BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 131537.2.211
(777 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AV540331.1|AV540331 AV540331 Arabidopsis thaliana roots ... 86 1e-014
gb|AV557321.1|AV557321 AV557321 Arabidopsis thaliana green ... 86 1e-014
gb|BP619021.1|BP619021 BP619021 RAFL16 Arabidopsis thaliana... 86 1e-014
gb|CB255588.1|CB255588 37-E015391-019-006-I09-T7R MPIZ-ADIS... 86 1e-014
gb|BP787756.1|BP787756 BP787756 RAFL7 Arabidopsis thaliana ... 86 1e-014
gb|U34757.2|ATU34757 Arabidopsis thaliana phosphoribosylant... 86 1e-014
gb|AF130878.1|AF130878 Arabidopsis thaliana phosphoribosyla... 86 1e-014
gb|AE005172.1| Arabidopsis thaliana chromosome 1, top arm c... 86 1e-014
gb|AY070760.1| Arabidopsis thaliana At1g07790/F24B9_10 mRNA... 86 1e-014
gb|AY133638.1| Arabidopsis thaliana At1g07790/F24B9_10 mRNA... 86 1e-014
gb|AY088636.1| Arabidopsis thaliana clone 8711 mRNA, comple... 86 1e-014
gb|AF332446.1| Arabidopsis thaliana clone C00142 (p) putati... 86 1e-014
gb|AC007583.2|F24B9 Arabidopsis thaliana chromosome 1 BAC F... 86 1e-014
ref|NM_100653.2| Arabidopsis thaliana DNA binding AT1G07790... 86 1e-014
ref|NC_003070.5| Arabidopsis thaliana chromosome 1, complet... 86 1e-014
gb|CK118206.1|CK118206 217m08.p1 AtM1 Arabidopsis thaliana ... 82 2e-013
gb|BP586960.1|BP586960 BP586960 RAFL15 Arabidopsis thaliana... 78 3e-012
emb|AL758292.1| Arabidopsis thaliana T-DNA flanking sequenc... 76 1e-011
gb|AF471815.1| Arabidopsis thaliana ecotype HODJA chromosom... 76 1e-011
gb|AF471816.1| Arabidopsis thaliana ecotype CAL-0 chromosom... 76 1e-011
gb|AF471817.1| Arabidopsis thaliana ecotype MRK-0 chromosom... 76 1e-011
gb|AF471818.1| Arabidopsis thaliana ecotype CVI-0 chromosom... 76 1e-011
gb|AF471819.1| Arabidopsis thaliana ecotype PA-1 chromosome... 76 1e-011
gb|AF471820.1| Arabidopsis thaliana ecotype CNT-1 chromosom... 76 1e-011
gb|AF471821.1| Arabidopsis thaliana ecotype POG-0 chromosom... 76 1e-011
gb|AF471829.1| Arabidopsis thaliana ecotype KAS-1 chromosom... 76 1e-011
gb|AF471830.1| Arabidopsis thaliana ecotype TAC chromosome ... 76 1e-011
gb|AF471831.1| Arabidopsis thaliana ecotype KONDARA chromos... 76 1e-011
gb|AF471832.1| Arabidopsis thaliana ecotype ITA-0 chromosom... 76 1e-011
gb|C99813.1|C99813 C99813 YAC clone CIC8B11 region-specific... 72 2e-010
gb|CK120461.1|CK120461 218k04.p1 AtM1 Arabidopsis thaliana ... 72 2e-010
gb|CK120549.1|CK120549 207d05.p1 AtM1 Arabidopsis thaliana ... 72 2e-010
gb|AF471822.1| Arabidopsis thaliana ecotype CAN-0 chromosom... 72 2e-010
gb|AF471823.1| Arabidopsis thaliana ecotype DIJON_G chromos... 72 2e-010
gb|AF471824.1| Arabidopsis thaliana ecotype PETERGOF chromo... 72 2e-010
gb|AF471825.1| Arabidopsis thaliana ecotype LIP-0 chromosom... 72 2e-010
gb|AF471826.1| Arabidopsis thaliana ecotype LER-0 chromosom... 72 2e-010
gb|AF471827.1| Arabidopsis thaliana ecotype EI-2 chromosome... 72 2e-010
gb|AF471828.1| Arabidopsis thaliana ecotype SORBO chromosom... 72 2e-010
gb|CB185859.1|CB185859 EST01050 Arabidopsis virulent Pseudo... 70 6e-010
gb|U18970.1|ATU18970 Arabidopsis thaliana phosphoribosylant... 70 6e-010
gb|AY357734.1| Arabidopsis thaliana phosphoribosylanthranil... 70 6e-010
gb|AF471806.1| Arabidopsis thaliana ecotype BL-1 chromosome... 68 2e-009
gb|AF471807.1| Arabidopsis thaliana ecotype NO-0 chromosome... 68 2e-009
gb|AF471808.1| Arabidopsis thaliana ecotype TSU-1 chromosom... 68 2e-009
gb|AF471809.1| Arabidopsis thaliana ecotype YO-0 chromosome... 68 2e-009
gb|AF471810.1| Arabidopsis thaliana ecotype WL-0 chromosome... 68 2e-009
gb|AF471811.1| Arabidopsis thaliana ecotype SEI-0 chromosom... 68 2e-009
gb|AF471812.1| Arabidopsis thaliana ecotype PI-0 chromosome... 68 2e-009
gb|AF471813.1| Arabidopsis thaliana ecotype KA-0 chromosome... 68 2e-009
gb|AF471814.1| Arabidopsis thaliana ecotype SU-0 chromosome... 68 2e-009
gb|AF471833.1| Arabidopsis thaliana ecotype PLA-0 chromosom... 68 2e-009
gb|AF471834.1| Arabidopsis thaliana ecotype BLA-10 chromoso... 68 2e-009
gb|AI999101.1|AI999101 701554459 A. thaliana, Columbia Col-... 66 1e-008
gb|BU636121.1|BU636121 045G06 Infected Arabidopsis Leaf Ara... 66 1e-008
gb|AV521723.1|AV521723 AV521723 Arabidopsis thaliana aboveg... 66 1e-008
gb|AV557883.1|AV557883 AV557883 Arabidopsis thaliana green ... 66 1e-008
gb|CK117656.1|CK117656 215c08.p1 AtM1 Arabidopsis thaliana ... 66 1e-008
gb|CK117801.1|CK117801 204g20.p1 AtM1 Arabidopsis thaliana ... 66 1e-008
gb|CK118307.1|CK118307 217h22.p1 AtM1 Arabidopsis thaliana ... 66 1e-008
gb|CK118414.1|CK118414 217b16.p1 AtM1 Arabidopsis thaliana ... 66 1e-008
gb|CK118523.1|CK118523 216n23.p1 AtM1 Arabidopsis thaliana ... 66 1e-008
gb|CK119903.1|CK119903 210g05.p1 AtM1 Arabidopsis thaliana ... 66 1e-008
gb|CK120137.1|CK120137 208l20.p1 AtM1 Arabidopsis thaliana ... 66 1e-008
gb|CK120144.1|CK120144 208l13.p1 AtM1 Arabidopsis thaliana ... 66 1e-008
gb|CK121154.1|CK121154 204f20.p1 AtM1 Arabidopsis thaliana ... 66 1e-008
gb|CK121335.1|CK121335 203j20.p1 AtM1 Arabidopsis thaliana ... 66 1e-008
gb|CK121656.1|CK121656 202f07.p1 AtM1 Arabidopsis thaliana ... 66 1e-008
gb|BP591446.1|BP591446 BP591446 RAFL15 Arabidopsis thaliana... 66 1e-008
gb|BP591469.1|BP591469 BP591469 RAFL15 Arabidopsis thaliana... 66 1e-008
gb|CB253302.1|CB253302 05-E010699-019-002-J02-T7R MPIZ-ADIS... 66 1e-008
gb|CB255379.1|CB255379 43-E012994-019-004-F11-SP6r MPIZ-ADI... 66 1e-008
gb|CB255382.1|CB255382 43-E012999-019-004-F11-T7R MPIZ-ADIS... 66 1e-008
gb|BP802897.1|BP802897 BP802897 RAFL14 Arabidopsis thaliana... 66 1e-008
gb|BP814381.1|BP814381 BP814381 RAFL19 Arabidopsis thaliana... 66 1e-008
gb|AY057643.1| Arabidopsis thaliana AT5g59910/mmn10_130 mRN... 66 1e-008
dbj|AB015475.1| Arabidopsis thaliana genomic DNA, chromosom... 66 1e-008
emb|CQ804484.1| Sequence 895 from Patent WO2004035798 66 1e-008
dbj|BA000015.5| Arabidopsis thaliana DNA, chromosome 5, com... 66 1e-008
gb|BT020297.1| Arabidopsis thaliana At5g59910 gene, complet... 66 1e-008
ref|NM_125384.2| Arabidopsis thaliana DNA binding AT5G59910... 66 1e-008
ref|NC_003076.4| Arabidopsis thaliana chromosome 5, complet... 66 1e-008
gb|BP562087.2|BP562087 BP562087 RAFL9 Arabidopsis thaliana ... 64 4e-008
gb|CL470783.1|CL470783 SAIL_148_C12.v1 SAIL Collection Arab... 62 2e-007
gb|CL491089.1|CL491089 SAIL_551_H02.v1 SAIL Collection Arab... 62 2e-007
gb|CW801553.1|CW801553 WiscDsLox494B05 Arabidopsis thaliana... 62 2e-007
gb|AY202019.1|AY202019 AY202019 Arabidopsis thaliana Landsb... 62 2e-007
gb|AY202020.1|AY202020 AY202020 Arabidopsis thaliana Landsb... 62 2e-007
gb|T22899.1|T22899 4907 Lambda-PRL2 Arabidopsis thaliana cD... 62 2e-007
gb|AA712800.1|AA712800 32359 Lambda-PRL2 Arabidopsis thalia... 62 2e-007
gb|T14148.1|T14148 2313 Lambda-PRL2 Arabidopsis thaliana cD... 62 2e-007
gb|T88557.1|T88557 12253 Lambda-PRL2 Arabidopsis thaliana c... 62 2e-007
gb|AV821359.1|AV821359 AV821359 RAFL4 Arabidopsis thaliana ... 62 2e-007
gb|CB262791.1|CB262791 46-E8976-008-017-L11-pBl2 MPIZ-ADIS-... 62 2e-007
gb|CB263874.1|CB263874 06-E9721-008-016-K01-pBl2 MPIZ-ADIS-... 62 2e-007
gb|CF651964.1|CF651964 25-L020578-066-004-A08-SP6P MPIZ-ADI... 62 2e-007
gb|CF652901.1|CF652901 83-L020526w-066-003-F22-SP6P MPIZ-AD... 62 2e-007
gb|AV559679.1|AV559679 AV559679 Arabidopsis thaliana green ... 62 2e-007
gb|CK117979.1|CK117979 208m24.p1 AtM1 Arabidopsis thaliana ... 62 2e-007
gb|BP592573.1|BP592573 BP592573 RAFL15 Arabidopsis thaliana... 62 2e-007
gb|BP642219.1|BP642219 BP642219 RAFL19 Arabidopsis thaliana... 62 2e-007
gb|BP801969.1|BP801969 BP801969 RAFL14 Arabidopsis thaliana... 62 2e-007
gb|BP815361.1|BP815361 BP815361 RAFL19 Arabidopsis thaliana... 62 2e-007
gb|BP823425.1|BP823425 BP823425 RAFL19 Arabidopsis thaliana... 62 2e-007
gb|BP846772.1|BP846772 BP846772 RAFL21 Arabidopsis thaliana... 62 2e-007
gb|BP867288.1|BP867288 BP867288 RAFL21 Arabidopsis thaliana... 62 2e-007
gb|AF102173.1|AF102173 Arabidopsis thaliana actin depolymer... 62 2e-007
gb|AY084352.1| Arabidopsis thaliana clone 10517 mRNA, compl... 62 2e-007
gb|AY086049.1| Arabidopsis thaliana clone 20822 mRNA, compl... 62 2e-007
