BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 131537.2.12
(694 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AF471815.1| Arabidopsis thaliana ecotype HODJA chromosom... 100 6e-019
gb|AF471816.1| Arabidopsis thaliana ecotype CAL-0 chromosom... 100 6e-019
gb|AF471817.1| Arabidopsis thaliana ecotype MRK-0 chromosom... 100 6e-019
gb|AF471818.1| Arabidopsis thaliana ecotype CVI-0 chromosom... 100 6e-019
gb|AF471819.1| Arabidopsis thaliana ecotype PA-1 chromosome... 100 6e-019
gb|AF471820.1| Arabidopsis thaliana ecotype CNT-1 chromosom... 100 6e-019
gb|AF471821.1| Arabidopsis thaliana ecotype POG-0 chromosom... 100 6e-019
gb|AF471829.1| Arabidopsis thaliana ecotype KAS-1 chromosom... 100 6e-019
gb|AF471830.1| Arabidopsis thaliana ecotype TAC chromosome ... 100 6e-019
gb|AF471831.1| Arabidopsis thaliana ecotype KONDARA chromos... 100 6e-019
gb|AF471832.1| Arabidopsis thaliana ecotype ITA-0 chromosom... 100 6e-019
gb|AF471833.1| Arabidopsis thaliana ecotype PLA-0 chromosom... 100 6e-019
gb|AF471834.1| Arabidopsis thaliana ecotype BLA-10 chromoso... 100 6e-019
gb|C99813.1|C99813 C99813 YAC clone CIC8B11 region-specific... 92 2e-016
gb|CK120461.1|CK120461 218k04.p1 AtM1 Arabidopsis thaliana ... 92 2e-016
gb|CK120549.1|CK120549 207d05.p1 AtM1 Arabidopsis thaliana ... 92 2e-016
gb|AF471806.1| Arabidopsis thaliana ecotype BL-1 chromosome... 92 2e-016
gb|AF471807.1| Arabidopsis thaliana ecotype NO-0 chromosome... 92 2e-016
gb|AF471808.1| Arabidopsis thaliana ecotype TSU-1 chromosom... 92 2e-016
gb|AF471809.1| Arabidopsis thaliana ecotype YO-0 chromosome... 92 2e-016
gb|AF471810.1| Arabidopsis thaliana ecotype WL-0 chromosome... 92 2e-016
gb|AF471811.1| Arabidopsis thaliana ecotype SEI-0 chromosom... 92 2e-016
gb|AF471812.1| Arabidopsis thaliana ecotype PI-0 chromosome... 92 2e-016
gb|AF471813.1| Arabidopsis thaliana ecotype KA-0 chromosome... 92 2e-016
gb|AF471814.1| Arabidopsis thaliana ecotype SU-0 chromosome... 92 2e-016
gb|AF471822.1| Arabidopsis thaliana ecotype CAN-0 chromosom... 92 2e-016
gb|AF471823.1| Arabidopsis thaliana ecotype DIJON_G chromos... 92 2e-016
gb|AF471824.1| Arabidopsis thaliana ecotype PETERGOF chromo... 92 2e-016
gb|AF471825.1| Arabidopsis thaliana ecotype LIP-0 chromosom... 92 2e-016
gb|AF471826.1| Arabidopsis thaliana ecotype LER-0 chromosom... 92 2e-016
gb|AF471827.1| Arabidopsis thaliana ecotype EI-2 chromosome... 92 2e-016
gb|AF471828.1| Arabidopsis thaliana ecotype SORBO chromosom... 92 2e-016
gb|BP562087.2|BP562087 BP562087 RAFL9 Arabidopsis thaliana ... 86 9e-015
gb|AI999101.1|AI999101 701554459 A. thaliana, Columbia Col-... 84 4e-014
gb|AU235967.1|AU235967 AU235967 RAFL14 Arabidopsis thaliana... 84 4e-014
gb|BU636121.1|BU636121 045G06 Infected Arabidopsis Leaf Ara... 84 4e-014
gb|AV521723.1|AV521723 AV521723 Arabidopsis thaliana aboveg... 84 4e-014
gb|AV557883.1|AV557883 AV557883 Arabidopsis thaliana green ... 84 4e-014
gb|AV559679.1|AV559679 AV559679 Arabidopsis thaliana green ... 84 4e-014
gb|CK117656.1|CK117656 215c08.p1 AtM1 Arabidopsis thaliana ... 84 4e-014
gb|CK117669.1|CK117669 214j19.p1 AtM1 Arabidopsis thaliana ... 84 4e-014
gb|CK117801.1|CK117801 204g20.p1 AtM1 Arabidopsis thaliana ... 84 4e-014
gb|CK118019.1|CK118019 207g23.p1 AtM1 Arabidopsis thaliana ... 84 4e-014
gb|CK118307.1|CK118307 217h22.p1 AtM1 Arabidopsis thaliana ... 84 4e-014
gb|CK118414.1|CK118414 217b16.p1 AtM1 Arabidopsis thaliana ... 84 4e-014
gb|CK118523.1|CK118523 216n23.p1 AtM1 Arabidopsis thaliana ... 84 4e-014
gb|CK119044.1|CK119044 214l11.p1 AtM1 Arabidopsis thaliana ... 84 4e-014
gb|CK119663.1|CK119663 211c17.p1 AtM1 Arabidopsis thaliana ... 84 4e-014
gb|CK119903.1|CK119903 210g05.p1 AtM1 Arabidopsis thaliana ... 84 4e-014
gb|CK120137.1|CK120137 208l20.p1 AtM1 Arabidopsis thaliana ... 84 4e-014
gb|CK120144.1|CK120144 208l13.p1 AtM1 Arabidopsis thaliana ... 84 4e-014
gb|CK121154.1|CK121154 204f20.p1 AtM1 Arabidopsis thaliana ... 84 4e-014
gb|CK121335.1|CK121335 203j20.p1 AtM1 Arabidopsis thaliana ... 84 4e-014
gb|CK121656.1|CK121656 202f07.p1 AtM1 Arabidopsis thaliana ... 84 4e-014
gb|BP591446.1|BP591446 BP591446 RAFL15 Arabidopsis thaliana... 84 4e-014
gb|BP591469.1|BP591469 BP591469 RAFL15 Arabidopsis thaliana... 84 4e-014
gb|BP597674.1|BP597674 BP597674 RAFL15 Arabidopsis thaliana... 84 4e-014
gb|CB252338.1|CB252338 29-E010007-019-001-I04-T7R MPIZ-ADIS... 84 4e-014
gb|CB253051.1|CB253051 10-E018437-019-009-C03-T7R MPIZ-ADIS... 84 4e-014
gb|CB253302.1|CB253302 05-E010699-019-002-J02-T7R MPIZ-ADIS... 84 4e-014
gb|CB253829.1|CB253829 87-E012997-019-004-M21-T7R MPIZ-ADIS... 84 4e-014
gb|CB255379.1|CB255379 43-E012994-019-004-F11-SP6r MPIZ-ADI... 84 4e-014
gb|CB255382.1|CB255382 43-E012999-019-004-F11-T7R MPIZ-ADIS... 84 4e-014
gb|CB255418.1|CB255418 42-E010007-019-001-C06-T7R MPIZ-ADIS... 84 4e-014
gb|BP802897.1|BP802897 BP802897 RAFL14 Arabidopsis thaliana... 84 4e-014
gb|BP814381.1|BP814381 BP814381 RAFL19 Arabidopsis thaliana... 84 4e-014
gb|AY057643.1| Arabidopsis thaliana AT5g59910/mmn10_130 mRN... 84 4e-014
gb|AF471835.1| Arabidopsis thaliana ecotype DI-1 chromosome... 84 4e-014
gb|AF471836.1| Arabidopsis thaliana ecotype LM-2 chromosome... 84 4e-014
gb|AF471837.1| Arabidopsis thaliana ecotype MT-0 chromosome... 84 4e-014
gb|AF471838.1| Arabidopsis thaliana ecotype COL-0 chromosom... 84 4e-014
gb|AF471839.1| Arabidopsis thaliana ecotype AG-0 chromosome... 84 4e-014
gb|AF471840.1| Arabidopsis thaliana ecotype GY-0 chromosome... 84 4e-014
gb|AF471841.1| Arabidopsis thaliana ecotype AA-0 chromosome... 84 4e-014
gb|AF471842.1| Arabidopsis thaliana ecotype DI-0 chromosome... 84 4e-014
gb|AF471843.1| Arabidopsis thaliana ecotype MA-0 chromosome... 84 4e-014
gb|AF471844.1| Arabidopsis thaliana ecotype KIL-0 chromosom... 84 4e-014
emb|AX506052.1| Sequence 747 from Patent WO0216655 84 4e-014
emb|BX833190.1|CNS0A0CG Arabidopsis thaliana Full-length cD... 84 4e-014
dbj|AB005243.1| Arabidopsis thaliana genomic DNA, chromosom... 84 4e-014
dbj|AB015475.1| Arabidopsis thaliana genomic DNA, chromosom... 84 4e-014
emb|CQ804484.1| Sequence 895 from Patent WO2004035798 84 4e-014
emb|CQ804822.1| Sequence 1233 from Patent WO2004035798 84 4e-014
