||||| || || ||||| |||||||||||||||||||||||||| |||
Sbjct: 85 gagattccgatatcgggatgaacttgcttaagcaccttgaagatgtagatcttgtaagtc 144
Query: 546 tccacgctcttctt 559
|| || ||||||||
Sbjct: 145 tcgacactcttctt 158
>gb|CK117656.1|CK117656 215c08.p1 AtM1 Arabidopsis thaliana cDNA clone MPMGp2011C08215
5-PRIME, mRNA sequence
Length = 494
Score = 75.8 bits (38), Expect = 1e-011
Identities = 65/74 (87%)
Strand = Plus / Minus
Query: 486 gagatgccgatgtcggggtgcacctgcttgagcaccttgaagatgtagatcttgtaggtc 545
||||| ||||| ||||| || || ||||| |||||||||||||||||||||||||| |||
Sbjct: 307 gagattccgatatcgggatgaacttgcttaagcaccttgaagatgtagatcttgtaagtc 248
Query: 546 tccacgctcttctt 559
|| || ||||||||
Sbjct: 247 tcgacactcttctt 234
>gb|CK117801.1|CK117801 204g20.p1 AtM1 Arabidopsis thaliana cDNA clone MPMGp2011G20204
5-PRIME, mRNA sequence
Length = 694
Score = 75.8 bits (38), Expect = 1e-011
Identities = 65/74 (87%)
Strand = Plus / Minus
Query: 486 gagatgccgatgtcggggtgcacctgcttgagcaccttgaagatgtagatcttgtaggtc 545
||||| ||||| ||||| || || ||||| |||||||||||||||||||||||||| |||
Sbjct: 307 gagattccgatatcgggatgaacttgcttaagcaccttgaagatgtagatcttgtaagtc 248
Query: 546 tccacgctcttctt 559
|| || ||||||||
Sbjct: 247 tcgacactcttctt 234
>gb|CK118307.1|CK118307 217h22.p1 AtM1 Arabidopsis thaliana cDNA clone MPMGp2011H22217
5-PRIME, mRNA sequence
Length = 585
Score = 75.8 bits (38), Expect = 1e-011
Identities = 65/74 (87%)
Strand = Plus / Minus
Query: 486 gagatgccgatgtcggggtgcacctgcttgagcaccttgaagatgtagatcttgtaggtc 545
||||| ||||| ||||| || || ||||| |||||||||||||||||||||||||| |||
Sbjct: 292 gagattccgatatcgggatgaacttgcttaagcaccttgaagatgtagatcttgtaagtc 233
Query: 546 tccacgctcttctt 559
|| || ||||||||
Sbjct: 232 tcgacactcttctt 219
>gb|CK118414.1|CK118414 217b16.p1 AtM1 Arabidopsis thaliana cDNA clone MPMGp2011B16217
5-PRIME, mRNA sequence
Length = 596
Score = 75.8 bits (38), Expect = 1e-011
Identities = 65/74 (87%)
Strand = Plus / Minus
Query: 486 gagatgccgatgtcggggtgcacctgcttgagcaccttgaagatgtagatcttgtaggtc 545
||||| ||||| ||||| || || ||||| |||||||||||||||||||||||||| |||
Sbjct: 307 gagattccgatatcgggatgaacttgcttaagcaccttgaagatgtagatcttgtaagtc 248
Query: 546 tccacgctcttctt 559
|| || ||||||||
Sbjct: 247 tcgacactcttctt 234
>gb|CK118523.1|CK118523 216n23.p1 AtM1 Arabidopsis thaliana cDNA clone MPMGp2011N23216
5-PRIME, mRNA sequence
Length = 627
Score = 75.8 bits (38), Expect = 1e-011
Identities = 65/74 (87%)
Strand = Plus / Minus
Query: 486 gagatgccgatgtcggggtgcacctgcttgagcaccttgaagatgtagatcttgtaggtc 545
||||| ||||| ||||| || || ||||| |||||||||||||||||||||||||| |||
Sbjct: 292 gagattccgatatcgggatgaacttgcttaagcaccttgaagatgtagatcttgtaagtc 233
Query: 546 tccacgctcttctt 559
|| || ||||||||
Sbjct: 232 tcgacactcttctt 219
>gb|CK119903.1|CK119903 210g05.p1 AtM1 Arabidopsis thaliana cDNA clone MPMGp2011G05210
5-PRIME, mRNA sequence
Length = 627
Score = 75.8 bits (38), Expect = 1e-011
Identities = 65/74 (87%)
Strand = Plus / Minus
Query: 486 gagatgccgatgtcggggtgcacctgcttgagcaccttgaagatgtagatcttgtaggtc 545
||||| ||||| ||||| || || ||||| |||||||||||||||||||||||||| |||
Sbjct: 292 gagattccgatatcgggatgaacttgcttaagcaccttgaagatgtagatcttgtaagtc 233