emb|BX816118.1|CNS0ABRU Arabidopsis thaliana Full-length cD... 62 2e-007
emb|BX816346.1|CNS0ABM4 Arabidopsis thaliana Full-length cD... 62 2e-007
emb|AJ839038.1| Arabidopsis thaliana T-DNA flanking sequenc... 62 2e-007
dbj|BA000014.8| Arabidopsis thaliana, chromosome 3, complet... 62 2e-007
emb|AL132966.1|ATF4P12 Arabidopsis thaliana DNA chromosome ... 62 2e-007
emb|AL162459.2|ATF16L2 Arabidopsis thaliana DNA chromosome ... 62 2e-007
ref|NM_115225.1| Arabidopsis thaliana DNA binding AT3G53650... 62 2e-007
ref|NM_114472.2| Arabidopsis thaliana DNA binding AT3G46030... 62 2e-007
ref|NC_003074.4| Arabidopsis thaliana chromosome 3, complet... 62 2e-007
gb|BH610928.1|BH610928 SALK_018246 Arabidopsis thaliana TDN... 60 6e-007
gb|BH617416.1|BH617416 SALK_036467 Arabidopsis thaliana TDN... 60 6e-007
gb|BZ288838.1|BZ288838 SALK_022228.56.00.x Arabidopsis thal... 60 6e-007
gb|BZ289176.1|BZ289176 SALK_022573.48.40.x Arabidopsis thal... 60 6e-007
gb|BZ769396.1|BZ769396 SALK_142124.48.80.x Arabidopsis thal... 60 6e-007
gb|CL491150.1|CL491150 SAIL_553_B04.v3 SAIL Collection Arab... 60 6e-007
emb|CR401647.1| Arabidopsis thaliana T-DNA flanking sequenc... 60 6e-007
emb|CR401648.1| Arabidopsis thaliana T-DNA flanking sequenc... 60 6e-007
emb|CR401845.1| Arabidopsis thaliana T-DNA flanking sequenc... 60 6e-007
emb|CR401846.1| Arabidopsis thaliana T-DNA flanking sequenc... 60 6e-007
gb|Z26871.1|Z26871 ATTS1876 AC16H Arabidopsis thaliana cDNA... 60 6e-007
gb|Z47622.1|Z47622 ATTS4478 AC16H Arabidopsis thaliana cDNA... 60 6e-007
gb|T22855.1|T22855 4863 Lambda-PRL2 Arabidopsis thaliana cD... 60 6e-007
gb|R30263.1|R30263 12868 Lambda-PRL2 Arabidopsis thaliana c... 60 6e-007
gb|AU235967.1|AU235967 AU235967 RAFL14 Arabidopsis thaliana... 60 6e-007
gb|CB074430.1|CB074430 EST00945 Virulent Peronospora parasi... 60 6e-007
gb|CF652319.1|CF652319 48-L020164-066-001-O12-SP6P MPIZ-ADI... 60 6e-007
gb|AV562999.1|AV562999 AV562999 Arabidopsis thaliana green ... 60 6e-007
gb|CF773114.1|CF773114 AG_FSL_13B10 Arabidopsis ag-1 35S:AG... 60 6e-007
gb|CK117669.1|CK117669 214j19.p1 AtM1 Arabidopsis thaliana ... 60 6e-007
gb|CK118019.1|CK118019 207g23.p1 AtM1 Arabidopsis thaliana ... 60 6e-007
gb|CK119044.1|CK119044 214l11.p1 AtM1 Arabidopsis thaliana ... 60 6e-007
gb|CK119663.1|CK119663 211c17.p1 AtM1 Arabidopsis thaliana ... 60 6e-007
gb|BP564421.1|BP564421 BP564421 RAFL14 Arabidopsis thaliana... 60 6e-007
gb|BP579872.1|BP579872 BP579872 RAFL14 Arabidopsis thaliana... 60 6e-007
gb|BP581187.1|BP581187 BP581187 RAFL14 Arabidopsis thaliana... 60 6e-007
gb|BP597674.1|BP597674 BP597674 RAFL15 Arabidopsis thaliana... 60 6e-007
gb|CB252338.1|CB252338 29-E010007-019-001-I04-T7R MPIZ-ADIS... 60 6e-007
gb|CB253051.1|CB253051 10-E018437-019-009-C03-T7R MPIZ-ADIS... 60 6e-007
gb|CB253829.1|CB253829 87-E012997-019-004-M21-T7R MPIZ-ADIS... 60 6e-007
gb|CB255418.1|CB255418 42-E010007-019-001-C06-T7R MPIZ-ADIS... 60 6e-007
gb|BP803510.1|BP803510 BP803510 RAFL14 Arabidopsis thaliana... 60 6e-007
gb|BP803966.1|BP803966 BP803966 RAFL14 Arabidopsis thaliana... 60 6e-007
gb|BP812450.1|BP812450 BP812450 RAFL19 Arabidopsis thaliana... 60 6e-007
gb|BP814260.1|BP814260 BP814260 RAFL19 Arabidopsis thaliana... 60 6e-007
gb|BP821530.1|BP821530 BP821530 RAFL19 Arabidopsis thaliana... 60 6e-007
gb|BP822410.1|BP822410 BP822410 RAFL19 Arabidopsis thaliana... 60 6e-007
gb|BP822970.1|BP822970 BP822970 RAFL19 Arabidopsis thaliana... 60 6e-007
gb|BP824782.1|BP824782 BP824782 RAFL19 Arabidopsis thaliana... 60 6e-007
gb|BP826014.1|BP826014 BP826014 RAFL19 Arabidopsis thaliana... 60 6e-007
gb|BP827738.1|BP827738 BP827738 RAFL19 Arabidopsis thaliana... 60 6e-007
gb|BP829410.1|BP829410 BP829410 RAFL19 Arabidopsis thaliana... 60 6e-007
gb|BP831132.1|BP831132 BP831132 RAFL19 Arabidopsis thaliana... 60 6e-007
gb|BP834170.1|BP834170 BP834170 RAFL19 Arabidopsis thaliana... 60 6e-007
gb|BP834415.1|BP834415 BP834415 RAFL19 Arabidopsis thaliana... 60 6e-007
gb|BP836681.1|BP836681 BP836681 RAFL19 Arabidopsis thaliana... 60 6e-007
gb|BP837073.1|BP837073 BP837073 RAFL19 Arabidopsis thaliana... 60 6e-007
gb|BP837675.1|BP837675 BP837675 RAFL19 Arabidopsis thaliana... 60 6e-007
gb|BP839371.1|BP839371 BP839371 RAFL19 Arabidopsis thaliana... 60 6e-007
gb|BP840507.1|BP840507 BP840507 RAFL19 Arabidopsis thaliana... 60 6e-007
gb|BP854448.1|BP854448 BP854448 RAFL21 Arabidopsis thaliana... 60 6e-007
gb|BP856858.1|BP856858 BP856858 RAFL21 Arabidopsis thaliana... 60 6e-007
gb|AF471835.1| Arabidopsis thaliana ecotype DI-1 chromosome... 60 6e-007
gb|AF471836.1| Arabidopsis thaliana ecotype LM-2 chromosome... 60 6e-007
gb|AF471837.1| Arabidopsis thaliana ecotype MT-0 chromosome... 60 6e-007
gb|AF471838.1| Arabidopsis thaliana ecotype COL-0 chromosom... 60 6e-007
gb|AF471839.1| Arabidopsis thaliana ecotype AG-0 chromosome... 60 6e-007
gb|AF471840.1| Arabidopsis thaliana ecotype GY-0 chromosome... 60 6e-007
gb|AF471841.1| Arabidopsis thaliana ecotype AA-0 chromosome... 60 6e-007
gb|AF471842.1| Arabidopsis thaliana ecotype DI-0 chromosome... 60 6e-007
gb|AF471843.1| Arabidopsis thaliana ecotype MA-0 chromosome... 60 6e-007
gb|AF471844.1| Arabidopsis thaliana ecotype KIL-0 chromosom... 60 6e-007
emb|AX506052.1| Sequence 747 from Patent WO0216655 60 6e-007
emb|BX833190.1|CNS0A0CG Arabidopsis thaliana Full-length cD... 60 6e-007
dbj|AB005243.1| Arabidopsis thaliana genomic DNA, chromosom... 60 6e-007
emb|CQ804822.1| Sequence 1233 from Patent WO2004035798 60 6e-007
emb|Y07745.1|ATHISH2BL A.thaliana mRNA histone H2B like pro... 60 6e-007
ref|NM_122194.2| Arabidopsis thaliana DNA binding AT5G22880... 60 6e-007
emb|AL952711.1| Arabidopsis thaliana T-DNA flanking sequenc... 58 2e-006
gb|T04097.1|T04097 47 Lambda-PRL1 Arabidopsis thaliana cDNA... 58 2e-006
gb|BP565667.1|BP565667 BP565667 RAFL14 Arabidopsis thaliana... 58 2e-006
gb|Z18202.1|Z18202 ATTS0707 Grenoble-B Arabidopsis thaliana... 58 2e-006
emb|AL094930.1|CNS00XIS Arabidopsis thaliana genome survey ... 56 9e-006
gb|AY202021.1|AY202021 AY202021 Arabidopsis thaliana Landsb... 56 9e-006
gb|AA720269.1|AA720269 33462 Lambda-PRL2 Arabidopsis thalia... 56 9e-006
gb|T13853.1|T13853 2018 Lambda-PRL2 Arabidopsis thaliana cD... 56 9e-006
gb|AU235602.1|AU235602 AU235602 RAFL14 Arabidopsis thaliana... 56 9e-006
gb|AV552384.1|AV552384 AV552384 Arabidopsis thaliana roots ... 56 9e-006
gb|CK117943.1|CK117943 209b05.p1 AtM1 Arabidopsis thaliana ... 56 9e-006
gb|CK117978.1|CK117978 208m23.p1 AtM1 Arabidopsis thaliana ... 56 9e-006
gb|CK118052.1|CK118052 218h23.p1 AtM1 Arabidopsis thaliana ... 56 9e-006
gb|CK118120.1|CK118120 218a09.p1 AtM1 Arabidopsis thaliana ... 56 9e-006
gb|CK119134.1|CK119134 214b21.p1 AtM1 Arabidopsis thaliana ... 56 9e-006
gb|CK119155.1|CK119155 214a19.p1 AtM1 Arabidopsis thaliana ... 56 9e-006
gb|CK121285.1|CK121285 203m24.p1 AtM1 Arabidopsis thaliana ... 56 9e-006
gb|CK121397.1|CK121397 203f14.p1 AtM1 Arabidopsis thaliana ... 56 9e-006
gb|CK121854.1|CK121854 212m17.p1 AtM1 Arabidopsis thaliana ... 56 9e-006
gb|BP561503.1|BP561503 BP561503 RAFL7 Arabidopsis thaliana ... 56 9e-006
gb|BP624380.1|BP624380 BP624380 RAFL17 Arabidopsis thaliana... 56 9e-006
gb|BP641660.1|BP641660 BP641660 RAFL19 Arabidopsis thaliana... 56 9e-006
gb|BP643336.1|BP643336 BP643336 RAFL19 Arabidopsis thaliana... 56 9e-006
gb|BP796377.1|BP796377 BP796377 RAFL5 Arabidopsis thaliana ... 56 9e-006
gb|BP813666.1|BP813666 BP813666 RAFL19 Arabidopsis thaliana... 56 9e-006
gb|BP815526.1|BP815526 BP815526 RAFL19 Arabidopsis thaliana... 56 9e-006
gb|BP840182.1|BP840182 BP840182 RAFL19 Arabidopsis thaliana... 56 9e-006
gb|AY087219.1| Arabidopsis thaliana clone 32930 mRNA, compl... 56 9e-006
gb|BT006400.1| Arabidopsis thaliana At3g45980 gene, complet... 56 9e-006
emb|BX822784.1|CNS0A4UQ Arabidopsis thaliana Full-length cD... 56 9e-006
emb|BX824094.1|CNS0A6W9 Arabidopsis thaliana Full-length cD... 56 9e-006
emb|Y12576.1|ATH2B Arabidopsis thaliana mRNA for histone H2B 56 9e-006
ref|NM_114467.3| Arabidopsis thaliana DNA binding AT3G45980... 56 9e-006