dbj|BA000015.5| Arabidopsis thaliana DNA, chromosome 5, com... 84 4e-014
gb|BT020297.1| Arabidopsis thaliana At5g59910 gene, complet... 84 4e-014
emb|Y07745.1|ATHISH2BL A.thaliana mRNA histone H2B like pro... 84 4e-014
ref|NM_122194.2| Arabidopsis thaliana DNA binding AT5G22880... 84 4e-014
ref|NM_125384.2| Arabidopsis thaliana DNA binding AT5G59910... 84 4e-014
ref|NC_003076.4| Arabidopsis thaliana chromosome 5, complet... 84 4e-014
gb|AV557321.1|AV557321 AV557321 Arabidopsis thaliana green ... 82 1e-013
gb|CK118206.1|CK118206 217m08.p1 AtM1 Arabidopsis thaliana ... 82 1e-013
gb|CB255588.1|CB255588 37-E015391-019-006-I09-T7R MPIZ-ADIS... 82 1e-013
gb|AF130878.1|AF130878 Arabidopsis thaliana phosphoribosyla... 82 1e-013
gb|AE005172.1| Arabidopsis thaliana chromosome 1, top arm c... 82 1e-013
gb|AY070760.1| Arabidopsis thaliana At1g07790/F24B9_10 mRNA... 82 1e-013
gb|AY133638.1| Arabidopsis thaliana At1g07790/F24B9_10 mRNA... 82 1e-013
gb|AF332446.1| Arabidopsis thaliana clone C00142 (p) putati... 82 1e-013
gb|AC007583.2|F24B9 Arabidopsis thaliana chromosome 1 BAC F... 82 1e-013
ref|NM_100653.2| Arabidopsis thaliana DNA binding AT1G07790... 82 1e-013
ref|NC_003070.5| Arabidopsis thaliana chromosome 1, complet... 82 1e-013
gb|AY086049.1| Arabidopsis thaliana clone 20822 mRNA, compl... 80 6e-013
gb|BP579872.1|BP579872 BP579872 RAFL14 Arabidopsis thaliana... 78 2e-012
gb|BP581187.1|BP581187 BP581187 RAFL14 Arabidopsis thaliana... 78 2e-012
gb|CL469572.1|CL469572 SAIL_1307_B05.v1 SAIL Collection Ara... 76 9e-012
gb|CB185859.1|CB185859 EST01050 Arabidopsis virulent Pseudo... 76 9e-012
gb|BP564421.1|BP564421 BP564421 RAFL14 Arabidopsis thaliana... 76 9e-012
gb|BP565667.1|BP565667 BP565667 RAFL14 Arabidopsis thaliana... 76 9e-012
gb|BP619021.1|BP619021 BP619021 RAFL16 Arabidopsis thaliana... 76 9e-012
gb|BP826014.1|BP826014 BP826014 RAFL19 Arabidopsis thaliana... 76 9e-012
gb|BP840507.1|BP840507 BP840507 RAFL19 Arabidopsis thaliana... 76 9e-012
gb|Z18202.1|Z18202 ATTS0707 Grenoble-B Arabidopsis thaliana... 76 9e-012
gb|U18970.1|ATU18970 Arabidopsis thaliana phosphoribosylant... 76 9e-012
gb|BP831132.1|BP831132 BP831132 RAFL19 Arabidopsis thaliana... 74 4e-011
gb|U34757.2|ATU34757 Arabidopsis thaliana phosphoribosylant... 74 4e-011
gb|AY088636.1| Arabidopsis thaliana clone 8711 mRNA, comple... 74 4e-011
gb|AY357734.1| Arabidopsis thaliana phosphoribosylanthranil... 74 4e-011
gb|BH610928.1|BH610928 SALK_018246 Arabidopsis thaliana TDN... 72 1e-010
gb|BH617416.1|BH617416 SALK_036467 Arabidopsis thaliana TDN... 72 1e-010
gb|BZ288838.1|BZ288838 SALK_022228.56.00.x Arabidopsis thal... 72 1e-010
gb|BZ289176.1|BZ289176 SALK_022573.48.40.x Arabidopsis thal... 72 1e-010
gb|BZ769396.1|BZ769396 SALK_142124.48.80.x Arabidopsis thal... 72 1e-010
gb|CB074430.1|CB074430 EST00945 Virulent Peronospora parasi... 72 1e-010
gb|CF652319.1|CF652319 48-L020164-066-001-O12-SP6P MPIZ-ADI... 72 1e-010
gb|BP814260.1|BP814260 BP814260 RAFL19 Arabidopsis thaliana... 72 1e-010
gb|BP827738.1|BP827738 BP827738 RAFL19 Arabidopsis thaliana... 72 1e-010
gb|BP834415.1|BP834415 BP834415 RAFL19 Arabidopsis thaliana... 72 1e-010
gb|BP836681.1|BP836681 BP836681 RAFL19 Arabidopsis thaliana... 72 1e-010
gb|BP867288.1|BP867288 BP867288 RAFL21 Arabidopsis thaliana... 72 1e-010
gb|CL489531.1|CL489531 SAIL_525_F04.v1 SAIL Collection Arab... 68 2e-009
gb|T22855.1|T22855 4863 Lambda-PRL2 Arabidopsis thaliana cD... 68 2e-009
gb|R30263.1|R30263 12868 Lambda-PRL2 Arabidopsis thaliana c... 68 2e-009
gb|CA963968.1|CA963968 cATI008B02AF Infected Arabidopsis Le... 68 2e-009
gb|AV562999.1|AV562999 AV562999 Arabidopsis thaliana green ... 68 2e-009
gb|CF773114.1|CF773114 AG_FSL_13B10 Arabidopsis ag-1 35S:AG... 68 2e-009
gb|BP812450.1|BP812450 BP812450 RAFL19 Arabidopsis thaliana... 68 2e-009
gb|BP813666.1|BP813666 BP813666 RAFL19 Arabidopsis thaliana... 68 2e-009
gb|BP821530.1|BP821530 BP821530 RAFL19 Arabidopsis thaliana... 68 2e-009
gb|BP834170.1|BP834170 BP834170 RAFL19 Arabidopsis thaliana... 68 2e-009
gb|BP837073.1|BP837073 BP837073 RAFL19 Arabidopsis thaliana... 68 2e-009
gb|BP854448.1|BP854448 BP854448 RAFL21 Arabidopsis thaliana... 68 2e-009
emb|AJ839038.1| Arabidopsis thaliana T-DNA flanking sequenc... 68 2e-009
gb|BP643336.1|BP643336 BP643336 RAFL19 Arabidopsis thaliana... 66 9e-009
gb|BP595772.1|BP595772 BP595772 RAFL15 Arabidopsis thaliana... 64 3e-008
gb|BP624380.1|BP624380 BP624380 RAFL17 Arabidopsis thaliana... 64 3e-008
gb|T13853.1|T13853 2018 Lambda-PRL2 Arabidopsis thaliana cD... 62 1e-007
gb|BP652615.1|BP652615 BP652615 RAFL19 Arabidopsis thaliana... 62 1e-007
gb|CL491150.1|CL491150 SAIL_553_B04.v3 SAIL Collection Arab... 60 5e-007
emb|CR401647.1| Arabidopsis thaliana T-DNA flanking sequenc... 60 5e-007
emb|CR401648.1| Arabidopsis thaliana T-DNA flanking sequenc... 60 5e-007
emb|CR401845.1| Arabidopsis thaliana T-DNA flanking sequenc... 60 5e-007
emb|CR401846.1| Arabidopsis thaliana T-DNA flanking sequenc... 60 5e-007
gb|Z26871.1|Z26871 ATTS1876 AC16H Arabidopsis thaliana cDNA... 60 5e-007
gb|Z47622.1|Z47622 ATTS4478 AC16H Arabidopsis thaliana cDNA... 60 5e-007
gb|AU226757.1|AU226757 AU226757 RAFL14 Arabidopsis thaliana... 60 5e-007
gb|BP597022.1|BP597022 BP597022 RAFL15 Arabidopsis thaliana... 60 5e-007
gb|BP803510.1|BP803510 BP803510 RAFL14 Arabidopsis thaliana... 60 5e-007
gb|BP822410.1|BP822410 BP822410 RAFL19 Arabidopsis thaliana... 60 5e-007
gb|BP822970.1|BP822970 BP822970 RAFL19 Arabidopsis thaliana... 60 5e-007
gb|BP823124.1|BP823124 BP823124 RAFL19 Arabidopsis thaliana... 60 5e-007
gb|BP824782.1|BP824782 BP824782 RAFL19 Arabidopsis thaliana... 60 5e-007
gb|BP829410.1|BP829410 BP829410 RAFL19 Arabidopsis thaliana... 60 5e-007
gb|BP835400.1|BP835400 BP835400 RAFL19 Arabidopsis thaliana... 60 5e-007
gb|BP837675.1|BP837675 BP837675 RAFL19 Arabidopsis thaliana... 60 5e-007
gb|BP839371.1|BP839371 BP839371 RAFL19 Arabidopsis thaliana... 60 5e-007
gb|BP856858.1|BP856858 BP856858 RAFL21 Arabidopsis thaliana... 60 5e-007
emb|AL094930.1|CNS00XIS Arabidopsis thaliana genome survey ... 58 2e-006
emb|BX947581.1| Arabidopsis thaliana T-DNA flanking sequenc... 58 2e-006
gb|CW801553.1|CW801553 WiscDsLox494B05 Arabidopsis thaliana... 58 2e-006