Query: 546 tccacgctcttctt 559
|| || ||||||||
Sbjct: 232 tcgacactcttctt 219
>gb|CK120137.1|CK120137 208l20.p1 AtM1 Arabidopsis thaliana cDNA clone MPMGp2011L20208
5-PRIME, mRNA sequence
Length = 713
Score = 75.8 bits (38), Expect = 1e-011
Identities = 65/74 (87%)
Strand = Plus / Minus
Query: 486 gagatgccgatgtcggggtgcacctgcttgagcaccttgaagatgtagatcttgtaggtc 545
||||| ||||| ||||| || || ||||| |||||||||||||||||||||||||| |||
Sbjct: 292 gagattccgatatcgggatgaacttgcttaagcaccttgaagatgtagatcttgtaagtc 233
Query: 546 tccacgctcttctt 559
|| || ||||||||
Sbjct: 232 tcgacactcttctt 219
>gb|CK120144.1|CK120144 208l13.p1 AtM1 Arabidopsis thaliana cDNA clone MPMGp2011L13208
5-PRIME, mRNA sequence
Length = 670
Score = 75.8 bits (38), Expect = 1e-011
Identities = 65/74 (87%)
Strand = Plus / Minus
Query: 486 gagatgccgatgtcggggtgcacctgcttgagcaccttgaagatgtagatcttgtaggtc 545
||||| ||||| ||||| || || ||||| |||||||||||||||||||||||||| |||
Sbjct: 307 gagattccgatatcgggatgaacttgcttaagcaccttgaagatgtagatcttgtaagtc 248
Query: 546 tccacgctcttctt 559
|| || ||||||||
Sbjct: 247 tcgacactcttctt 234
>gb|CK121154.1|CK121154 204f20.p1 AtM1 Arabidopsis thaliana cDNA clone MPMGp2011F20204
5-PRIME, mRNA sequence
Length = 691
Score = 75.8 bits (38), Expect = 1e-011
Identities = 65/74 (87%)
Strand = Plus / Minus
Query: 486 gagatgccgatgtcggggtgcacctgcttgagcaccttgaagatgtagatcttgtaggtc 545
||||| ||||| ||||| || || ||||| |||||||||||||||||||||||||| |||
Sbjct: 307 gagattccgatatcgggatgaacttgcttaagcaccttgaagatgtagatcttgtaagtc 248
Query: 546 tccacgctcttctt 559
|| || ||||||||
Sbjct: 247 tcgacactcttctt 234
>gb|CK121335.1|CK121335 203j20.p1 AtM1 Arabidopsis thaliana cDNA clone MPMGp2011J20203
5-PRIME, mRNA sequence
Length = 504
Score = 75.8 bits (38), Expect = 1e-011
Identities = 65/74 (87%)
Strand = Plus / Minus
Query: 486 gagatgccgatgtcggggtgcacctgcttgagcaccttgaagatgtagatcttgtaggtc 545
||||| ||||| ||||| || || ||||| |||||||||||||||||||||||||| |||
Sbjct: 292 gagattccgatatcgggatgaacttgcttaagcaccttgaagatgtagatcttgtaagtc 233
Query: 546 tccacgctcttctt 559
|| || ||||||||
Sbjct: 232 tcgacactcttctt 219
>gb|CK121656.1|CK121656 202f07.p1 AtM1 Arabidopsis thaliana cDNA clone MPMGp2011F07202
5-PRIME, mRNA sequence
Length = 804
Score = 75.8 bits (38), Expect = 1e-011
Identities = 65/74 (87%)
Strand = Plus / Minus
Query: 486 gagatgccgatgtcggggtgcacctgcttgagcaccttgaagatgtagatcttgtaggtc 545
||||| ||||| ||||| || || ||||| |||||||||||||||||||||||||| |||
Sbjct: 295 gagattccgatatcgggatgaacttgcttaagcaccttgaagatgtagatcttgtaagtc 236
Query: 546 tccacgctcttctt 559
|| || ||||||||
Sbjct: 235 tcgacactcttctt 222
>gb|BP581187.1|BP581187 BP581187 RAFL14 Arabidopsis thaliana cDNA clone RAFL14-30-N03 3',
mRNA sequence
Length = 468
Score = 75.8 bits (38), Expect = 1e-011
Identities = 65/74 (87%)
Strand = Plus / Plus
Query: 486 gagatgccgatgtcggggtgcacctgcttgagcaccttgaagatgtagatcttgtaggtc 545
||||| ||||| ||||| || || ||||| |||||||||||||||||||||||||| |||
Sbjct: 377 gagattccgatatcgggatgaacttgcttaagcaccttgaagatgtagatcttgtaagtc 436
Query: 546 tccacgctcttctt 559
|| || ||||||||
Sbjct: 437 tcgacactcttctt 450
>gb|BP591446.1|BP591446 BP591446 RAFL15 Arabidopsis thaliana cDNA clone RAFL15-14-L09 3',