gb|B76780.1|B76780 T26G2TR TAMU Arabidopsis thaliana genomi... 54 4e-005
gb|CC792902.1|CC792902 SALK_003306.56.00.n Arabidopsis thal... 54 4e-005
gb|CL469572.1|CL469572 SAIL_1307_B05.v1 SAIL Collection Ara... 54 4e-005
gb|CL494398.1|CL494398 SAIL_594_A07.v1 SAIL Collection Arab... 54 4e-005
gb|Z29157.1|Z29157 ATTS2103 Versailles-VB Arabidopsis thali... 54 4e-005
gb|T43468.1|T43468 6731 Lambda-PRL2 Arabidopsis thaliana cD... 54 4e-005
gb|AI992655.1|AI992655 701558589 A. thaliana, Ohio State cl... 54 4e-005
gb|AI999726.1|AI999726 701557189 A. thaliana, Columbia Col-... 54 4e-005
gb|AU226784.1|AU226784 AU226784 RAFL14 Arabidopsis thaliana... 54 4e-005
gb|AV828931.1|AV828931 AV828931 RAFL9 Arabidopsis thaliana ... 54 4e-005
gb|AU235990.1|AU235990 AU235990 RAFL14 Arabidopsis thaliana... 54 4e-005
gb|BU635121.1|BU635121 016A12 Infected Arabidopsis Leaf Ara... 54 4e-005
gb|CB263606.1|CB263606 14-E8975-008-017-K04-pBl2 MPIZ-ADIS-... 54 4e-005
gb|CF651258.1|CF651258 41-E009213w-013-001-A11-T7R MPIZ-ADI... 54 4e-005
gb|CF651259.1|CF651259 41-E021106-013-001-A11-T7R MPIZ-ADIS... 54 4e-005
gb|CK121749.1|CK121749 201a19.p1 AtM1 Arabidopsis thaliana ... 54 4e-005
gb|BP586131.1|BP586131 BP586131 RAFL15 Arabidopsis thaliana... 54 4e-005
gb|BP647465.1|BP647465 BP647465 RAFL19 Arabidopsis thaliana... 54 4e-005
gb|BP652615.1|BP652615 BP652615 RAFL19 Arabidopsis thaliana... 54 4e-005
gb|CB254707.1|CB254707 62-E012995-019-004-L16-SP6r MPIZ-ADI... 54 4e-005
gb|CB254710.1|CB254710 62-E013000-019-004-L16-T7R MPIZ-ADIS... 54 4e-005
gb|BP804090.1|BP804090 BP804090 RAFL14 Arabidopsis thaliana... 54 4e-005
gb|BP817957.1|BP817957 BP817957 RAFL19 Arabidopsis thaliana... 54 4e-005
gb|BP836709.1|BP836709 BP836709 RAFL19 Arabidopsis thaliana... 54 4e-005
gb|BP839918.1|BP839918 BP839918 RAFL19 Arabidopsis thaliana... 54 4e-005
gb|BP855856.1|BP855856 BP855856 RAFL21 Arabidopsis thaliana... 54 4e-005
gb|BP864961.1|BP864961 BP864961 RAFL21 Arabidopsis thaliana... 54 4e-005
gb|BP866899.1|BP866899 BP866899 RAFL21 Arabidopsis thaliana... 54 4e-005
gb|AY057605.1| Arabidopsis thaliana At2g28720/T11P11.3 mRNA... 54 4e-005
gb|AF325075.1|AF325075 Arabidopsis thaliana putative histon... 54 4e-005
gb|AY124835.1| Arabidopsis thaliana At2g28720/T11P11.3 mRNA... 54 4e-005
emb|AX507201.1| Sequence 1896 from Patent WO0216655 54 4e-005
gb|BT005206.1| Arabidopsis thaliana At2g37470 mRNA, complet... 54 4e-005
gb|AY085391.1| Arabidopsis thaliana clone 14965 mRNA, compl... 54 4e-005
gb|AY087125.1| Arabidopsis thaliana clone 31973 mRNA, compl... 54 4e-005
gb|AC005896.3| Arabidopsis thaliana chromosome 2 clone F3G5... 54 4e-005
gb|AC007184.4| Arabidopsis thaliana chromosome 2 clone T11P... 54 4e-005
emb|BX819107.1|CNS0AA81 Arabidopsis thaliana Full-length cD... 54 4e-005
emb|BX821556.1|CNS0AAGB Arabidopsis thaliana Full-length cD... 54 4e-005
emb|BX813779.1|CNS0AEHZ Arabidopsis thaliana Full-length cD... 54 4e-005
ref|NM_129302.2| Arabidopsis thaliana DNA binding AT2G37470... 54 4e-005
ref|NM_128433.3| Arabidopsis thaliana DNA binding AT2G28720... 54 4e-005
ref|NC_003071.3| Arabidopsis thaliana chromosome 2, complet... 54 4e-005
gb|CL489531.1|CL489531 SAIL_525_F04.v1 SAIL Collection Arab... 52 1e-004
gb|R29809.1|R29809 12414 Lambda-PRL2 Arabidopsis thaliana c... 52 1e-004
gb|T45496.1|T45496 8759 Lambda-PRL2 Arabidopsis thaliana cD... 52 1e-004
gb|AU226337.1|AU226337 AU226337 RAFL14 Arabidopsis thaliana... 52 1e-004
gb|CB252613.1|CB252613 21-E018362-019-007-J05-T7R MPIZ-ADIS... 52 1e-004
gb|CB253825.1|CB253825 87-E012992-019-004-M21-SP6r MPIZ-ADI... 52 1e-004
gb|BP805281.1|BP805281 BP805281 RAFL16 Arabidopsis thaliana... 52 1e-004
gb|BP810218.1|BP810218 BP810218 RAFL16 Arabidopsis thaliana... 52 1e-004
gb|BP819311.1|BP819311 BP819311 RAFL19 Arabidopsis thaliana... 52 1e-004
gb|BP823037.1|BP823037 BP823037 RAFL19 Arabidopsis thaliana... 52 1e-004
gb|BP823124.1|BP823124 BP823124 RAFL19 Arabidopsis thaliana... 52 1e-004
gb|BP826623.1|BP826623 BP826623 RAFL19 Arabidopsis thaliana... 52 1e-004
gb|BP834871.1|BP834871 BP834871 RAFL19 Arabidopsis thaliana... 52 1e-004
gb|BP835400.1|BP835400 BP835400 RAFL19 Arabidopsis thaliana... 52 1e-004
gb|BP836150.1|BP836150 BP836150 RAFL19 Arabidopsis thaliana... 52 1e-004
emb|AL162971.1|ATT22P11 Arabidopsis thaliana DNA chromosome... 52 1e-004
ref|NM_120335.1| Arabidopsis thaliana DNA binding AT5G02570... 52 1e-004
emb|CR399380.1| Arabidopsis thaliana T-DNA flanking sequenc... 50 6e-004
gb|CW796725.1|CW796725 WiscDsLox465C5 Arabidopsis thaliana ... 50 6e-004
gb|T21790.1|T21790 3798 Lambda-PRL2 Arabidopsis thaliana cD... 50 6e-004
gb|C99791.1|C99791 C99791 YAC clone CIC8B11 region-specific... 50 6e-004
gb|CA963968.1|CA963968 cATI008B02AF Infected Arabidopsis Le... 50 6e-004
gb|BP816537.1|BP816537 BP816537 RAFL19 Arabidopsis thaliana... 50 6e-004
gb|AY203572.1|AY203572 AY203572 Arabidopsis thaliana Landsb... 48 0.002
gb|BP565885.1|BP565885 BP565885 RAFL14 Arabidopsis thaliana... 48 0.002
gb|BP596496.1|BP596496 BP596496 RAFL15 Arabidopsis thaliana... 48 0.002
gb|BT010498.1| Arabidopsis thaliana At3g09480 gene, complet... 48 0.002
gb|AC016661.7|AC016661 Arabidopsis thaliana chromosome 3 BA... 48 0.002
dbj|AK175800.1| Arabidopsis thaliana mRNA for putative hist... 48 0.002
dbj|AK176003.1| Arabidopsis thaliana mRNA for putative hist... 48 0.002
dbj|AK176835.1| Arabidopsis thaliana mRNA for putative hist... 48 0.002
ref|NM_111782.1| Arabidopsis thaliana DNA binding AT3G09480... 48 0.002
gb|BZ292636.1|BZ292636 SALK_124939.52.00.x Arabidopsis thal... 46 0.009
emb|AL756239.1| Arabidopsis thaliana T-DNA flanking sequenc... 46 0.009
gb|AI100688.1|AI100688 34385 Lambda-PRL2 Arabidopsis thalia... 46 0.009
gb|AV806453.1|AV806453 AV806453 RAFL9 Arabidopsis thaliana ... 46 0.009
gb|AV537095.1|AV537095 AV537095 Arabidopsis thaliana liquid... 46 0.009
gb|AV567456.1|AV567456 AV567456 Arabidopsis thaliana green ... 46 0.009
gb|BP568688.1|BP568688 BP568688 RAFL14 Arabidopsis thaliana... 46 0.009
gb|BP571003.1|BP571003 BP571003 RAFL14 Arabidopsis thaliana... 46 0.009
gb|BP571654.1|BP571654 BP571654 RAFL14 Arabidopsis thaliana... 46 0.009
gb|BP571920.1|BP571920 BP571920 RAFL14 Arabidopsis thaliana... 46 0.009
gb|BP576224.1|BP576224 BP576224 RAFL14 Arabidopsis thaliana... 46 0.009
gb|BP576387.1|BP576387 BP576387 RAFL14 Arabidopsis thaliana... 46 0.009
gb|BP580308.1|BP580308 BP580308 RAFL14 Arabidopsis thaliana... 46 0.009
gb|BP582160.1|BP582160 BP582160 RAFL14 Arabidopsis thaliana... 46 0.009
gb|BP587491.1|BP587491 BP587491 RAFL15 Arabidopsis thaliana... 46 0.009
gb|BP593701.1|BP593701 BP593701 RAFL15 Arabidopsis thaliana... 46 0.009
gb|BP594138.1|BP594138 BP594138 RAFL15 Arabidopsis thaliana... 46 0.009
gb|BP595772.1|BP595772 BP595772 RAFL15 Arabidopsis thaliana... 46 0.009
gb|BP599053.1|BP599053 BP599053 RAFL16 Arabidopsis thaliana... 46 0.009
gb|BP602161.1|BP602161 BP602161 RAFL16 Arabidopsis thaliana... 46 0.009
gb|BP607237.1|BP607237 BP607237 RAFL16 Arabidopsis thaliana... 46 0.009
gb|BP628089.1|BP628089 BP628089 RAFL17 Arabidopsis thaliana... 46 0.009
gb|BP636328.1|BP636328 BP636328 RAFL18 Arabidopsis thaliana... 46 0.009
gb|BP645624.1|BP645624 BP645624 RAFL19 Arabidopsis thaliana... 46 0.009
gb|BP650551.1|BP650551 BP650551 RAFL19 Arabidopsis thaliana... 46 0.009
gb|BP650608.1|BP650608 BP650608 RAFL19 Arabidopsis thaliana... 46 0.009
gb|BP650985.1|BP650985 BP650985 RAFL19 Arabidopsis thaliana... 46 0.009
gb|BP657853.1|BP657853 BP657853 RAFL19 Arabidopsis thaliana... 46 0.009
gb|BP658892.1|BP658892 BP658892 RAFL19 Arabidopsis thaliana... 46 0.009
gb|BP665269.1|BP665269 BP665269 RAFL21 Arabidopsis thaliana... 46 0.009
gb|BP793366.1|BP793366 BP793366 RAFL7 Arabidopsis thaliana ... 46 0.009
gb|BP825734.1|BP825734 BP825734 RAFL19 Arabidopsis thaliana... 46 0.009
gb|BP837854.1|BP837854 BP837854 RAFL19 Arabidopsis thaliana... 46 0.009
gb|BP841779.1|BP841779 BP841779 RAFL21 Arabidopsis thaliana... 46 0.009
gb|BP858977.1|BP858977 BP858977 RAFL21 Arabidopsis thaliana... 46 0.009
gb|CL499371.1|CL499371 SAIL_667_G10.v1 SAIL Collection Arab... 44 0.036