gb|AI100688.1|AI100688 34385 Lambda-PRL2 Arabidopsis thalia... 58 2e-006
gb|AU226337.1|AU226337 AU226337 RAFL14 Arabidopsis thaliana... 58 2e-006
gb|AU235602.1|AU235602 AU235602 RAFL14 Arabidopsis thaliana... 58 2e-006
gb|AV552384.1|AV552384 AV552384 Arabidopsis thaliana roots ... 58 2e-006
gb|CK117943.1|CK117943 209b05.p1 AtM1 Arabidopsis thaliana ... 58 2e-006
gb|CK117978.1|CK117978 208m23.p1 AtM1 Arabidopsis thaliana ... 58 2e-006
gb|CK118052.1|CK118052 218h23.p1 AtM1 Arabidopsis thaliana ... 58 2e-006
gb|CK118120.1|CK118120 218a09.p1 AtM1 Arabidopsis thaliana ... 58 2e-006
gb|CK119134.1|CK119134 214b21.p1 AtM1 Arabidopsis thaliana ... 58 2e-006
gb|CK119155.1|CK119155 214a19.p1 AtM1 Arabidopsis thaliana ... 58 2e-006
gb|CK121285.1|CK121285 203m24.p1 AtM1 Arabidopsis thaliana ... 58 2e-006
gb|CK121397.1|CK121397 203f14.p1 AtM1 Arabidopsis thaliana ... 58 2e-006
gb|CK121854.1|CK121854 212m17.p1 AtM1 Arabidopsis thaliana ... 58 2e-006
gb|BP561503.1|BP561503 BP561503 RAFL7 Arabidopsis thaliana ... 58 2e-006
gb|BP571920.1|BP571920 BP571920 RAFL14 Arabidopsis thaliana... 58 2e-006
gb|BP599053.1|BP599053 BP599053 RAFL16 Arabidopsis thaliana... 58 2e-006
gb|AY087219.1| Arabidopsis thaliana clone 32930 mRNA, compl... 58 2e-006
gb|BT006400.1| Arabidopsis thaliana At3g45980 gene, complet... 58 2e-006
emb|BX822784.1|CNS0A4UQ Arabidopsis thaliana Full-length cD... 58 2e-006
emb|BX824094.1|CNS0A6W9 Arabidopsis thaliana Full-length cD... 58 2e-006
dbj|BA000014.8| Arabidopsis thaliana, chromosome 3, complet... 58 2e-006
emb|AL132966.1|ATF4P12 Arabidopsis thaliana DNA chromosome ... 58 2e-006
emb|AL162459.2|ATF16L2 Arabidopsis thaliana DNA chromosome ... 58 2e-006
emb|Y12576.1|ATH2B Arabidopsis thaliana mRNA for histone H2B 58 2e-006
ref|NM_115225.1| Arabidopsis thaliana DNA binding AT3G53650... 58 2e-006
ref|NM_114467.3| Arabidopsis thaliana DNA binding AT3G45980... 58 2e-006
ref|NC_003074.4| Arabidopsis thaliana chromosome 3, complet... 58 2e-006
gb|BP570834.1|BP570834 BP570834 RAFL14 Arabidopsis thaliana... 56 8e-006
gb|BP586131.1|BP586131 BP586131 RAFL15 Arabidopsis thaliana... 56 8e-006
gb|BP657464.1|BP657464 BP657464 RAFL19 Arabidopsis thaliana... 56 8e-006
gb|B76780.1|B76780 T26G2TR TAMU Arabidopsis thaliana genomi... 54 3e-005
gb|CC792902.1|CC792902 SALK_003306.56.00.n Arabidopsis thal... 54 3e-005
gb|CL470783.1|CL470783 SAIL_148_C12.v1 SAIL Collection Arab... 54 3e-005
gb|CL491089.1|CL491089 SAIL_551_H02.v1 SAIL Collection Arab... 54 3e-005
gb|CL494398.1|CL494398 SAIL_594_A07.v1 SAIL Collection Arab... 54 3e-005
gb|AY202019.1|AY202019 AY202019 Arabidopsis thaliana Landsb... 54 3e-005
gb|AY202020.1|AY202020 AY202020 Arabidopsis thaliana Landsb... 54 3e-005
gb|Z29157.1|Z29157 ATTS2103 Versailles-VB Arabidopsis thali... 54 3e-005
gb|T22899.1|T22899 4907 Lambda-PRL2 Arabidopsis thaliana cD... 54 3e-005
gb|AA712800.1|AA712800 32359 Lambda-PRL2 Arabidopsis thalia... 54 3e-005
gb|T14148.1|T14148 2313 Lambda-PRL2 Arabidopsis thaliana cD... 54 3e-005
gb|T43468.1|T43468 6731 Lambda-PRL2 Arabidopsis thaliana cD... 54 3e-005
gb|T88557.1|T88557 12253 Lambda-PRL2 Arabidopsis thaliana c... 54 3e-005
gb|AI992655.1|AI992655 701558589 A. thaliana, Ohio State cl... 54 3e-005
gb|AI999726.1|AI999726 701557189 A. thaliana, Columbia Col-... 54 3e-005
gb|AU226784.1|AU226784 AU226784 RAFL14 Arabidopsis thaliana... 54 3e-005
gb|AV821359.1|AV821359 AV821359 RAFL4 Arabidopsis thaliana ... 54 3e-005
gb|AV828931.1|AV828931 AV828931 RAFL9 Arabidopsis thaliana ... 54 3e-005
gb|AU235990.1|AU235990 AU235990 RAFL14 Arabidopsis thaliana... 54 3e-005
gb|BU635121.1|BU635121 016A12 Infected Arabidopsis Leaf Ara... 54 3e-005
gb|CB262791.1|CB262791 46-E8976-008-017-L11-pBl2 MPIZ-ADIS-... 54 3e-005
gb|CB263606.1|CB263606 14-E8975-008-017-K04-pBl2 MPIZ-ADIS-... 54 3e-005
gb|CB263874.1|CB263874 06-E9721-008-016-K01-pBl2 MPIZ-ADIS-... 54 3e-005
gb|CF651258.1|CF651258 41-E009213w-013-001-A11-T7R MPIZ-ADI... 54 3e-005
gb|CF651259.1|CF651259 41-E021106-013-001-A11-T7R MPIZ-ADIS... 54 3e-005
gb|CF651964.1|CF651964 25-L020578-066-004-A08-SP6P MPIZ-ADI... 54 3e-005
gb|CF652901.1|CF652901 83-L020526w-066-003-F22-SP6P MPIZ-AD... 54 3e-005
gb|CK117979.1|CK117979 208m24.p1 AtM1 Arabidopsis thaliana ... 54 3e-005
gb|CK121749.1|CK121749 201a19.p1 AtM1 Arabidopsis thaliana ... 54 3e-005
gb|BP565885.1|BP565885 BP565885 RAFL14 Arabidopsis thaliana... 54 3e-005
gb|BP592573.1|BP592573 BP592573 RAFL15 Arabidopsis thaliana... 54 3e-005
gb|BP642219.1|BP642219 BP642219 RAFL19 Arabidopsis thaliana... 54 3e-005
gb|BP647465.1|BP647465 BP647465 RAFL19 Arabidopsis thaliana... 54 3e-005
gb|CB254707.1|CB254707 62-E012995-019-004-L16-SP6r MPIZ-ADI... 54 3e-005
gb|CB254710.1|CB254710 62-E013000-019-004-L16-T7R MPIZ-ADIS... 54 3e-005
gb|BP801969.1|BP801969 BP801969 RAFL14 Arabidopsis thaliana... 54 3e-005
gb|BP815361.1|BP815361 BP815361 RAFL19 Arabidopsis thaliana... 54 3e-005
gb|BP817957.1|BP817957 BP817957 RAFL19 Arabidopsis thaliana... 54 3e-005
gb|BP819311.1|BP819311 BP819311 RAFL19 Arabidopsis thaliana... 54 3e-005
gb|BP823425.1|BP823425 BP823425 RAFL19 Arabidopsis thaliana... 54 3e-005
gb|BP839918.1|BP839918 BP839918 RAFL19 Arabidopsis thaliana... 54 3e-005
gb|BP846772.1|BP846772 BP846772 RAFL21 Arabidopsis thaliana... 54 3e-005
gb|BP855856.1|BP855856 BP855856 RAFL21 Arabidopsis thaliana... 54 3e-005
gb|BP864961.1|BP864961 BP864961 RAFL21 Arabidopsis thaliana... 54 3e-005
gb|BP866899.1|BP866899 BP866899 RAFL21 Arabidopsis thaliana... 54 3e-005
gb|AF102173.1|AF102173 Arabidopsis thaliana actin depolymer... 54 3e-005
gb|AY057605.1| Arabidopsis thaliana At2g28720/T11P11.3 mRNA... 54 3e-005
gb|AF325075.1|AF325075 Arabidopsis thaliana putative histon... 54 3e-005
gb|AY124835.1| Arabidopsis thaliana At2g28720/T11P11.3 mRNA... 54 3e-005
emb|AX507201.1| Sequence 1896 from Patent WO0216655 54 3e-005
gb|BT005206.1| Arabidopsis thaliana At2g37470 mRNA, complet... 54 3e-005
gb|AY084352.1| Arabidopsis thaliana clone 10517 mRNA, compl... 54 3e-005
gb|AY085391.1| Arabidopsis thaliana clone 14965 mRNA, compl... 54 3e-005
gb|AY087125.1| Arabidopsis thaliana clone 31973 mRNA, compl... 54 3e-005