mRNA sequence
Length = 460
Score = 75.8 bits (38), Expect = 1e-011
Identities = 65/74 (87%)
Strand = Plus / Plus
Query: 486 gagatgccgatgtcggggtgcacctgcttgagcaccttgaagatgtagatcttgtaggtc 545
||||| ||||| ||||| || || ||||| |||||||||||||||||||||||||| |||
Sbjct: 386 gagattccgatatcgggatgaacttgcttaagcaccttgaagatgtagatcttgtaagtc 445
Query: 546 tccacgctcttctt 559
|| || ||||||||
Sbjct: 446 tcgacactcttctt 459
>gb|BP591469.1|BP591469 BP591469 RAFL15 Arabidopsis thaliana cDNA clone RAFL15-14-M13 3',
mRNA sequence
Length = 449
Score = 75.8 bits (38), Expect = 1e-011
Identities = 65/74 (87%)
Strand = Plus / Plus
Query: 486 gagatgccgatgtcggggtgcacctgcttgagcaccttgaagatgtagatcttgtaggtc 545
||||| ||||| ||||| || || ||||| |||||||||||||||||||||||||| |||
Sbjct: 376 gagattccgatatcgggatgaacttgcttaagcaccttgaagatgtagatcttgtaagtc 435
Query: 546 tccacgctcttctt 559
|| || ||||||||
Sbjct: 436 tcgacactcttctt 449
>gb|BP562087.2|BP562087 BP562087 RAFL9 Arabidopsis thaliana cDNA clone RAFL09-46-K06 5',
mRNA sequence
Length = 472
Score = 75.8 bits (38), Expect = 1e-011
Identities = 65/74 (87%)
Strand = Plus / Minus
Query: 486 gagatgccgatgtcggggtgcacctgcttgagcaccttgaagatgtagatcttgtaggtc 545
||||| ||||| ||||| || || ||||| |||||||||||||||||||||||||| |||
Sbjct: 321 gagattccgatatcgggatgaacttgcttaagcaccttgaagatgtagatcttgtaagtc 262
Query: 546 tccacgctcttctt 559
|| || ||||||||
Sbjct: 261 tcgacactcttctt 248
>gb|CB253302.1|CB253302 05-E010699-019-002-J02-T7R MPIZ-ADIS-019 Arabidopsis thaliana cDNA
clone MPIZp768J022Q 5-PRIME, mRNA sequence
Length = 579
Score = 75.8 bits (38), Expect = 1e-011
Identities = 65/74 (87%)
Strand = Plus / Minus
Query: 486 gagatgccgatgtcggggtgcacctgcttgagcaccttgaagatgtagatcttgtaggtc 545
||||| ||||| ||||| || || ||||| |||||||||||||||||||||||||| |||
Sbjct: 305 gagattccgatatcgggatgaacttgcttaagcaccttgaagatgtagatcttgtaagtc 246
Query: 546 tccacgctcttctt 559
|| || ||||||||
Sbjct: 245 tcgacactcttctt 232
>gb|CB255379.1|CB255379 43-E012994-019-004-F11-SP6r MPIZ-ADIS-019 Arabidopsis thaliana cDNA
clone MPIZp768F114Q 3-PRIME, mRNA sequence
Length = 599
Score = 75.8 bits (38), Expect = 1e-011
Identities = 65/74 (87%)
Strand = Plus / Plus
Query: 486 gagatgccgatgtcggggtgcacctgcttgagcaccttgaagatgtagatcttgtaggtc 545
||||| ||||| ||||| || || ||||| |||||||||||||||||||||||||| |||
Sbjct: 394 gagattccgatatcgggatgaacttgcttaagcaccttgaagatgtagatcttgtaagtc 453
Query: 546 tccacgctcttctt 559
|| || ||||||||
Sbjct: 454 tcgacactcttctt 467
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 306,894
Number of Sequences: 1013581
Number of extensions: 306894
Number of successful extensions: 22563
Number of sequences better than 0.5: 313
Number of HSP's better than 0.5 without gapping: 315
Number of HSP's successfully gapped in prelim test: 3
Number of HSP's that attempted gapping in prelim test: 20636
Number of HSP's gapped (non-prelim): 1909
length of query: 818
length of database: 908,940,872
effective HSP length: 20
effective length of query: 798
effective length of database: 888,669,252
effective search space: 709158063096
effective search space used: 709158063096
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)