gb|AU226757.1|AU226757 AU226757 RAFL14 Arabidopsis thaliana... 44 0.036
gb|BP585021.1|BP585021 BP585021 RAFL15 Arabidopsis thaliana... 44 0.036
gb|BP595243.1|BP595243 BP595243 RAFL15 Arabidopsis thaliana... 44 0.036
gb|BP596859.1|BP596859 BP596859 RAFL15 Arabidopsis thaliana... 44 0.036
gb|BP597022.1|BP597022 BP597022 RAFL15 Arabidopsis thaliana... 44 0.036
gb|BP614135.1|BP614135 BP614135 RAFL16 Arabidopsis thaliana... 44 0.036
gb|BP816452.1|BP816452 BP816452 RAFL19 Arabidopsis thaliana... 44 0.036
gb|B11088.1|B11088 T13M11-T7 TAMU Arabidopsis thaliana geno... 42 0.14
emb|AL755493.1| Arabidopsis thaliana T-DNA flanking sequenc... 42 0.14
gb|R83948.1|R83948 15907 Lambda-PRL2 Arabidopsis thaliana c... 42 0.14
gb|BP570834.1|BP570834 BP570834 RAFL14 Arabidopsis thaliana... 42 0.14
gb|BP608591.1|BP608591 BP608591 RAFL16 Arabidopsis thaliana... 42 0.14
gb|BP634381.1|BP634381 BP634381 RAFL17 Arabidopsis thaliana... 42 0.14
gb|BP656677.1|BP656677 BP656677 RAFL19 Arabidopsis thaliana... 42 0.14
gb|BP660344.1|BP660344 BP660344 RAFL19 Arabidopsis thaliana... 42 0.14
gb|BP831315.1|BP831315 BP831315 RAFL19 Arabidopsis thaliana... 42 0.14
>gb|AV540331.1|AV540331 AV540331 Arabidopsis thaliana roots Columbia Arabidopsis thaliana
cDNA clone RZ149b03F 3', mRNA sequence
Length = 204
Score = 85.7 bits (43), Expect = 1e-014
Identities = 106/127 (83%)
Strand = Plus / Plus
Query: 241 gagctagtgaacttggtgacggctttggtgccctcggagacggcgtgcttggcgagctcg 300
|||||||| |||||||| || || ||||| || || ||||||||||| || ||||| ||
Sbjct: 35 gagctagtaaacttggtaaccgccttggtaccttcagagacggcgtgtttagcgagttca 94
Query: 301 ccggggaggacgaggcggacggaggtctggatctcgcgggacgtgatggtaggcttcttg 360
|||||||||||||| | || | |||||||||||||| || || ||||| |||||||||
Sbjct: 95 ccggggaggacgagtctcacagccgtctggatctcgcgagatgtaatggtcggcttcttg 154
Query: 361 ttgtacc 367
|||||||
Sbjct: 155 ttgtacc 161
>gb|AV557321.1|AV557321 AV557321 Arabidopsis thaliana green siliques Columbia Arabidopsis
thaliana cDNA clone SQ065f12F 3', mRNA sequence
Length = 476
Score = 85.7 bits (43), Expect = 1e-014
Identities = 106/127 (83%)
Strand = Plus / Plus
Query: 241 gagctagtgaacttggtgacggctttggtgccctcggagacggcgtgcttggcgagctcg 300
|||||||| |||||||| || || ||||| || || ||||||||||| || ||||| ||
Sbjct: 178 gagctagtaaacttggtaaccgccttggtaccttcagagacggcgtgtttagcgagttca 237
Query: 301 ccggggaggacgaggcggacggaggtctggatctcgcgggacgtgatggtaggcttcttg 360
|||||||||||||| | || | |||||||||||||| || || ||||| |||||||||
Sbjct: 238 ccggggaggacgagtctcacagccgtctggatctcgcgagatgtaatggtcggcttcttg 297
Query: 361 ttgtacc 367
|||||||
Sbjct: 298 ttgtacc 304
Score = 69.9 bits (35), Expect = 6e-010
Identities = 35/35 (100%)
Strand = Plus / Plus
Query: 469 acctgcttcagcaccttgaagatgtagatcttgta 503
|||||||||||||||||||||||||||||||||||
Sbjct: 406 acctgcttcagcaccttgaagatgtagatcttgta 440
>gb|BP619021.1|BP619021 BP619021 RAFL16 Arabidopsis thaliana cDNA clone RAFL16-30-L06 3',
mRNA sequence
Length = 447
Score = 85.7 bits (43), Expect = 1e-014
Identities = 106/127 (83%)
Strand = Plus / Plus
Query: 241 gagctagtgaacttggtgacggctttggtgccctcggagacggcgtgcttggcgagctcg 300
|||||||| |||||||| || || ||||| || || ||||||||||| || ||||| ||
Sbjct: 167 gagctagtaaacttggtaaccgccttggtaccttcagagacggcgtgtttagcgagttca 226
Query: 301 ccggggaggacgaggcggacggaggtctggatctcgcgggacgtgatggtaggcttcttg 360
|||||||||||||| | || | |||||||||||||| || || ||||| |||||||||
Sbjct: 227 ccggggaggacgagtctcacagccgtctggatctcgcgagatgtaatggtcggcttcttg 286
Query: 361 ttgtacc 367
|||||||
Sbjct: 287 ttgtacc 293
Score = 69.9 bits (35), Expect = 6e-010
Identities = 35/35 (100%)
Strand = Plus / Plus
Query: 469 acctgcttcagcaccttgaagatgtagatcttgta 503
|||||||||||||||||||||||||||||||||||
Sbjct: 395 acctgcttcagcaccttgaagatgtagatcttgta 429
Score = 44.1 bits (22), Expect = 0.036
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 394 agcttctcgaagatgtcgttgatgaa 419
||||||||||| ||||||||||||||
Sbjct: 321 agcttctcgaatatgtcgttgatgaa 346
>gb|CB255588.1|CB255588 37-E015391-019-006-I09-T7R MPIZ-ADIS-019 Arabidopsis thaliana cDNA
clone MPIZp768I096Q 5-PRIME, mRNA sequence
Length = 677
Score = 85.7 bits (43), Expect = 1e-014
Identities = 106/127 (83%)
Strand = Plus / Minus
Query: 241 gagctagtgaacttggtgacggctttggtgccctcggagacggcgtgcttggcgagctcg 300
|||||||| |||||||| || || ||||| || || ||||||||||| || ||||| ||
Sbjct: 477 gagctagtaaacttggtaaccgccttggtaccttcagagacggcgtgtttagcgagttca 418
Query: 301 ccggggaggacgaggcggacggaggtctggatctcgcgggacgtgatggtaggcttcttg 360
|||||||||||||| | || | |||||||||||||| || || ||||| |||||||||
Sbjct: 417 ccggggaggacgagtctcacagccgtctggatctcgcgagatgtaatggtcggcttcttg 358
Query: 361 ttgtacc 367
|||||||
Sbjct: 357 ttgtacc 351
Score = 69.9 bits (35), Expect = 6e-010
Identities = 35/35 (100%)
Strand = Plus / Minus
Query: 469 acctgcttcagcaccttgaagatgtagatcttgta 503
|||||||||||||||||||||||||||||||||||
Sbjct: 249 acctgcttcagcaccttgaagatgtagatcttgta 215
>gb|BP787756.1|BP787756 BP787756 RAFL7 Arabidopsis thaliana cDNA clone RAFL26-05-I12 3',
mRNA sequence
Length = 388
Score = 85.7 bits (43), Expect = 1e-014
Identities = 106/127 (83%)
Strand = Plus / Plus
Query: 241 gagctagtgaacttggtgacggctttggtgccctcggagacggcgtgcttggcgagctcg 300
|||||||| |||||||| || || ||||| || || ||||||||||| || ||||| ||
Sbjct: 184 gagctagtaaacttggtaaccgccttggtaccttcagagacggcgtgtttagcgagttca 243
Query: 301 ccggggaggacgaggcggacggaggtctggatctcgcgggacgtgatggtaggcttcttg 360
|||||||||||||| | || | |||||||||||||| || || ||||| |||||||||
Sbjct: 244 ccggggaggacgagtctcacagccgtctggatctcgcgagatgtaatggtcggcttcttg 303
Query: 361 ttgtacc 367
|||||||
Sbjct: 304 ttgtacc 310
Score = 44.1 bits (22), Expect = 0.036
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 394 agcttctcgaagatgtcgttgatgaa 419
||||||||||| ||||||||||||||
Sbjct: 337 agcttctcgaatatgtcgttgatgaa 362
>gb|U34757.2|ATU34757 Arabidopsis thaliana phosphoribosylanthranilate isomerase (PAI1) and
(PAI4) genes, complete cds
Length = 10784
Score = 85.7 bits (43), Expect = 1e-014
Identities = 106/127 (83%)
Strand = Plus / Plus
Query: 241 gagctagtgaacttggtgacggctttggtgccctcggagacggcgtgcttggcgagctcg 300
|||||||| |||||||| || || ||||| || || ||||||||||| || ||||| ||
Sbjct: 9227 gagctagtaaacttggtaaccgccttggtaccttcagagacggcgtgtttagcgagttca 9286
Query: 301 ccggggaggacgaggcggacggaggtctggatctcgcgggacgtgatggtaggcttcttg 360
|||||||||||||| | || | |||||||||||||| || || ||||| |||||||||
Sbjct: 9287 ccggggaggacgagtctcacagccgtctggatctcgcgagatgtaatggtcggcttcttg 9346
Query: 361 ttgtacc 367
|||||||
Sbjct: 9347 ttgtacc 9353
Score = 85.7 bits (43), Expect = 1e-014
Identities = 106/127 (83%)
Strand = Plus / Plus
Query: 241 gagctagtgaacttggtgacggctttggtgccctcggagacggcgtgcttggcgagctcg 300
|||||||| |||||||| || || ||||| || || ||||||||||| || ||||| ||
Sbjct: 2405 gagctagtaaacttggtaaccgccttggtaccttcagagacggcgtgtttagcgagttca 2464
Query: 301 ccggggaggacgaggcggacggaggtctggatctcgcgggacgtgatggtaggcttcttg 360
|||||||||||||| | || | |||||||||||||| || || ||||| |||||||||
Sbjct: 2465 ccggggaggacgagtctcacagccgtctggatctcgcgagatgtaatggtcggcttcttg 2524
Query: 361 ttgtacc 367
|||||||
Sbjct: 2525 ttgtacc 2531
Score = 61.9 bits (31), Expect = 2e-007
Identities = 34/35 (97%)
Strand = Plus / Plus
Query: 469 acctgcttcagcaccttgaagatgtagatcttgta 503
||||||||||| |||||||||||||||||||||||
Sbjct: 9455 acctgcttcagaaccttgaagatgtagatcttgta 9489
Score = 61.9 bits (31), Expect = 2e-007
Identities = 34/35 (97%)
Strand = Plus / Plus
Query: 469 acctgcttcagcaccttgaagatgtagatcttgta 503
||||||||||| |||||||||||||||||||||||
Sbjct: 2633 acctgcttcagaaccttgaagatgtagatcttgta 2667
>gb|AF130878.1|AF130878 Arabidopsis thaliana phosphoribosylanthranilate isomerase (PAI1)
gene, complete cds
Length = 7484
Score = 85.7 bits (43), Expect = 1e-014
Identities = 106/127 (83%)
Strand = Plus / Plus
Query: 241 gagctagtgaacttggtgacggctttggtgccctcggagacggcgtgcttggcgagctcg 300
|||||||| |||||||| || || ||||| || || ||||||||||| || ||||| ||
Sbjct: 2866 gagctagtaaacttggtaaccgccttggtaccttcagagacggcgtgtttagcgagttca 2925
Query: 301 ccggggaggacgaggcggacggaggtctggatctcgcgggacgtgatggtaggcttcttg 360
|||||||||||||| | || | |||||||||||||| || || ||||| |||||||||
Sbjct: 2926 ccggggaggacgagtctcacagccgtctggatctcgcgagatgtaatggtcggcttcttg 2985