gb|AC005896.3| Arabidopsis thaliana chromosome 2 clone F3G5... 54 3e-005
gb|AC007184.4| Arabidopsis thaliana chromosome 2 clone T11P... 54 3e-005
emb|BX819107.1|CNS0AA81 Arabidopsis thaliana Full-length cD... 54 3e-005
emb|BX821556.1|CNS0AAGB Arabidopsis thaliana Full-length cD... 54 3e-005
emb|BX816118.1|CNS0ABRU Arabidopsis thaliana Full-length cD... 54 3e-005
emb|BX816346.1|CNS0ABM4 Arabidopsis thaliana Full-length cD... 54 3e-005
emb|BX813779.1|CNS0AEHZ Arabidopsis thaliana Full-length cD... 54 3e-005
ref|NM_129302.2| Arabidopsis thaliana DNA binding AT2G37470... 54 3e-005
ref|NM_114472.2| Arabidopsis thaliana DNA binding AT3G46030... 54 3e-005
ref|NM_128433.3| Arabidopsis thaliana DNA binding AT2G28720... 54 3e-005
ref|NC_003071.3| Arabidopsis thaliana chromosome 2, complet... 54 3e-005
gb|R29809.1|R29809 12414 Lambda-PRL2 Arabidopsis thaliana c... 52 1e-004
gb|T45496.1|T45496 8759 Lambda-PRL2 Arabidopsis thaliana cD... 52 1e-004
gb|BP585021.1|BP585021 BP585021 RAFL15 Arabidopsis thaliana... 52 1e-004
gb|BP593701.1|BP593701 BP593701 RAFL15 Arabidopsis thaliana... 52 1e-004
gb|BP596496.1|BP596496 BP596496 RAFL15 Arabidopsis thaliana... 52 1e-004
gb|BP653431.1|BP653431 BP653431 RAFL19 Arabidopsis thaliana... 52 1e-004
gb|CB252613.1|CB252613 21-E018362-019-007-J05-T7R MPIZ-ADIS... 52 1e-004
gb|CB253825.1|CB253825 87-E012992-019-004-M21-SP6r MPIZ-ADI... 52 1e-004
gb|BP796377.1|BP796377 BP796377 RAFL5 Arabidopsis thaliana ... 52 1e-004
gb|BP803966.1|BP803966 BP803966 RAFL14 Arabidopsis thaliana... 52 1e-004
gb|BP805281.1|BP805281 BP805281 RAFL16 Arabidopsis thaliana... 52 1e-004
gb|BP810218.1|BP810218 BP810218 RAFL16 Arabidopsis thaliana... 52 1e-004
gb|BP815526.1|BP815526 BP815526 RAFL19 Arabidopsis thaliana... 52 1e-004
gb|BP823037.1|BP823037 BP823037 RAFL19 Arabidopsis thaliana... 52 1e-004
gb|BP826623.1|BP826623 BP826623 RAFL19 Arabidopsis thaliana... 52 1e-004
gb|BP834871.1|BP834871 BP834871 RAFL19 Arabidopsis thaliana... 52 1e-004
gb|BP836150.1|BP836150 BP836150 RAFL19 Arabidopsis thaliana... 52 1e-004
gb|BP840182.1|BP840182 BP840182 RAFL19 Arabidopsis thaliana... 52 1e-004
emb|AL756239.1| Arabidopsis thaliana T-DNA flanking sequenc... 50 5e-004
gb|CL499371.1|CL499371 SAIL_667_G10.v1 SAIL Collection Arab... 50 5e-004
emb|AL952711.1| Arabidopsis thaliana T-DNA flanking sequenc... 50 5e-004
emb|CR399380.1| Arabidopsis thaliana T-DNA flanking sequenc... 50 5e-004
gb|T04097.1|T04097 47 Lambda-PRL1 Arabidopsis thaliana cDNA... 50 5e-004
gb|T21790.1|T21790 3798 Lambda-PRL2 Arabidopsis thaliana cD... 50 5e-004
gb|BP608591.1|BP608591 BP608591 RAFL16 Arabidopsis thaliana... 50 5e-004
gb|BP636328.1|BP636328 BP636328 RAFL18 Arabidopsis thaliana... 50 5e-004
gb|BP816537.1|BP816537 BP816537 RAFL19 Arabidopsis thaliana... 50 5e-004
gb|BP836709.1|BP836709 BP836709 RAFL19 Arabidopsis thaliana... 50 5e-004
gb|BP858977.1|BP858977 BP858977 RAFL21 Arabidopsis thaliana... 50 5e-004
gb|BT010498.1| Arabidopsis thaliana At3g09480 gene, complet... 50 5e-004
gb|AC016661.7|AC016661 Arabidopsis thaliana chromosome 3 BA... 50 5e-004
dbj|AK175800.1| Arabidopsis thaliana mRNA for putative hist... 50 5e-004
dbj|AK176003.1| Arabidopsis thaliana mRNA for putative hist... 50 5e-004
dbj|AK176835.1| Arabidopsis thaliana mRNA for putative hist... 50 5e-004
ref|NM_111782.1| Arabidopsis thaliana DNA binding AT3G09480... 50 5e-004
emb|AL758292.1| Arabidopsis thaliana T-DNA flanking sequenc... 48 0.002
gb|AY202021.1|AY202021 AY202021 Arabidopsis thaliana Landsb... 48 0.002
gb|AY203572.1|AY203572 AY203572 Arabidopsis thaliana Landsb... 48 0.002
gb|R83948.1|R83948 15907 Lambda-PRL2 Arabidopsis thaliana c... 48 0.002
gb|AA720269.1|AA720269 33462 Lambda-PRL2 Arabidopsis thalia... 48 0.002
gb|AV806453.1|AV806453 AV806453 RAFL9 Arabidopsis thaliana ... 48 0.002
gb|AV535358.1|AV535358 AV535358 Arabidopsis thaliana flower... 48 0.002
gb|AV537095.1|AV537095 AV537095 Arabidopsis thaliana liquid... 48 0.002
gb|AV540331.1|AV540331 AV540331 Arabidopsis thaliana roots ... 48 0.002
gb|AV567456.1|AV567456 AV567456 Arabidopsis thaliana green ... 48 0.002
gb|BP571654.1|BP571654 BP571654 RAFL14 Arabidopsis thaliana... 48 0.002
gb|BP576387.1|BP576387 BP576387 RAFL14 Arabidopsis thaliana... 48 0.002
gb|BP580308.1|BP580308 BP580308 RAFL14 Arabidopsis thaliana... 48 0.002
gb|BP582160.1|BP582160 BP582160 RAFL14 Arabidopsis thaliana... 48 0.002
gb|BP587491.1|BP587491 BP587491 RAFL15 Arabidopsis thaliana... 48 0.002
gb|BP589933.1|BP589933 BP589933 RAFL15 Arabidopsis thaliana... 48 0.002
gb|BP594138.1|BP594138 BP594138 RAFL15 Arabidopsis thaliana... 48 0.002
gb|BP595243.1|BP595243 BP595243 RAFL15 Arabidopsis thaliana... 48 0.002
gb|BP602161.1|BP602161 BP602161 RAFL16 Arabidopsis thaliana... 48 0.002
gb|BP607237.1|BP607237 BP607237 RAFL16 Arabidopsis thaliana... 48 0.002
gb|BP628089.1|BP628089 BP628089 RAFL17 Arabidopsis thaliana... 48 0.002
gb|BP641660.1|BP641660 BP641660 RAFL19 Arabidopsis thaliana... 48 0.002
gb|BP647203.1|BP647203 BP647203 RAFL19 Arabidopsis thaliana... 48 0.002
gb|BP648112.1|BP648112 BP648112 RAFL19 Arabidopsis thaliana... 48 0.002
gb|BP650551.1|BP650551 BP650551 RAFL19 Arabidopsis thaliana... 48 0.002
gb|BP650608.1|BP650608 BP650608 RAFL19 Arabidopsis thaliana... 48 0.002
gb|BP650985.1|BP650985 BP650985 RAFL19 Arabidopsis thaliana... 48 0.002
gb|BP655963.1|BP655963 BP655963 RAFL19 Arabidopsis thaliana... 48 0.002
gb|BP658892.1|BP658892 BP658892 RAFL19 Arabidopsis thaliana... 48 0.002
gb|BP669202.1|BP669202 BP669202 RAFL21 Arabidopsis thaliana... 48 0.002
gb|BP787756.1|BP787756 BP787756 RAFL7 Arabidopsis thaliana ... 48 0.002
gb|BP793366.1|BP793366 BP793366 RAFL7 Arabidopsis thaliana ... 48 0.002
emb|AL755493.1| Arabidopsis thaliana T-DNA flanking sequenc... 46 0.008
gb|T42349.1|T42349 5612 Lambda-PRL2 Arabidopsis thaliana cD... 46 0.008
gb|BP568688.1|BP568688 BP568688 RAFL14 Arabidopsis thaliana... 46 0.008
gb|BP571003.1|BP571003 BP571003 RAFL14 Arabidopsis thaliana... 46 0.008
gb|BP576224.1|BP576224 BP576224 RAFL14 Arabidopsis thaliana... 46 0.008
gb|BP614135.1|BP614135 BP614135 RAFL16 Arabidopsis thaliana... 46 0.008
gb|BP645624.1|BP645624 BP645624 RAFL19 Arabidopsis thaliana... 46 0.008
gb|BP665269.1|BP665269 BP665269 RAFL21 Arabidopsis thaliana... 46 0.008
gb|BP804090.1|BP804090 BP804090 RAFL14 Arabidopsis thaliana... 46 0.008
gb|BP841779.1|BP841779 BP841779 RAFL21 Arabidopsis thaliana... 46 0.008
emb|AL162971.1|ATT22P11 Arabidopsis thaliana DNA chromosome... 46 0.008
ref|NM_120335.1| Arabidopsis thaliana DNA binding AT5G02570... 46 0.008
gb|CL472902.1|CL472902 SAIL_18b_C02.v1 SAIL Collection Arab... 44 0.032
gb|AV790151.1|AV790151 AV790151 RAFL6 Arabidopsis thaliana ... 44 0.032
gb|AV535463.1|AV535463 AV535463 Arabidopsis thaliana flower... 44 0.032
gb|BP571130.1|BP571130 BP571130 RAFL14 Arabidopsis thaliana... 44 0.032
gb|BP580496.1|BP580496 BP580496 RAFL14 Arabidopsis thaliana... 44 0.032
gb|BP586960.1|BP586960 BP586960 RAFL15 Arabidopsis thaliana... 44 0.032
gb|BP596859.1|BP596859 BP596859 RAFL15 Arabidopsis thaliana... 44 0.032
gb|BP597280.1|BP597280 BP597280 RAFL15 Arabidopsis thaliana... 44 0.032
gb|BP617666.1|BP617666 BP617666 RAFL16 Arabidopsis thaliana... 44 0.032
gb|BP636973.1|BP636973 BP636973 RAFL19 Arabidopsis thaliana... 44 0.032
gb|BP637764.1|BP637764 BP637764 RAFL19 Arabidopsis thaliana... 44 0.032
gb|BP655685.1|BP655685 BP655685 RAFL19 Arabidopsis thaliana... 44 0.032
gb|BP656677.1|BP656677 BP656677 RAFL19 Arabidopsis thaliana... 44 0.032
gb|BP657853.1|BP657853 BP657853 RAFL19 Arabidopsis thaliana... 44 0.032
gb|BP660344.1|BP660344 BP660344 RAFL19 Arabidopsis thaliana... 44 0.032
gb|BP662810.1|BP662810 BP662810 RAFL21 Arabidopsis thaliana... 44 0.032
gb|BP671914.1|BP671914 BP671914 RAFL21 Arabidopsis thaliana... 44 0.032
gb|BP816452.1|BP816452 BP816452 RAFL19 Arabidopsis thaliana... 44 0.032
gb|BP831315.1|BP831315 BP831315 RAFL19 Arabidopsis thaliana... 44 0.032
gb|BH904942.1|BH904942 SALK_105362.55.00.x Arabidopsis thal... 42 0.13
gb|CL496660.1|CL496660 SAIL_629_D07.v1 SAIL Collection Arab... 42 0.13
gb|CW796725.1|CW796725 WiscDsLox465C5 Arabidopsis thaliana ... 42 0.13
gb|C99791.1|C99791 C99791 YAC clone CIC8B11 region-specific... 42 0.13
gb|BP624421.1|BP624421 BP624421 RAFL17 Arabidopsis thaliana... 42 0.13
gb|BP634381.1|BP634381 BP634381 RAFL17 Arabidopsis thaliana... 42 0.13
gb|BP639365.1|BP639365 BP639365 RAFL19 Arabidopsis thaliana... 42 0.13
gb|BP652588.1|BP652588 BP652588 RAFL19 Arabidopsis thaliana... 42 0.13
gb|AI100170.1|AI100170 34545 Lambda-PRL2 Arabidopsis thalia... 40 0.49
gb|AV781858.1|AV781858 AV781858 RAFL4 Arabidopsis thaliana ... 40 0.49
gb|BP597115.1|BP597115 BP597115 RAFL15 Arabidopsis thaliana... 40 0.49
gb|BP637622.1|BP637622 BP637622 RAFL19 Arabidopsis thaliana... 40 0.49
gb|BP648563.1|BP648563 BP648563 RAFL19 Arabidopsis thaliana... 40 0.49
gb|BP655572.1|BP655572 BP655572 RAFL19 Arabidopsis thaliana... 40 0.49
gb|BP812005.1|BP812005 BP812005 RAFL19 Arabidopsis thaliana... 40 0.49
gb|BP816132.1|BP816132 BP816132 RAFL19 Arabidopsis thaliana... 40 0.49
>gb|AF471815.1| Arabidopsis thaliana ecotype HODJA chromosome 5 locus MRN17.5
Length = 324
Score = 99.6 bits (50), Expect = 6e-019
Identities = 131/158 (82%)
Strand = Plus / Plus
Query: 298 ggcttcttgttgtagcgcgcaagcttggcagcctcgccggcgagcttctcgaagatgtcg 357
|||||||||||||| | ||||||||| | || ||| || || |||||||| ||||| |||
Sbjct: 39 ggcttcttgttgtacctcgcaagcttcgaagactcaccagcaagcttctcaaagatatcg 98
Query: 358 ttgatgaaggagttcatgatggacatggccttggaagagatgccgatgtcggggtggacc 417
|||||||| ||||||||| |||||| ||| ||||| |||||||| || || ||
Sbjct: 99 ttgatgaaactgttcatgattcccatggctttgcttgagattccgatgtctggatgaact 158
Query: 418 tgcttcagcaccttgaagatgtagatcttgtaggtctc 455
||||||| |||||||||||||||||||||||| |||||
Sbjct: 159 tgcttcaacaccttgaagatgtagatcttgtatgtctc 196
>gb|AF471816.1| Arabidopsis thaliana ecotype CAL-0 chromosome 5 locus MRN17.5
Length = 324
Score = 99.6 bits (50), Expect = 6e-019
Identities = 131/158 (82%)
Strand = Plus / Plus
Query: 298 ggcttcttgttgtagcgcgcaagcttggcagcctcgccggcgagcttctcgaagatgtcg 357
|||||||||||||| | ||||||||| | || ||| || || |||||||| ||||| |||
Sbjct: 39 ggcttcttgttgtacctcgcaagcttcgaagactcaccagcaagcttctcaaagatatcg 98
Query: 358 ttgatgaaggagttcatgatggacatggccttggaagagatgccgatgtcggggtggacc 417
|||||||| ||||||||| |||||| ||| ||||| |||||||| || || ||
Sbjct: 99 ttgatgaaactgttcatgattcccatggctttgcttgagattccgatgtctggatgaact 158
Query: 418 tgcttcagcaccttgaagatgtagatcttgtaggtctc 455
||||||| |||||||||||||||||||||||| |||||
Sbjct: 159 tgcttcaacaccttgaagatgtagatcttgtatgtctc 196
>gb|AF471817.1| Arabidopsis thaliana ecotype MRK-0 chromosome 5 locus MRN17.5
Length = 324
Score = 99.6 bits (50), Expect = 6e-019
Identities = 131/158 (82%)
Strand = Plus / Plus
Query: 298 ggcttcttgttgtagcgcgcaagcttggcagcctcgccggcgagcttctcgaagatgtcg 357
|||||||||||||| | ||||||||| | || ||| || || |||||||| ||||| |||
Sbjct: 39 ggcttcttgttgtacctcgcaagcttcgaagactcaccagcaagcttctcaaagatatcg 98
Query: 358 ttgatgaaggagttcatgatggacatggccttggaagagatgccgatgtcggggtggacc 417
|||||||| ||||||||| |||||| ||| ||||| |||||||| || || ||
Sbjct: 99 ttgatgaaactgttcatgattcccatggctttgcttgagattccgatgtctggatgaact 158
Query: 418 tgcttcagcaccttgaagatgtagatcttgtaggtctc 455
||||||| |||||||||||||||||||||||| |||||
Sbjct: 159 tgcttcaacaccttgaagatgtagatcttgtatgtctc 196
>gb|AF471818.1| Arabidopsis thaliana ecotype CVI-0 chromosome 5 locus MRN17.5
Length = 324
Score = 99.6 bits (50), Expect = 6e-019
Identities = 131/158 (82%)
Strand = Plus / Plus
Query: 298 ggcttcttgttgtagcgcgcaagcttggcagcctcgccggcgagcttctcgaagatgtcg 357
|||||||||||||| | ||||||||| | || ||| || || |||||||| ||||| |||
Sbjct: 39 ggcttcttgttgtacctcgcaagcttcgaagactcaccagcaagcttctcaaagatatcg 98
Query: 358 ttgatgaaggagttcatgatggacatggccttggaagagatgccgatgtcggggtggacc 417
|||||||| ||||||||| |||||| ||| ||||| |||||||| || || ||
Sbjct: 99 ttgatgaaactgttcatgattcccatggctttgcttgagattccgatgtctggatgaact 158
Query: 418 tgcttcagcaccttgaagatgtagatcttgtaggtctc 455
||||||| |||||||||||||||||||||||| |||||
Sbjct: 159 tgcttcaacaccttgaagatgtagatcttgtatgtctc 196
>gb|AF471819.1| Arabidopsis thaliana ecotype PA-1 chromosome 5 locus MRN17.5
Length = 324
Score = 99.6 bits (50), Expect = 6e-019
Identities = 131/158 (82%)
Strand = Plus / Plus
Query: 298 ggcttcttgttgtagcgcgcaagcttggcagcctcgccggcgagcttctcgaagatgtcg 357
|||||||||||||| | ||||||||| | || ||| || || |||||||| ||||| |||
Sbjct: 39 ggcttcttgttgtacctcgcaagcttcgaagactcaccagcaagcttctcaaagatatcg 98