Query: 361 ttgtacc 367
|||||||
Sbjct: 2986 ttgtacc 2992
Score = 69.9 bits (35), Expect = 6e-010
Identities = 35/35 (100%)
Strand = Plus / Plus
Query: 469 acctgcttcagcaccttgaagatgtagatcttgta 503
|||||||||||||||||||||||||||||||||||
Sbjct: 3094 acctgcttcagcaccttgaagatgtagatcttgta 3128
>gb|AE005172.1| Arabidopsis thaliana chromosome 1, top arm complete sequence
Length = 14221815
Score = 85.7 bits (43), Expect = 1e-014
Identities = 106/127 (83%)
Strand = Plus / Minus
Query: 241 gagctagtgaacttggtgacggctttggtgccctcggagacggcgtgcttggcgagctcg 300
|||||||| |||||||| || || ||||| || || ||||||||||| || ||||| ||
Sbjct: 2413335 gagctagtaaacttggtaaccgccttggtaccttcagagacggcgtgtttagcgagttca 2413276
Query: 301 ccggggaggacgaggcggacggaggtctggatctcgcgggacgtgatggtaggcttcttg 360
|||||||||||||| | || | |||||||||||||| || || ||||| |||||||||
Sbjct: 2413275 ccggggaggacgagtctcacagccgtctggatctcgcgagatgtaatggtcggcttcttg 2413216
Query: 361 ttgtacc 367
|||||||
Sbjct: 2413215 ttgtacc 2413209
Score = 69.9 bits (35), Expect = 6e-010
Identities = 35/35 (100%)
Strand = Plus / Minus
Query: 469 acctgcttcagcaccttgaagatgtagatcttgta 503
|||||||||||||||||||||||||||||||||||
Sbjct: 2413107 acctgcttcagcaccttgaagatgtagatcttgta 2413073
>gb|AY070760.1| Arabidopsis thaliana At1g07790/F24B9_10 mRNA, complete cds
Length = 709
Score = 85.7 bits (43), Expect = 1e-014
Identities = 106/127 (83%)
Strand = Plus / Minus
Query: 241 gagctagtgaacttggtgacggctttggtgccctcggagacggcgtgcttggcgagctcg 300
|||||||| |||||||| || || ||||| || || ||||||||||| || ||||| ||
Sbjct: 491 gagctagtaaacttggtaaccgccttggtaccttcagagacggcgtgtttagcgagttca 432
Query: 301 ccggggaggacgaggcggacggaggtctggatctcgcgggacgtgatggtaggcttcttg 360
|||||||||||||| | || | |||||||||||||| || || ||||| |||||||||
Sbjct: 431 ccggggaggacgagtctcacagccgtctggatctcgcgagatgtaatggtcggcttcttg 372
Query: 361 ttgtacc 367
|||||||
Sbjct: 371 ttgtacc 365
Score = 69.9 bits (35), Expect = 6e-010
Identities = 35/35 (100%)
Strand = Plus / Minus
Query: 469 acctgcttcagcaccttgaagatgtagatcttgta 503
|||||||||||||||||||||||||||||||||||
Sbjct: 263 acctgcttcagcaccttgaagatgtagatcttgta 229
>gb|AY133638.1| Arabidopsis thaliana At1g07790/F24B9_10 mRNA, complete cds
Length = 447
Score = 85.7 bits (43), Expect = 1e-014
Identities = 106/127 (83%)
Strand = Plus / Minus
Query: 241 gagctagtgaacttggtgacggctttggtgccctcggagacggcgtgcttggcgagctcg 300
|||||||| |||||||| || || ||||| || || ||||||||||| || ||||| ||
Sbjct: 443 gagctagtaaacttggtaaccgccttggtaccttcagagacggcgtgtttagcgagttca 384
Query: 301 ccggggaggacgaggcggacggaggtctggatctcgcgggacgtgatggtaggcttcttg 360
|||||||||||||| | || | |||||||||||||| || || ||||| |||||||||
Sbjct: 383 ccggggaggacgagtctcacagccgtctggatctcgcgagatgtaatggtcggcttcttg 324
Query: 361 ttgtacc 367
|||||||
Sbjct: 323 ttgtacc 317
Score = 69.9 bits (35), Expect = 6e-010
Identities = 35/35 (100%)
Strand = Plus / Minus
Query: 469 acctgcttcagcaccttgaagatgtagatcttgta 503
|||||||||||||||||||||||||||||||||||
Sbjct: 215 acctgcttcagcaccttgaagatgtagatcttgta 181
>gb|AY088636.1| Arabidopsis thaliana clone 8711 mRNA, complete sequence
Length = 704
Score = 85.7 bits (43), Expect = 1e-014
Identities = 106/127 (83%)
Strand = Plus / Minus
Query: 241 gagctagtgaacttggtgacggctttggtgccctcggagacggcgtgcttggcgagctcg 300
|||||||| |||||||| || || ||||| || || ||||||||||| || ||||| ||
Sbjct: 513 gagctagtaaacttggtaaccgccttggtaccttcagagacggcgtgtttagcgagttca 454
Query: 301 ccggggaggacgaggcggacggaggtctggatctcgcgggacgtgatggtaggcttcttg 360
|||||||||||||| | || | |||||||||||||| || || ||||| |||||||||
Sbjct: 453 ccggggaggacgagtctcacagccgtctggatctcgcgagatgtaatggtcggcttcttg 394
Query: 361 ttgtacc 367
|||||||
Sbjct: 393 ttgtacc 387
Score = 61.9 bits (31), Expect = 2e-007
Identities = 34/35 (97%)
Strand = Plus / Minus
Query: 469 acctgcttcagcaccttgaagatgtagatcttgta 503
||||||||||| |||||||||||||||||||||||
Sbjct: 285 acctgcttcagaaccttgaagatgtagatcttgta 251
>gb|AF332446.1| Arabidopsis thaliana clone C00142 (p) putative histone H2B protein
(At1g07790) mRNA, complete cds
Length = 447
Score = 85.7 bits (43), Expect = 1e-014
Identities = 106/127 (83%)
Strand = Plus / Minus
Query: 241 gagctagtgaacttggtgacggctttggtgccctcggagacggcgtgcttggcgagctcg 300
|||||||| |||||||| || || ||||| || || ||||||||||| || ||||| ||
Sbjct: 443 gagctagtaaacttggtaaccgccttggtaccttcagagacggcgtgtttagcgagttca 384
Query: 301 ccggggaggacgaggcggacggaggtctggatctcgcgggacgtgatggtaggcttcttg 360
|||||||||||||| | || | |||||||||||||| || || ||||| |||||||||
Sbjct: 383 ccggggaggacgagtctcacagccgtctggatctcgcgagatgtaatggtcggcttcttg 324
Query: 361 ttgtacc 367
|||||||
Sbjct: 323 ttgtacc 317
Score = 69.9 bits (35), Expect = 6e-010
Identities = 35/35 (100%)
Strand = Plus / Minus
Query: 469 acctgcttcagcaccttgaagatgtagatcttgta 503
|||||||||||||||||||||||||||||||||||
Sbjct: 215 acctgcttcagcaccttgaagatgtagatcttgta 181
>gb|AC007583.2|F24B9 Arabidopsis thaliana chromosome 1 BAC F24B9 sequence, complete sequence
Length = 107234
Score = 85.7 bits (43), Expect = 1e-014
Identities = 106/127 (83%)
Strand = Plus / Plus
Query: 241 gagctagtgaacttggtgacggctttggtgccctcggagacggcgtgcttggcgagctcg 300
|||||||| |||||||| || || ||||| || || ||||||||||| || ||||| ||
Sbjct: 31741 gagctagtaaacttggtaaccgccttggtaccttcagagacggcgtgtttagcgagttca 31800
Query: 301 ccggggaggacgaggcggacggaggtctggatctcgcgggacgtgatggtaggcttcttg 360
|||||||||||||| | || | |||||||||||||| || || ||||| |||||||||
Sbjct: 31801 ccggggaggacgagtctcacagccgtctggatctcgcgagatgtaatggtcggcttcttg 31860
Query: 361 ttgtacc 367
|||||||
Sbjct: 31861 ttgtacc 31867
Score = 69.9 bits (35), Expect = 6e-010
Identities = 35/35 (100%)
Strand = Plus / Plus
Query: 469 acctgcttcagcaccttgaagatgtagatcttgta 503
|||||||||||||||||||||||||||||||||||
Sbjct: 31969 acctgcttcagcaccttgaagatgtagatcttgta 32003
>ref|NM_100653.2| Arabidopsis thaliana DNA binding AT1G07790 mRNA, complete cds
Length = 729
Score = 85.7 bits (43), Expect = 1e-014
Identities = 106/127 (83%)
Strand = Plus / Minus
Query: 241 gagctagtgaacttggtgacggctttggtgccctcggagacggcgtgcttggcgagctcg 300
|||||||| |||||||| || || ||||| || || ||||||||||| || ||||| ||
Sbjct: 512 gagctagtaaacttggtaaccgccttggtaccttcagagacggcgtgtttagcgagttca 453
Query: 301 ccggggaggacgaggcggacggaggtctggatctcgcgggacgtgatggtaggcttcttg 360
|||||||||||||| | || | |||||||||||||| || || ||||| |||||||||
Sbjct: 452 ccggggaggacgagtctcacagccgtctggatctcgcgagatgtaatggtcggcttcttg 393
Query: 361 ttgtacc 367
|||||||
Sbjct: 392 ttgtacc 386
Score = 69.9 bits (35), Expect = 6e-010
Identities = 35/35 (100%)
Strand = Plus / Minus
Query: 469 acctgcttcagcaccttgaagatgtagatcttgta 503
|||||||||||||||||||||||||||||||||||
Sbjct: 284 acctgcttcagcaccttgaagatgtagatcttgta 250
>ref|NC_003070.5| Arabidopsis thaliana chromosome 1, complete sequence
Length = 30432563
Score = 85.7 bits (43), Expect = 1e-014
Identities = 106/127 (83%)
Strand = Plus / Minus
Query: 241 gagctagtgaacttggtgacggctttggtgccctcggagacggcgtgcttggcgagctcg 300
|||||||| |||||||| || || ||||| || || ||||||||||| || ||||| ||
Sbjct: 2413488 gagctagtaaacttggtaaccgccttggtaccttcagagacggcgtgtttagcgagttca 2413429
Query: 301 ccggggaggacgaggcggacggaggtctggatctcgcgggacgtgatggtaggcttcttg 360
|||||||||||||| | || | |||||||||||||| || || ||||| |||||||||
Sbjct: 2413428 ccggggaggacgagtctcacagccgtctggatctcgcgagatgtaatggtcggcttcttg 2413369
Query: 361 ttgtacc 367
|||||||
Sbjct: 2413368 ttgtacc 2413362
Score = 69.9 bits (35), Expect = 6e-010
Identities = 35/35 (100%)
Strand = Plus / Minus
Query: 469 acctgcttcagcaccttgaagatgtagatcttgta 503
|||||||||||||||||||||||||||||||||||
Sbjct: 2413260 acctgcttcagcaccttgaagatgtagatcttgta 2413226
>gb|CK118206.1|CK118206 217m08.p1 AtM1 Arabidopsis thaliana cDNA clone MPMGp2011M08217
5-PRIME, mRNA sequence
Length = 466
Score = 81.8 bits (41), Expect = 2e-013
Identities = 104/125 (83%)
Strand = Plus / Minus
Query: 243 gctagtgaacttggtgacggctttggtgccctcggagacggcgtgcttggcgagctcgcc 302
|||||| |||||||| ||| | ||||| || || ||||||||||| || ||||| || ||
Sbjct: 466 gctagtaaacttggtaacgcccttggtaccttcagagacggcgtgtttagcgagttcacc 407
Query: 303 ggggaggacgaggcggacggaggtctggatctcgcgggacgtgatggtaggcttcttgtt 362
|||||||||||| | || | |||||||||||||| || || ||||| |||||||||||