Query: 358 ttgatgaaggagttcatgatggacatggccttggaagagatgccgatgtcggggtggacc 417
|||||||| ||||||||| |||||| ||| ||||| |||||||| || || ||
Sbjct: 99 ttgatgaaactgttcatgattcccatggctttgcttgagattccgatgtctggatgaact 158
Query: 418 tgcttcagcaccttgaagatgtagatcttgtaggtctc 455
||||||| |||||||||||||||||||||||| |||||
Sbjct: 159 tgcttcaacaccttgaagatgtagatcttgtatgtctc 196
>gb|AF471820.1| Arabidopsis thaliana ecotype CNT-1 chromosome 5 locus MRN17.5
Length = 324
Score = 99.6 bits (50), Expect = 6e-019
Identities = 131/158 (82%)
Strand = Plus / Plus
Query: 298 ggcttcttgttgtagcgcgcaagcttggcagcctcgccggcgagcttctcgaagatgtcg 357
|||||||||||||| | ||||||||| | || ||| || || |||||||| ||||| |||
Sbjct: 39 ggcttcttgttgtacctcgcaagcttcgaagactcaccagcaagcttctcaaagatatcg 98
Query: 358 ttgatgaaggagttcatgatggacatggccttggaagagatgccgatgtcggggtggacc 417
|||||||| ||||||||| |||||| ||| ||||| |||||||| || || ||
Sbjct: 99 ttgatgaaactgttcatgattcccatggctttgcttgagattccgatgtctggatgaact 158
Query: 418 tgcttcagcaccttgaagatgtagatcttgtaggtctc 455
||||||| |||||||||||||||||||||||| |||||
Sbjct: 159 tgcttcaacaccttgaagatgtagatcttgtatgtctc 196
>gb|AF471821.1| Arabidopsis thaliana ecotype POG-0 chromosome 5 locus MRN17.5
Length = 324
Score = 99.6 bits (50), Expect = 6e-019
Identities = 131/158 (82%)
Strand = Plus / Plus
Query: 298 ggcttcttgttgtagcgcgcaagcttggcagcctcgccggcgagcttctcgaagatgtcg 357
|||||||||||||| | ||||||||| | || ||| || || |||||||| ||||| |||
Sbjct: 39 ggcttcttgttgtacctcgcaagcttcgaagactcaccagcaagcttctcaaagatatcg 98
Query: 358 ttgatgaaggagttcatgatggacatggccttggaagagatgccgatgtcggggtggacc 417
|||||||| ||||||||| |||||| ||| ||||| |||||||| || || ||
Sbjct: 99 ttgatgaaactgttcatgattcccatggctttgcttgagattccgatgtctggatgaact 158
Query: 418 tgcttcagcaccttgaagatgtagatcttgtaggtctc 455
||||||| |||||||||||||||||||||||| |||||
Sbjct: 159 tgcttcaacaccttgaagatgtagatcttgtatgtctc 196
>gb|AF471829.1| Arabidopsis thaliana ecotype KAS-1 chromosome 5 locus MRN17.5
Length = 324
Score = 99.6 bits (50), Expect = 6e-019
Identities = 131/158 (82%)
Strand = Plus / Plus
Query: 298 ggcttcttgttgtagcgcgcaagcttggcagcctcgccggcgagcttctcgaagatgtcg 357
|||||||||||||| | ||||||||| | || ||| || || |||||||| ||||| |||
Sbjct: 39 ggcttcttgttgtacctcgcaagcttcgaagactcaccagcaagcttctcaaagatatcg 98
Query: 358 ttgatgaaggagttcatgatggacatggccttggaagagatgccgatgtcggggtggacc 417
|||||||| ||||||||| |||||| ||| ||||| |||||||| || || ||
Sbjct: 99 ttgatgaaactgttcatgattcccatggctttgcttgagattccgatgtctggatgaact 158
Query: 418 tgcttcagcaccttgaagatgtagatcttgtaggtctc 455
||||||| |||||||||||||||||||||||| |||||
Sbjct: 159 tgcttcaacaccttgaagatgtagatcttgtatgtctc 196
>gb|AF471830.1| Arabidopsis thaliana ecotype TAC chromosome 5 locus MRN17.5
Length = 324
Score = 99.6 bits (50), Expect = 6e-019
Identities = 131/158 (82%)
Strand = Plus / Plus
Query: 298 ggcttcttgttgtagcgcgcaagcttggcagcctcgccggcgagcttctcgaagatgtcg 357
|||||||||||||| | ||||||||| | || ||| || || |||||||| ||||| |||
Sbjct: 39 ggcttcttgttgtacctcgcaagcttcgaagactcaccagcaagcttctcaaagatatcg 98
Query: 358 ttgatgaaggagttcatgatggacatggccttggaagagatgccgatgtcggggtggacc 417
|||||||| ||||||||| |||||| ||| ||||| |||||||| || || ||
Sbjct: 99 ttgatgaaactgttcatgattcccatggctttgcttgagattccgatgtctggatgaact 158
Query: 418 tgcttcagcaccttgaagatgtagatcttgtaggtctc 455
||||||| |||||||||||||||||||||||| |||||
Sbjct: 159 tgcttcaacaccttgaagatgtagatcttgtatgtctc 196
>gb|AF471831.1| Arabidopsis thaliana ecotype KONDARA chromosome 5 locus MRN17.5
Length = 324
Score = 99.6 bits (50), Expect = 6e-019
Identities = 131/158 (82%)
Strand = Plus / Plus
Query: 298 ggcttcttgttgtagcgcgcaagcttggcagcctcgccggcgagcttctcgaagatgtcg 357
|||||||||||||| | ||||||||| | || ||| || || |||||||| ||||| |||
Sbjct: 39 ggcttcttgttgtacctcgcaagcttcgaagactcaccagcaagcttctcaaagatatcg 98
Query: 358 ttgatgaaggagttcatgatggacatggccttggaagagatgccgatgtcggggtggacc 417
|||||||| ||||||||| |||||| ||| ||||| |||||||| || || ||
Sbjct: 99 ttgatgaaactgttcatgattcccatggctttgcttgagattccgatgtctggatgaact 158
Query: 418 tgcttcagcaccttgaagatgtagatcttgtaggtctc 455
||||||| |||||||||||||||||||||||| |||||
Sbjct: 159 tgcttcaacaccttgaagatgtagatcttgtatgtctc 196
>gb|AF471832.1| Arabidopsis thaliana ecotype ITA-0 chromosome 5 locus MRN17.5
Length = 324
Score = 99.6 bits (50), Expect = 6e-019
Identities = 131/158 (82%)
Strand = Plus / Plus
Query: 298 ggcttcttgttgtagcgcgcaagcttggcagcctcgccggcgagcttctcgaagatgtcg 357
|||||||||||||| | ||||||||| | || ||| || || |||||||| ||||| |||
Sbjct: 39 ggcttcttgttgtacctcgcaagcttcgaagactcaccagcaagcttctcaaagatatcg 98
Query: 358 ttgatgaaggagttcatgatggacatggccttggaagagatgccgatgtcggggtggacc 417
|||||||| ||||||||| |||||| ||| ||||| |||||||| || || ||
Sbjct: 99 ttgatgaaactgttcatgattcccatggctttgcttgagattccgatgtctggatgaact 158
Query: 418 tgcttcagcaccttgaagatgtagatcttgtaggtctc 455
||||||| |||||||||||||||||||||||| |||||
Sbjct: 159 tgcttcaacaccttgaagatgtagatcttgtatgtctc 196
>gb|AF471833.1| Arabidopsis thaliana ecotype PLA-0 chromosome 5 locus MRN17.5
Length = 324
Score = 99.6 bits (50), Expect = 6e-019
Identities = 149/182 (81%)
Strand = Plus / Plus
Query: 274 tgaatctcccgagaggtgatggtgggcttcttgttgtagcgcgcaagcttggcagcctcg 333
|||||||||| ||| || || || |||||||||||||| | ||||||||| | || |||
Sbjct: 15 tgaatctccctagaagtaatcgtcggcttcttgttgtacctcgcaagcttcgaagactca 74
Query: 334 ccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaa 393
|| || || ||||| ||||| ||||||||||| ||||||||| |||||| |||
Sbjct: 75 ccagcaagtttctcaaagatatcgttgatgaaactgttcatgattcccatggctttgctt 134
Query: 394 gagatgccgatgtcggggtggacctgcttcagcaccttgaagatgtagatcttgtaggtc 453
||||| |||||||| || || || ||||||| |||||||||||||||||||||||| |||
Sbjct: 135 gagattccgatgtctggatgaacttgcttcaacaccttgaagatgtagatcttgtatgtc 194
Query: 454 tc 455
||
Sbjct: 195 tc 196
>gb|AF471834.1| Arabidopsis thaliana ecotype BLA-10 chromosome 5 locus MRN17.5
Length = 324
Score = 99.6 bits (50), Expect = 6e-019
Identities = 149/182 (81%)
Strand = Plus / Plus
Query: 274 tgaatctcccgagaggtgatggtgggcttcttgttgtagcgcgcaagcttggcagcctcg 333
|||||||||| ||| || || || |||||||||||||| | ||||||||| | || |||
Sbjct: 15 tgaatctccctagaagtaatcgtcggcttcttgttgtacctcgcaagcttcgaagactca 74
Query: 334 ccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaa 393
|| || || ||||| ||||| ||||||||||| ||||||||| |||||| |||
Sbjct: 75 ccagcaagtttctcaaagatatcgttgatgaaactgttcatgattcccatggctttgctt 134
Query: 394 gagatgccgatgtcggggtggacctgcttcagcaccttgaagatgtagatcttgtaggtc 453
||||| |||||||| || || || ||||||| |||||||||||||||||||||||| |||
Sbjct: 135 gagattccgatgtctggatgaacttgcttcaacaccttgaagatgtagatcttgtatgtc 194
Query: 454 tc 455
||
Sbjct: 195 tc 196
>gb|C99813.1|C99813 C99813 YAC clone CIC8B11 region-specific cDNA Arabidopsis thaliana
cDNA clone 8B11-38, mRNA sequence
Length = 456
Score = 91.7 bits (46), Expect = 2e-016
Identities = 130/158 (82%)
Strand = Plus / Minus
Query: 298 ggcttcttgttgtagcgcgcaagcttggcagcctcgccggcgagcttctcgaagatgtcg 357
|||||||||||||| | |||||||| | || ||| || || |||||||| ||||| |||
Sbjct: 358 ggcttcttgttgtaccttgcaagcttcgaagactcaccagcaagcttctcaaagatatcg 299
Query: 358 ttgatgaaggagttcatgatggacatggccttggaagagatgccgatgtcggggtggacc 417
|||||||| ||||||||| |||||| ||| ||||| |||||||| || || ||
Sbjct: 298 ttgatgaaactgttcatgattcccatggctttgcttgagattccgatgtctggatgaact 239
Query: 418 tgcttcagcaccttgaagatgtagatcttgtaggtctc 455
||||||| |||||||||||||||||||||||| |||||
Sbjct: 238 tgcttcaacaccttgaagatgtagatcttgtatgtctc 201
>gb|CK120461.1|CK120461 218k04.p1 AtM1 Arabidopsis thaliana cDNA clone MPMGp2011K04218
5-PRIME, mRNA sequence
Length = 437
Score = 91.7 bits (46), Expect = 2e-016
Identities = 130/158 (82%)
Strand = Plus / Minus
Query: 298 ggcttcttgttgtagcgcgcaagcttggcagcctcgccggcgagcttctcgaagatgtcg 357
|||||||||||||| | |||||||| | || ||| || || |||||||| ||||| |||
Sbjct: 175 ggcttcttgttgtaccttgcaagcttcgaagactcaccagcaagcttctcaaagatatcg 116
Query: 358 ttgatgaaggagttcatgatggacatggccttggaagagatgccgatgtcggggtggacc 417
|||||||| ||||||||| |||||| ||| ||||| |||||||| || || ||
Sbjct: 115 ttgatgaaactgttcatgattcccatggctttgcttgagattccgatgtctggatgaact 56
Query: 418 tgcttcagcaccttgaagatgtagatcttgtaggtctc 455
||||||| |||||||||||||||||||||||| |||||
Sbjct: 55 tgcttcaacaccttgaagatgtagatcttgtatgtctc 18
>gb|CK120549.1|CK120549 207d05.p1 AtM1 Arabidopsis thaliana cDNA clone MPMGp2011D05207
5-PRIME, mRNA sequence
Length = 607
Score = 91.7 bits (46), Expect = 2e-016
Identities = 130/158 (82%)
Strand = Plus / Minus
Query: 298 ggcttcttgttgtagcgcgcaagcttggcagcctcgccggcgagcttctcgaagatgtcg 357
|||||||||||||| | |||||||| | || ||| || || |||||||| ||||| |||
Sbjct: 354 ggcttcttgttgtaccttgcaagcttcgaagactcaccagcaagcttctcaaagatatcg 295
Query: 358 ttgatgaaggagttcatgatggacatggccttggaagagatgccgatgtcggggtggacc 417
|||||||| ||||||||| |||||| ||| ||||| |||||||| || || ||
Sbjct: 294 ttgatgaaactgttcatgattcccatggctttgcttgagattccgatgtctggatgaact 235
Query: 418 tgcttcagcaccttgaagatgtagatcttgtaggtctc 455
||||||| |||||||||||||||||||||||| |||||
Sbjct: 234 tgcttcaacaccttgaagatgtagatcttgtatgtctc 197
>gb|AF471806.1| Arabidopsis thaliana ecotype BL-1 chromosome 5 locus MRN17.5
Length = 324
Score = 91.7 bits (46), Expect = 2e-016
Identities = 130/158 (82%)
Strand = Plus / Plus
Query: 298 ggcttcttgttgtagcgcgcaagcttggcagcctcgccggcgagcttctcgaagatgtcg 357
|||||||||||||| | ||||||||| | || ||| || || |||||||| ||||| |||
Sbjct: 39 ggcttcttgttgtacctcgcaagcttcgaagactcaccagcaagcttctcaaagatatcg 98
Query: 358 ttgatgaaggagttcatgatggacatggccttggaagagatgccgatgtcggggtggacc 417
|||||||| ||||||||| |||||| ||| ||||| |||||||| || || ||
Sbjct: 99 ttgatgaaactgttcatgattcccatggctttgcttgagattccgatgtctggatgaact 158
Query: 418 tgcttcagcaccttgaagatgtagatcttgtaggtctc 455
|| |||| |||||||||||||||||||||||| |||||
Sbjct: 159 tgtttcaacaccttgaagatgtagatcttgtatgtctc 196
>gb|AF471807.1| Arabidopsis thaliana ecotype NO-0 chromosome 5 locus MRN17.5
Length = 324
Score = 91.7 bits (46), Expect = 2e-016
Identities = 130/158 (82%)
Strand = Plus / Plus
Query: 298 ggcttcttgttgtagcgcgcaagcttggcagcctcgccggcgagcttctcgaagatgtcg 357
|||||||||||||| | ||||||||| | || ||| || || |||||||| ||||| |||
Sbjct: 39 ggcttcttgttgtacctcgcaagcttcgaagactcaccagcaagcttctcaaagatatcg 98
Query: 358 ttgatgaaggagttcatgatggacatggccttggaagagatgccgatgtcggggtggacc 417
|||||||| ||||||||| |||||| ||| ||||| |||||||| || || ||
Sbjct: 99 ttgatgaaactgttcatgattcccatggctttgcttgagattccgatgtctggatgaact 158
Query: 418 tgcttcagcaccttgaagatgtagatcttgtaggtctc 455
|| |||| |||||||||||||||||||||||| |||||
Sbjct: 159 tgtttcaacaccttgaagatgtagatcttgtatgtctc 196
>gb|AF471808.1| Arabidopsis thaliana ecotype TSU-1 chromosome 5 locus MRN17.5
Length = 324
Score = 91.7 bits (46), Expect = 2e-016
Identities = 130/158 (82%)
Strand = Plus / Plus
Query: 298 ggcttcttgttgtagcgcgcaagcttggcagcctcgccggcgagcttctcgaagatgtcg 357
|||||||||||||| | ||||||||| | || ||| || || |||||||| ||||| |||
Sbjct: 39 ggcttcttgttgtacctcgcaagcttcgaagactcaccagcaagcttctcaaagatatcg 98
Query: 358 ttgatgaaggagttcatgatggacatggccttggaagagatgccgatgtcggggtggacc 417
|||||||| ||||||||| |||||| ||| ||||| |||||||| || || ||
Sbjct: 99 ttgatgaaactgttcatgattcccatggctttgcttgagattccgatgtctggatgaact 158
Query: 418 tgcttcagcaccttgaagatgtagatcttgtaggtctc 455
|| |||| |||||||||||||||||||||||| |||||
Sbjct: 159 tgtttcaacaccttgaagatgtagatcttgtatgtctc 196
>gb|AF471809.1| Arabidopsis thaliana ecotype YO-0 chromosome 5 locus MRN17.5
Length = 324
Score = 91.7 bits (46), Expect = 2e-016
Identities = 130/158 (82%)
Strand = Plus / Plus
Query: 298 ggcttcttgttgtagcgcgcaagcttggcagcctcgccggcgagcttctcgaagatgtcg 357
|||||||||||||| | ||||||||| | || ||| || || |||||||| ||||| |||
Sbjct: 39 ggcttcttgttgtacctcgcaagcttcgaagactcaccagcaagcttctcaaagatatcg 98
Query: 358 ttgatgaaggagttcatgatggacatggccttggaagagatgccgatgtcggggtggacc 417
|||||||| ||||||||| |||||| ||| ||||| |||||||| || || ||
Sbjct: 99 ttgatgaaactgttcatgattcccatggctttgcttgagattccgatgtctggatgaact 158
Query: 418 tgcttcagcaccttgaagatgtagatcttgtaggtctc 455
|| |||| |||||||||||||||||||||||| |||||
Sbjct: 159 tgtttcaacaccttgaagatgtagatcttgtatgtctc 196
>gb|AF471810.1| Arabidopsis thaliana ecotype WL-0 chromosome 5 locus MRN17.5
Length = 324
Score = 91.7 bits (46), Expect = 2e-016
Identities = 130/158 (82%)
Strand = Plus / Plus
Query: 298 ggcttcttgttgtagcgcgcaagcttggcagcctcgccggcgagcttctcgaagatgtcg 357
|||||||||||||| | ||||||||| | || ||| || || |||||||| ||||| |||
Sbjct: 39 ggcttcttgttgtacctcgcaagcttcgaagactcaccagcaagcttctcaaagatatcg 98
Query: 358 ttgatgaaggagttcatgatggacatggccttggaagagatgccgatgtcggggtggacc 417
|||||||| ||||||||| |||||| ||| ||||| |||||||| || || ||