Sbjct: 406 ggggaggacgagtctcacagccgtctggatctcgcgagatgtaatggtcggcttcttgtt 347
Query: 363 gtacc 367
|||||
Sbjct: 346 gtacc 342
Score = 69.9 bits (35), Expect = 6e-010
Identities = 35/35 (100%)
Strand = Plus / Minus
Query: 469 acctgcttcagcaccttgaagatgtagatcttgta 503
|||||||||||||||||||||||||||||||||||
Sbjct: 240 acctgcttcagcaccttgaagatgtagatcttgta 206
>gb|BP586960.1|BP586960 BP586960 RAFL15 Arabidopsis thaliana cDNA clone RAFL15-08-E08 3',
mRNA sequence
Length = 422
Score = 77.8 bits (39), Expect = 3e-012
Identities = 105/127 (82%)
Strand = Plus / Plus
Query: 241 gagctagtgaacttggtgacggctttggtgccctcggagacggcgtgcttggcgagctcg 300
|||||||| |||||||| || | ||||| || || ||||||||||| || ||||| ||
Sbjct: 198 gagctagtaaacttggtaaccggcttggtaccttcagagacggcgtgtttagcgagttca 257
Query: 301 ccggggaggacgaggcggacggaggtctggatctcgcgggacgtgatggtaggcttcttg 360
|||||||||||||| | || | |||||||||||||| || || ||||| |||||||||
Sbjct: 258 ccggggaggacgagtctcacagccgtctggatctcgcgagatgtaatggtcggcttcttg 317
Query: 361 ttgtacc 367
|||||||
Sbjct: 318 ttgtacc 324
Score = 44.1 bits (22), Expect = 0.036
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 394 agcttctcgaagatgtcgttgatgaa 419
||||||||||| ||||||||||||||
Sbjct: 350 agcttctcgaatatgtcgttgatgaa 375
>emb|AL758292.1| Arabidopsis thaliana T-DNA flanking sequence GK-157C10-013241,
genomic survey sequence
Length = 138
Score = 75.8 bits (38), Expect = 1e-011
Identities = 98/118 (83%)
Strand = Plus / Plus
Query: 250 aacttggtgacggctttggtgccctcggagacggcgtgcttggcgagctcgccggggagg 309
|||||||| || || ||||| || || ||||||||||| || ||||| || |||||||||
Sbjct: 19 aacttggtaaccgccttggtaccttcagagacggcgtgtttagcgagttcaccggggagg 78
Query: 310 acgaggcggacggaggtctggatctcgcgggacgtgatggtaggcttcttgttgtacc 367
||||| | || | |||||||||||||| || || ||||| ||||||||||||||||
Sbjct: 79 acgagtctcacagccgtctggatctcgcgagatgtaatggtcggcttcttgttgtacc 136
>gb|AF471815.1| Arabidopsis thaliana ecotype HODJA chromosome 5 locus MRN17.5
Length = 324
Score = 75.8 bits (38), Expect = 1e-011
Identities = 128/158 (81%)
Strand = Plus / Plus
Query: 352 ggcttcttgttgtaccgcgccagcttggccgcctccgccgccagcttctcgaagatgtcg 411
|||||||||||||||| ||| ||||| | | ||| | || |||||||| ||||| |||
Sbjct: 39 ggcttcttgttgtacctcgcaagcttcgaagactcaccagcaagcttctcaaagatatcg 98
Query: 412 ttgatgaaggagttcatgatggacatggccttggacgagatgccaatgtccgggtgcacc 471
|||||||| ||||||||| |||||| ||| ||||| || ||||| || || ||
Sbjct: 99 ttgatgaaactgttcatgattcccatggctttgcttgagattccgatgtctggatgaact 158
Query: 472 tgcttcagcaccttgaagatgtagatcttgtacgtctc 509
||||||| |||||||||||||||||||||||| |||||
Sbjct: 159 tgcttcaacaccttgaagatgtagatcttgtatgtctc 196
>gb|AF471816.1| Arabidopsis thaliana ecotype CAL-0 chromosome 5 locus MRN17.5
Length = 324
Score = 75.8 bits (38), Expect = 1e-011
Identities = 128/158 (81%)
Strand = Plus / Plus
Query: 352 ggcttcttgttgtaccgcgccagcttggccgcctccgccgccagcttctcgaagatgtcg 411
|||||||||||||||| ||| ||||| | | ||| | || |||||||| ||||| |||
Sbjct: 39 ggcttcttgttgtacctcgcaagcttcgaagactcaccagcaagcttctcaaagatatcg 98
Query: 412 ttgatgaaggagttcatgatggacatggccttggacgagatgccaatgtccgggtgcacc 471
|||||||| ||||||||| |||||| ||| ||||| || ||||| || || ||
Sbjct: 99 ttgatgaaactgttcatgattcccatggctttgcttgagattccgatgtctggatgaact 158
Query: 472 tgcttcagcaccttgaagatgtagatcttgtacgtctc 509
||||||| |||||||||||||||||||||||| |||||
Sbjct: 159 tgcttcaacaccttgaagatgtagatcttgtatgtctc 196
>gb|AF471817.1| Arabidopsis thaliana ecotype MRK-0 chromosome 5 locus MRN17.5
Length = 324
Score = 75.8 bits (38), Expect = 1e-011
Identities = 128/158 (81%)
Strand = Plus / Plus
Query: 352 ggcttcttgttgtaccgcgccagcttggccgcctccgccgccagcttctcgaagatgtcg 411
|||||||||||||||| ||| ||||| | | ||| | || |||||||| ||||| |||
Sbjct: 39 ggcttcttgttgtacctcgcaagcttcgaagactcaccagcaagcttctcaaagatatcg 98
Query: 412 ttgatgaaggagttcatgatggacatggccttggacgagatgccaatgtccgggtgcacc 471
|||||||| ||||||||| |||||| ||| ||||| || ||||| || || ||
Sbjct: 99 ttgatgaaactgttcatgattcccatggctttgcttgagattccgatgtctggatgaact 158
Query: 472 tgcttcagcaccttgaagatgtagatcttgtacgtctc 509
||||||| |||||||||||||||||||||||| |||||
Sbjct: 159 tgcttcaacaccttgaagatgtagatcttgtatgtctc 196
>gb|AF471818.1| Arabidopsis thaliana ecotype CVI-0 chromosome 5 locus MRN17.5
Length = 324
Score = 75.8 bits (38), Expect = 1e-011
Identities = 128/158 (81%)
Strand = Plus / Plus
Query: 352 ggcttcttgttgtaccgcgccagcttggccgcctccgccgccagcttctcgaagatgtcg 411
|||||||||||||||| ||| ||||| | | ||| | || |||||||| ||||| |||
Sbjct: 39 ggcttcttgttgtacctcgcaagcttcgaagactcaccagcaagcttctcaaagatatcg 98
Query: 412 ttgatgaaggagttcatgatggacatggccttggacgagatgccaatgtccgggtgcacc 471
|||||||| ||||||||| |||||| ||| ||||| || ||||| || || ||
Sbjct: 99 ttgatgaaactgttcatgattcccatggctttgcttgagattccgatgtctggatgaact 158
Query: 472 tgcttcagcaccttgaagatgtagatcttgtacgtctc 509
||||||| |||||||||||||||||||||||| |||||
Sbjct: 159 tgcttcaacaccttgaagatgtagatcttgtatgtctc 196
>gb|AF471819.1| Arabidopsis thaliana ecotype PA-1 chromosome 5 locus MRN17.5
Length = 324
Score = 75.8 bits (38), Expect = 1e-011
Identities = 128/158 (81%)
Strand = Plus / Plus
Query: 352 ggcttcttgttgtaccgcgccagcttggccgcctccgccgccagcttctcgaagatgtcg 411
|||||||||||||||| ||| ||||| | | ||| | || |||||||| ||||| |||
Sbjct: 39 ggcttcttgttgtacctcgcaagcttcgaagactcaccagcaagcttctcaaagatatcg 98
Query: 412 ttgatgaaggagttcatgatggacatggccttggacgagatgccaatgtccgggtgcacc 471
|||||||| ||||||||| |||||| ||| ||||| || ||||| || || ||
Sbjct: 99 ttgatgaaactgttcatgattcccatggctttgcttgagattccgatgtctggatgaact 158
Query: 472 tgcttcagcaccttgaagatgtagatcttgtacgtctc 509
||||||| |||||||||||||||||||||||| |||||
Sbjct: 159 tgcttcaacaccttgaagatgtagatcttgtatgtctc 196
>gb|AF471820.1| Arabidopsis thaliana ecotype CNT-1 chromosome 5 locus MRN17.5
Length = 324
Score = 75.8 bits (38), Expect = 1e-011
Identities = 128/158 (81%)
Strand = Plus / Plus
Query: 352 ggcttcttgttgtaccgcgccagcttggccgcctccgccgccagcttctcgaagatgtcg 411
|||||||||||||||| ||| ||||| | | ||| | || |||||||| ||||| |||
Sbjct: 39 ggcttcttgttgtacctcgcaagcttcgaagactcaccagcaagcttctcaaagatatcg 98
Query: 412 ttgatgaaggagttcatgatggacatggccttggacgagatgccaatgtccgggtgcacc 471
|||||||| ||||||||| |||||| ||| ||||| || ||||| || || ||
Sbjct: 99 ttgatgaaactgttcatgattcccatggctttgcttgagattccgatgtctggatgaact 158
Query: 472 tgcttcagcaccttgaagatgtagatcttgtacgtctc 509
||||||| |||||||||||||||||||||||| |||||
Sbjct: 159 tgcttcaacaccttgaagatgtagatcttgtatgtctc 196
>gb|AF471821.1| Arabidopsis thaliana ecotype POG-0 chromosome 5 locus MRN17.5
Length = 324
Score = 75.8 bits (38), Expect = 1e-011
Identities = 128/158 (81%)
Strand = Plus / Plus
Query: 352 ggcttcttgttgtaccgcgccagcttggccgcctccgccgccagcttctcgaagatgtcg 411
|||||||||||||||| ||| ||||| | | ||| | || |||||||| ||||| |||
Sbjct: 39 ggcttcttgttgtacctcgcaagcttcgaagactcaccagcaagcttctcaaagatatcg 98
Query: 412 ttgatgaaggagttcatgatggacatggccttggacgagatgccaatgtccgggtgcacc 471
|||||||| ||||||||| |||||| ||| ||||| || ||||| || || ||
Sbjct: 99 ttgatgaaactgttcatgattcccatggctttgcttgagattccgatgtctggatgaact 158
Query: 472 tgcttcagcaccttgaagatgtagatcttgtacgtctc 509
||||||| |||||||||||||||||||||||| |||||
Sbjct: 159 tgcttcaacaccttgaagatgtagatcttgtatgtctc 196
>gb|AF471829.1| Arabidopsis thaliana ecotype KAS-1 chromosome 5 locus MRN17.5
Length = 324
Score = 75.8 bits (38), Expect = 1e-011
Identities = 128/158 (81%)
Strand = Plus / Plus
Query: 352 ggcttcttgttgtaccgcgccagcttggccgcctccgccgccagcttctcgaagatgtcg 411
|||||||||||||||| ||| ||||| | | ||| | || |||||||| ||||| |||
Sbjct: 39 ggcttcttgttgtacctcgcaagcttcgaagactcaccagcaagcttctcaaagatatcg 98
Query: 412 ttgatgaaggagttcatgatggacatggccttggacgagatgccaatgtccgggtgcacc 471
|||||||| ||||||||| |||||| ||| ||||| || ||||| || || ||
Sbjct: 99 ttgatgaaactgttcatgattcccatggctttgcttgagattccgatgtctggatgaact 158
Query: 472 tgcttcagcaccttgaagatgtagatcttgtacgtctc 509
||||||| |||||||||||||||||||||||| |||||
Sbjct: 159 tgcttcaacaccttgaagatgtagatcttgtatgtctc 196
>gb|AF471830.1| Arabidopsis thaliana ecotype TAC chromosome 5 locus MRN17.5
Length = 324
Score = 75.8 bits (38), Expect = 1e-011
Identities = 128/158 (81%)
Strand = Plus / Plus
Query: 352 ggcttcttgttgtaccgcgccagcttggccgcctccgccgccagcttctcgaagatgtcg 411
|||||||||||||||| ||| ||||| | | ||| | || |||||||| ||||| |||
Sbjct: 39 ggcttcttgttgtacctcgcaagcttcgaagactcaccagcaagcttctcaaagatatcg 98
Query: 412 ttgatgaaggagttcatgatggacatggccttggacgagatgccaatgtccgggtgcacc 471
|||||||| ||||||||| |||||| ||| ||||| || ||||| || || ||
Sbjct: 99 ttgatgaaactgttcatgattcccatggctttgcttgagattccgatgtctggatgaact 158
Query: 472 tgcttcagcaccttgaagatgtagatcttgtacgtctc 509
||||||| |||||||||||||||||||||||| |||||
Sbjct: 159 tgcttcaacaccttgaagatgtagatcttgtatgtctc 196
>gb|AF471831.1| Arabidopsis thaliana ecotype KONDARA chromosome 5 locus MRN17.5
Length = 324
Score = 75.8 bits (38), Expect = 1e-011
Identities = 128/158 (81%)
Strand = Plus / Plus
Query: 352 ggcttcttgttgtaccgcgccagcttggccgcctccgccgccagcttctcgaagatgtcg 411
|||||||||||||||| ||| ||||| | | ||| | || |||||||| ||||| |||
Sbjct: 39 ggcttcttgttgtacctcgcaagcttcgaagactcaccagcaagcttctcaaagatatcg 98
Query: 412 ttgatgaaggagttcatgatggacatggccttggacgagatgccaatgtccgggtgcacc 471
|||||||| ||||||||| |||||| ||| ||||| || ||||| || || ||
Sbjct: 99 ttgatgaaactgttcatgattcccatggctttgcttgagattccgatgtctggatgaact 158
Query: 472 tgcttcagcaccttgaagatgtagatcttgtacgtctc 509
||||||| |||||||||||||||||||||||| |||||
Sbjct: 159 tgcttcaacaccttgaagatgtagatcttgtatgtctc 196
>gb|AF471832.1| Arabidopsis thaliana ecotype ITA-0 chromosome 5 locus MRN17.5
Length = 324
Score = 75.8 bits (38), Expect = 1e-011
Identities = 128/158 (81%)
Strand = Plus / Plus
Query: 352 ggcttcttgttgtaccgcgccagcttggccgcctccgccgccagcttctcgaagatgtcg 411
|||||||||||||||| ||| ||||| | | ||| | || |||||||| ||||| |||
Sbjct: 39 ggcttcttgttgtacctcgcaagcttcgaagactcaccagcaagcttctcaaagatatcg 98
Query: 412 ttgatgaaggagttcatgatggacatggccttggacgagatgccaatgtccgggtgcacc 471
|||||||| ||||||||| |||||| ||| ||||| || ||||| || || ||
Sbjct: 99 ttgatgaaactgttcatgattcccatggctttgcttgagattccgatgtctggatgaact 158
Query: 472 tgcttcagcaccttgaagatgtagatcttgtacgtctc 509
||||||| |||||||||||||||||||||||| |||||
Sbjct: 159 tgcttcaacaccttgaagatgtagatcttgtatgtctc 196
>gb|C99813.1|C99813 C99813 YAC clone CIC8B11 region-specific cDNA Arabidopsis thaliana
cDNA clone 8B11-38, mRNA sequence
Length = 456
Score = 71.9 bits (36), Expect = 2e-010
Identities = 96/116 (82%)
Strand = Plus / Minus
Query: 394 agcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggacgagatg 453
|||||||| ||||| ||||||||||| ||||||||| |||||| ||| |||||
Sbjct: 316 agcttctcaaagatatcgttgatgaaactgttcatgattcccatggctttgcttgagatt 257
Query: 454 ccaatgtccgggtgcacctgcttcagcaccttgaagatgtagatcttgtacgtctc 509
|| ||||| || || || ||||||| |||||||||||||||||||||||| |||||
Sbjct: 256 ccgatgtctggatgaacttgcttcaacaccttgaagatgtagatcttgtatgtctc 201
>gb|CK120461.1|CK120461 218k04.p1 AtM1 Arabidopsis thaliana cDNA clone MPMGp2011K04218
5-PRIME, mRNA sequence
Length = 437
Score = 71.9 bits (36), Expect = 2e-010
Identities = 96/116 (82%)
Strand = Plus / Minus
Query: 394 agcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggacgagatg 453
|||||||| ||||| ||||||||||| ||||||||| |||||| ||| |||||
Sbjct: 133 agcttctcaaagatatcgttgatgaaactgttcatgattcccatggctttgcttgagatt 74
Query: 454 ccaatgtccgggtgcacctgcttcagcaccttgaagatgtagatcttgtacgtctc 509
|| ||||| || || || ||||||| |||||||||||||||||||||||| |||||
Sbjct: 73 ccgatgtctggatgaacttgcttcaacaccttgaagatgtagatcttgtatgtctc 18
>gb|CK120549.1|CK120549 207d05.p1 AtM1 Arabidopsis thaliana cDNA clone MPMGp2011D05207
5-PRIME, mRNA sequence
Length = 607
Score = 71.9 bits (36), Expect = 2e-010
Identities = 96/116 (82%)
Strand = Plus / Minus
Query: 394 agcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggacgagatg 453
|||||||| ||||| ||||||||||| ||||||||| |||||| ||| |||||
Sbjct: 312 agcttctcaaagatatcgttgatgaaactgttcatgattcccatggctttgcttgagatt 253
Query: 454 ccaatgtccgggtgcacctgcttcagcaccttgaagatgtagatcttgtacgtctc 509
|| ||||| || || || ||||||| |||||||||||||||||||||||| |||||
Sbjct: 252 ccgatgtctggatgaacttgcttcaacaccttgaagatgtagatcttgtatgtctc 197
>gb|AF471822.1| Arabidopsis thaliana ecotype CAN-0 chromosome 5 locus MRN17.5
Length = 324
Score = 71.9 bits (36), Expect = 2e-010
Identities = 96/116 (82%)
Strand = Plus / Plus
Query: 394 agcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggacgagatg 453
|||||||| ||||| ||||||||||| ||||||||| |||||| ||| |||||
Sbjct: 81 agcttctcaaagatatcgttgatgaaactgttcatgattcccatggctttgcttgagatt 140
Query: 454 ccaatgtccgggtgcacctgcttcagcaccttgaagatgtagatcttgtacgtctc 509
|| ||||| || || || ||||||| |||||||||||||||||||||||| |||||
Sbjct: 141 ccgatgtctggatgaacttgcttcaacaccttgaagatgtagatcttgtatgtctc 196
>gb|AF471823.1| Arabidopsis thaliana ecotype DIJON_G chromosome 5 locus MRN17.5
Length = 324
Score = 71.9 bits (36), Expect = 2e-010
Identities = 96/116 (82%)
Strand = Plus / Plus
Query: 394 agcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggacgagatg 453
|||||||| ||||| ||||||||||| ||||||||| |||||| ||| |||||
Sbjct: 81 agcttctcaaagatatcgttgatgaaactgttcatgattcccatggctttgcttgagatt 140
Query: 454 ccaatgtccgggtgcacctgcttcagcaccttgaagatgtagatcttgtacgtctc 509
|| ||||| || || || ||||||| |||||||||||||||||||||||| |||||
Sbjct: 141 ccgatgtctggatgaacttgcttcaacaccttgaagatgtagatcttgtatgtctc 196
>gb|AF471824.1| Arabidopsis thaliana ecotype PETERGOF chromosome 5 locus MRN17.5
Length = 324
Score = 71.9 bits (36), Expect = 2e-010
Identities = 96/116 (82%)
Strand = Plus / Plus
Query: 394 agcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggacgagatg 453
|||||||| ||||| ||||||||||| ||||||||| |||||| ||| |||||
Sbjct: 81 agcttctcaaagatatcgttgatgaaactgttcatgattcccatggctttgcttgagatt 140
Query: 454 ccaatgtccgggtgcacctgcttcagcaccttgaagatgtagatcttgtacgtctc 509
|| ||||| || || || ||||||| |||||||||||||||||||||||| |||||
Sbjct: 141 ccgatgtctggatgaacttgcttcaacaccttgaagatgtagatcttgtatgtctc 196
>gb|AF471825.1| Arabidopsis thaliana ecotype LIP-0 chromosome 5 locus MRN17.5
Length = 324
Score = 71.9 bits (36), Expect = 2e-010
Identities = 96/116 (82%)
Strand = Plus / Plus
Query: 394 agcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggacgagatg 453
|||||||| ||||| ||||||||||| ||||||||| |||||| ||| |||||
Sbjct: 81 agcttctcaaagatatcgttgatgaaactgttcatgattcccatggctttgcttgagatt 140
Query: 454 ccaatgtccgggtgcacctgcttcagcaccttgaagatgtagatcttgtacgtctc 509
|| ||||| || || || ||||||| |||||||||||||||||||||||| |||||
Sbjct: 141 ccgatgtctggatgaacttgcttcaacaccttgaagatgtagatcttgtatgtctc 196
>gb|AF471826.1| Arabidopsis thaliana ecotype LER-0 chromosome 5 locus MRN17.5
Length = 324
Score = 71.9 bits (36), Expect = 2e-010
Identities = 96/116 (82%)
Strand = Plus / Plus
Query: 394 agcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggacgagatg 453
|||||||| ||||| ||||||||||| ||||||||| |||||| ||| |||||
Sbjct: 81 agcttctcaaagatatcgttgatgaaactgttcatgattcccatggctttgcttgagatt 140
Query: 454 ccaatgtccgggtgcacctgcttcagcaccttgaagatgtagatcttgtacgtctc 509
|| ||||| || || || ||||||| |||||||||||||||||||||||| |||||
Sbjct: 141 ccgatgtctggatgaacttgcttcaacaccttgaagatgtagatcttgtatgtctc 196
>gb|AF471827.1| Arabidopsis thaliana ecotype EI-2 chromosome 5 locus MRN17.5
Length = 324
Score = 71.9 bits (36), Expect = 2e-010
Identities = 96/116 (82%)
Strand = Plus / Plus
Query: 394 agcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggacgagatg 453
|||||||| ||||| ||||||||||| ||||||||| |||||| ||| |||||
Sbjct: 81 agcttctcaaagatatcgttgatgaaactgttcatgattcccatggctttgcttgagatt 140
Query: 454 ccaatgtccgggtgcacctgcttcagcaccttgaagatgtagatcttgtacgtctc 509
|| ||||| || || || ||||||| |||||||||||||||||||||||| |||||
Sbjct: 141 ccgatgtctggatgaacttgcttcaacaccttgaagatgtagatcttgtatgtctc 196
>gb|AF471828.1| Arabidopsis thaliana ecotype SORBO chromosome 5 locus MRN17.5
Length = 324
Score = 71.9 bits (36), Expect = 2e-010
Identities = 96/116 (82%)
Strand = Plus / Plus
Query: 394 agcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggacgagatg 453
|||||||| ||||| ||||||||||| ||||||||| |||||| ||| |||||
Sbjct: 81 agcttctcaaagatatcgttgatgaaactgttcatgattcccatggctttgcttgagatt 140
Query: 454 ccaatgtccgggtgcacctgcttcagcaccttgaagatgtagatcttgtacgtctc 509
|| ||||| || || || ||||||| |||||||||||||||||||||||| |||||
Sbjct: 141 ccgatgtctggatgaacttgcttcaacaccttgaagatgtagatcttgtatgtctc 196
>gb|CB185859.1|CB185859 EST01050 Arabidopsis virulent Pseudomonas syringae subtracted
library Arabidopsis thaliana cDNA clone DC3-F5 similar
to histone H2B, mRNA sequence
Length = 329
Score = 69.9 bits (35), Expect = 6e-010
Identities = 35/35 (100%)
Strand = Plus / Minus
Query: 469 acctgcttcagcaccttgaagatgtagatcttgta 503
|||||||||||||||||||||||||||||||||||
Sbjct: 224 acctgcttcagcaccttgaagatgtagatcttgta 190
>gb|U18970.1|ATU18970 Arabidopsis thaliana phosphoribosylanthranilate isomerase (PAI1)
gene, complete cds
Length = 3785
Score = 69.9 bits (35), Expect = 6e-010
Identities = 35/35 (100%)
Strand = Plus / Plus
Query: 469 acctgcttcagcaccttgaagatgtagatcttgta 503
|||||||||||||||||||||||||||||||||||
Sbjct: 14 acctgcttcagcaccttgaagatgtagatcttgta 48
>gb|AY357734.1| Arabidopsis thaliana phosphoribosylanthranilate isomerase (PAI1)
gene, PAI1-invpai1 allele, complete cds
Length = 6309
Score = 69.9 bits (35), Expect = 6e-010
Identities = 77/91 (84%)
Strand = Plus / Plus
Query: 277 gagacggcgtgcttggcgagctcgccggggaggacgaggcggacggaggtctggatctcg 336
||||||||||| || ||||| || |||||||||||||| | || | ||||||||||||
Sbjct: 11 gagacggcgtgtttagcgagttcaccggggaggacgagtctcacagccgtctggatctcg 70
Query: 337 cgggacgtgatggtaggcttcttgttgtacc 367
|| || || ||||| ||||||||||||||||
Sbjct: 71 cgagatgtaatggtcggcttcttgttgtacc 101
Score = 61.9 bits (31), Expect = 2e-007
Identities = 34/35 (97%)
Strand = Plus / Plus
Query: 469 acctgcttcagcaccttgaagatgtagatcttgta 503
||||||||||| |||||||||||||||||||||||
Sbjct: 203 acctgcttcagaaccttgaagatgtagatcttgta 237
>gb|AF471806.1| Arabidopsis thaliana ecotype BL-1 chromosome 5 locus MRN17.5
Length = 324
Score = 67.9 bits (34), Expect = 2e-009
Identities = 127/158 (80%)
Strand = Plus / Plus
Query: 352 ggcttcttgttgtaccgcgccagcttggccgcctccgccgccagcttctcgaagatgtcg 411
|||||||||||||||| ||| ||||| | | ||| | || |||||||| ||||| |||
Sbjct: 39 ggcttcttgttgtacctcgcaagcttcgaagactcaccagcaagcttctcaaagatatcg 98
Query: 412 ttgatgaaggagttcatgatggacatggccttggacgagatgccaatgtccgggtgcacc 471
|||||||| ||||||||| |||||| ||| ||||| || ||||| || || ||
Sbjct: 99 ttgatgaaactgttcatgattcccatggctttgcttgagattccgatgtctggatgaact 158
Query: 472 tgcttcagcaccttgaagatgtagatcttgtacgtctc 509
|| |||| |||||||||||||||||||||||| |||||
Sbjct: 159 tgtttcaacaccttgaagatgtagatcttgtatgtctc 196
>gb|AF471807.1| Arabidopsis thaliana ecotype NO-0 chromosome 5 locus MRN17.5
Length = 324
Score = 67.9 bits (34), Expect = 2e-009
Identities = 127/158 (80%)
Strand = Plus / Plus
Query: 352 ggcttcttgttgtaccgcgccagcttggccgcctccgccgccagcttctcgaagatgtcg 411
|||||||||||||||| ||| ||||| | | ||| | || |||||||| ||||| |||
Sbjct: 39 ggcttcttgttgtacctcgcaagcttcgaagactcaccagcaagcttctcaaagatatcg 98
Query: 412 ttgatgaaggagttcatgatggacatggccttggacgagatgccaatgtccgggtgcacc 471
|||||||| ||||||||| |||||| ||| ||||| || ||||| || || ||
Sbjct: 99 ttgatgaaactgttcatgattcccatggctttgcttgagattccgatgtctggatgaact 158
Query: 472 tgcttcagcaccttgaagatgtagatcttgtacgtctc 509
|| |||| |||||||||||||||||||||||| |||||
Sbjct: 159 tgtttcaacaccttgaagatgtagatcttgtatgtctc 196
>gb|AF471808.1| Arabidopsis thaliana ecotype TSU-1 chromosome 5 locus MRN17.5
Length = 324
Score = 67.9 bits (34), Expect = 2e-009
Identities = 127/158 (80%)
Strand = Plus / Plus
Query: 352 ggcttcttgttgtaccgcgccagcttggccgcctccgccgccagcttctcgaagatgtcg 411
|||||||||||||||| ||| ||||| | | ||| | || |||||||| ||||| |||
Sbjct: 39 ggcttcttgttgtacctcgcaagcttcgaagactcaccagcaagcttctcaaagatatcg 98
Query: 412 ttgatgaaggagttcatgatggacatggccttggacgagatgccaatgtccgggtgcacc 471
|||||||| ||||||||| |||||| ||| ||||| || ||||| || || ||
Sbjct: 99 ttgatgaaactgttcatgattcccatggctttgcttgagattccgatgtctggatgaact 158
Query: 472 tgcttcagcaccttgaagatgtagatcttgtacgtctc 509
|| |||| |||||||||||||||||||||||| |||||
Sbjct: 159 tgtttcaacaccttgaagatgtagatcttgtatgtctc 196
>gb|AF471809.1| Arabidopsis thaliana ecotype YO-0 chromosome 5 locus MRN17.5
Length = 324
Score = 67.9 bits (34), Expect = 2e-009
Identities = 127/158 (80%)
Strand = Plus / Plus
Query: 352 ggcttcttgttgtaccgcgccagcttggccgcctccgccgccagcttctcgaagatgtcg 411
|||||||||||||||| ||| ||||| | | ||| | || |||||||| ||||| |||
Sbjct: 39 ggcttcttgttgtacctcgcaagcttcgaagactcaccagcaagcttctcaaagatatcg 98
Query: 412 ttgatgaaggagttcatgatggacatggccttggacgagatgccaatgtccgggtgcacc 471
|||||||| ||||||||| |||||| ||| ||||| || ||||| || || ||
Sbjct: 99 ttgatgaaactgttcatgattcccatggctttgcttgagattccgatgtctggatgaact 158
Query: 472 tgcttcagcaccttgaagatgtagatcttgtacgtctc 509
|| |||| |||||||||||||||||||||||| |||||
Sbjct: 159 tgtttcaacaccttgaagatgtagatcttgtatgtctc 196
>gb|AF471810.1| Arabidopsis thaliana ecotype WL-0 chromosome 5 locus MRN17.5
Length = 324
Score = 67.9 bits (34), Expect = 2e-009
Identities = 127/158 (80%)
Strand = Plus / Plus
Query: 352 ggcttcttgttgtaccgcgccagcttggccgcctccgccgccagcttctcgaagatgtcg 411
|||||||||||||||| ||| ||||| | | ||| | || |||||||| ||||| |||
Sbjct: 39 ggcttcttgttgtacctcgcaagcttcgaagactcaccagcaagcttctcaaagatatcg 98
Query: 412 ttgatgaaggagttcatgatggacatggccttggacgagatgccaatgtccgggtgcacc 471
|||||||| ||||||||| |||||| ||| ||||| || ||||| || || ||
Sbjct: 99 ttgatgaaactgttcatgattcccatggctttgcttgagattccgatgtctggatgaact 158
Query: 472 tgcttcagcaccttgaagatgtagatcttgtacgtctc 509
|| |||| |||||||||||||||||||||||| |||||
Sbjct: 159 tgtttcaacaccttgaagatgtagatcttgtatgtctc 196
>gb|AF471811.1| Arabidopsis thaliana ecotype SEI-0 chromosome 5 locus MRN17.5
Length = 324
Score = 67.9 bits (34), Expect = 2e-009
Identities = 127/158 (80%)
Strand = Plus / Plus
Query: 352 ggcttcttgttgtaccgcgccagcttggccgcctccgccgccagcttctcgaagatgtcg 411
|||||||||||||||| ||| ||||| | | ||| | || |||||||| ||||| |||
Sbjct: 39 ggcttcttgttgtacctcgcaagcttcgaagactcaccagcaagcttctcaaagatatcg 98
Query: 412 ttgatgaaggagttcatgatggacatggccttggacgagatgccaatgtccgggtgcacc 471
|||||||| ||||||||| |||||| ||| ||||| || ||||| || || ||
Sbjct: 99 ttgatgaaactgttcatgattcccatggctttgcttgagattccgatgtctggatgaact 158
Query: 472 tgcttcagcaccttgaagatgtagatcttgtacgtctc 509
|| |||| |||||||||||||||||||||||| |||||
Sbjct: 159 tgtttcaacaccttgaagatgtagatcttgtatgtctc 196
>gb|AF471812.1| Arabidopsis thaliana ecotype PI-0 chromosome 5 locus MRN17.5
Length = 324
Score = 67.9 bits (34), Expect = 2e-009
Identities = 127/158 (80%)
Strand = Plus / Plus
Query: 352 ggcttcttgttgtaccgcgccagcttggccgcctccgccgccagcttctcgaagatgtcg 411
|||||||||||||||| ||| ||||| | | ||| | || |||||||| ||||| |||
Sbjct: 39 ggcttcttgttgtacctcgcaagcttcgaagactcaccagcaagcttctcaaagatatcg 98
Query: 412 ttgatgaaggagttcatgatggacatggccttggacgagatgccaatgtccgggtgcacc 471
|||||||| ||||||||| |||||| ||| ||||| || ||||| || || ||
Sbjct: 99 ttgatgaaactgttcatgattcccatggctttgcttgagattccgatgtctggatgaact 158
Query: 472 tgcttcagcaccttgaagatgtagatcttgtacgtctc 509
|| |||| |||||||||||||||||||||||| |||||
Sbjct: 159 tgtttcaacaccttgaagatgtagatcttgtatgtctc 196
>gb|AF471813.1| Arabidopsis thaliana ecotype KA-0 chromosome 5 locus MRN17.5
Length = 324
Score = 67.9 bits (34), Expect = 2e-009
Identities = 127/158 (80%)
Strand = Plus / Plus
Query: 352 ggcttcttgttgtaccgcgccagcttggccgcctccgccgccagcttctcgaagatgtcg 411
|||||||||||||||| ||| ||||| | | ||| | || |||||||| ||||| |||
Sbjct: 39 ggcttcttgttgtacctcgcaagcttcgaagactcaccagcaagcttctcaaagatatcg 98
Query: 412 ttgatgaaggagttcatgatggacatggccttggacgagatgccaatgtccgggtgcacc 471
|||||||| ||||||||| |||||| ||| ||||| || ||||| || || ||
Sbjct: 99 ttgatgaaactgttcatgattcccatggctttgcttgagattccgatgtctggatgaact 158
Query: 472 tgcttcagcaccttgaagatgtagatcttgtacgtctc 509
|| |||| |||||||||||||||||||||||| |||||
Sbjct: 159 tgtttcaacaccttgaagatgtagatcttgtatgtctc 196
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 356,736
Number of Sequences: 1013581
Number of extensions: 356736
Number of successful extensions: 29360
Number of sequences better than 0.5: 346
Number of HSP's better than 0.5 without gapping: 331
Number of HSP's successfully gapped in prelim test: 22
Number of HSP's that attempted gapping in prelim test: 26638
Number of HSP's gapped (non-prelim): 2692
length of query: 777
length of database: 908,940,872
effective HSP length: 20
effective length of query: 757
effective length of database: 888,669,252
effective search space: 672722623764
effective search space used: 672722623764
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)