Sbjct: 99 ttgatgaaactgttcatgattcccatggctttgcttgagattccgatgtctggatgaact 158
Query: 418 tgcttcagcaccttgaagatgtagatcttgtaggtctc 455
|| |||| |||||||||||||||||||||||| |||||
Sbjct: 159 tgtttcaacaccttgaagatgtagatcttgtatgtctc 196
>gb|AF471811.1| Arabidopsis thaliana ecotype SEI-0 chromosome 5 locus MRN17.5
Length = 324
Score = 91.7 bits (46), Expect = 2e-016
Identities = 130/158 (82%)
Strand = Plus / Plus
Query: 298 ggcttcttgttgtagcgcgcaagcttggcagcctcgccggcgagcttctcgaagatgtcg 357
|||||||||||||| | ||||||||| | || ||| || || |||||||| ||||| |||
Sbjct: 39 ggcttcttgttgtacctcgcaagcttcgaagactcaccagcaagcttctcaaagatatcg 98
Query: 358 ttgatgaaggagttcatgatggacatggccttggaagagatgccgatgtcggggtggacc 417
|||||||| ||||||||| |||||| ||| ||||| |||||||| || || ||
Sbjct: 99 ttgatgaaactgttcatgattcccatggctttgcttgagattccgatgtctggatgaact 158
Query: 418 tgcttcagcaccttgaagatgtagatcttgtaggtctc 455
|| |||| |||||||||||||||||||||||| |||||
Sbjct: 159 tgtttcaacaccttgaagatgtagatcttgtatgtctc 196
>gb|AF471812.1| Arabidopsis thaliana ecotype PI-0 chromosome 5 locus MRN17.5
Length = 324
Score = 91.7 bits (46), Expect = 2e-016
Identities = 130/158 (82%)
Strand = Plus / Plus
Query: 298 ggcttcttgttgtagcgcgcaagcttggcagcctcgccggcgagcttctcgaagatgtcg 357
|||||||||||||| | ||||||||| | || ||| || || |||||||| ||||| |||
Sbjct: 39 ggcttcttgttgtacctcgcaagcttcgaagactcaccagcaagcttctcaaagatatcg 98
Query: 358 ttgatgaaggagttcatgatggacatggccttggaagagatgccgatgtcggggtggacc 417
|||||||| ||||||||| |||||| ||| ||||| |||||||| || || ||
Sbjct: 99 ttgatgaaactgttcatgattcccatggctttgcttgagattccgatgtctggatgaact 158
Query: 418 tgcttcagcaccttgaagatgtagatcttgtaggtctc 455
|| |||| |||||||||||||||||||||||| |||||
Sbjct: 159 tgtttcaacaccttgaagatgtagatcttgtatgtctc 196
>gb|AF471813.1| Arabidopsis thaliana ecotype KA-0 chromosome 5 locus MRN17.5
Length = 324
Score = 91.7 bits (46), Expect = 2e-016
Identities = 130/158 (82%)
Strand = Plus / Plus
Query: 298 ggcttcttgttgtagcgcgcaagcttggcagcctcgccggcgagcttctcgaagatgtcg 357
|||||||||||||| | ||||||||| | || ||| || || |||||||| ||||| |||
Sbjct: 39 ggcttcttgttgtacctcgcaagcttcgaagactcaccagcaagcttctcaaagatatcg 98
Query: 358 ttgatgaaggagttcatgatggacatggccttggaagagatgccgatgtcggggtggacc 417
|||||||| ||||||||| |||||| ||| ||||| |||||||| || || ||
Sbjct: 99 ttgatgaaactgttcatgattcccatggctttgcttgagattccgatgtctggatgaact 158
Query: 418 tgcttcagcaccttgaagatgtagatcttgtaggtctc 455
|| |||| |||||||||||||||||||||||| |||||
Sbjct: 159 tgtttcaacaccttgaagatgtagatcttgtatgtctc 196
>gb|AF471814.1| Arabidopsis thaliana ecotype SU-0 chromosome 5 locus MRN17.5
Length = 324
Score = 91.7 bits (46), Expect = 2e-016
Identities = 130/158 (82%)
Strand = Plus / Plus
Query: 298 ggcttcttgttgtagcgcgcaagcttggcagcctcgccggcgagcttctcgaagatgtcg 357
|||||||||||||| | ||||||||| | || ||| || || |||||||| ||||| |||
Sbjct: 39 ggcttcttgttgtacctcgcaagcttcgaagactcaccagcaagcttctcaaagatatcg 98
Query: 358 ttgatgaaggagttcatgatggacatggccttggaagagatgccgatgtcggggtggacc 417
|||||||| ||||||||| |||||| ||| ||||| |||||||| || || ||
Sbjct: 99 ttgatgaaactgttcatgattcccatggctttgcttgagattccgatgtctggatgaact 158
Query: 418 tgcttcagcaccttgaagatgtagatcttgtaggtctc 455
|| |||| |||||||||||||||||||||||| |||||
Sbjct: 159 tgtttcaacaccttgaagatgtagatcttgtatgtctc 196
>gb|AF471822.1| Arabidopsis thaliana ecotype CAN-0 chromosome 5 locus MRN17.5
Length = 324
Score = 91.7 bits (46), Expect = 2e-016
Identities = 130/158 (82%)
Strand = Plus / Plus
Query: 298 ggcttcttgttgtagcgcgcaagcttggcagcctcgccggcgagcttctcgaagatgtcg 357
|||||||||||||| | |||||||| | || ||| || || |||||||| ||||| |||
Sbjct: 39 ggcttcttgttgtaccttgcaagcttcgaagactcaccagcaagcttctcaaagatatcg 98
Query: 358 ttgatgaaggagttcatgatggacatggccttggaagagatgccgatgtcggggtggacc 417
|||||||| ||||||||| |||||| ||| ||||| |||||||| || || ||
Sbjct: 99 ttgatgaaactgttcatgattcccatggctttgcttgagattccgatgtctggatgaact 158
Query: 418 tgcttcagcaccttgaagatgtagatcttgtaggtctc 455
||||||| |||||||||||||||||||||||| |||||
Sbjct: 159 tgcttcaacaccttgaagatgtagatcttgtatgtctc 196
>gb|AF471823.1| Arabidopsis thaliana ecotype DIJON_G chromosome 5 locus MRN17.5
Length = 324
Score = 91.7 bits (46), Expect = 2e-016
Identities = 130/158 (82%)
Strand = Plus / Plus
Query: 298 ggcttcttgttgtagcgcgcaagcttggcagcctcgccggcgagcttctcgaagatgtcg 357
|||||||||||||| | |||||||| | || ||| || || |||||||| ||||| |||
Sbjct: 39 ggcttcttgttgtaccttgcaagcttcgaagactcaccagcaagcttctcaaagatatcg 98
Query: 358 ttgatgaaggagttcatgatggacatggccttggaagagatgccgatgtcggggtggacc 417
|||||||| ||||||||| |||||| ||| ||||| |||||||| || || ||
Sbjct: 99 ttgatgaaactgttcatgattcccatggctttgcttgagattccgatgtctggatgaact 158
Query: 418 tgcttcagcaccttgaagatgtagatcttgtaggtctc 455
||||||| |||||||||||||||||||||||| |||||
Sbjct: 159 tgcttcaacaccttgaagatgtagatcttgtatgtctc 196
>gb|AF471824.1| Arabidopsis thaliana ecotype PETERGOF chromosome 5 locus MRN17.5
Length = 324
Score = 91.7 bits (46), Expect = 2e-016
Identities = 130/158 (82%)
Strand = Plus / Plus
Query: 298 ggcttcttgttgtagcgcgcaagcttggcagcctcgccggcgagcttctcgaagatgtcg 357
|||||||||||||| | |||||||| | || ||| || || |||||||| ||||| |||
Sbjct: 39 ggcttcttgttgtaccttgcaagcttcgaagactcaccagcaagcttctcaaagatatcg 98
Query: 358 ttgatgaaggagttcatgatggacatggccttggaagagatgccgatgtcggggtggacc 417
|||||||| ||||||||| |||||| ||| ||||| |||||||| || || ||
Sbjct: 99 ttgatgaaactgttcatgattcccatggctttgcttgagattccgatgtctggatgaact 158
Query: 418 tgcttcagcaccttgaagatgtagatcttgtaggtctc 455
||||||| |||||||||||||||||||||||| |||||
Sbjct: 159 tgcttcaacaccttgaagatgtagatcttgtatgtctc 196
>gb|AF471825.1| Arabidopsis thaliana ecotype LIP-0 chromosome 5 locus MRN17.5
Length = 324
Score = 91.7 bits (46), Expect = 2e-016
Identities = 130/158 (82%)
Strand = Plus / Plus
Query: 298 ggcttcttgttgtagcgcgcaagcttggcagcctcgccggcgagcttctcgaagatgtcg 357
|||||||||||||| | |||||||| | || ||| || || |||||||| ||||| |||
Sbjct: 39 ggcttcttgttgtaccttgcaagcttcgaagactcaccagcaagcttctcaaagatatcg 98
Query: 358 ttgatgaaggagttcatgatggacatggccttggaagagatgccgatgtcggggtggacc 417
|||||||| ||||||||| |||||| ||| ||||| |||||||| || || ||
Sbjct: 99 ttgatgaaactgttcatgattcccatggctttgcttgagattccgatgtctggatgaact 158
Query: 418 tgcttcagcaccttgaagatgtagatcttgtaggtctc 455
||||||| |||||||||||||||||||||||| |||||
Sbjct: 159 tgcttcaacaccttgaagatgtagatcttgtatgtctc 196
>gb|AF471826.1| Arabidopsis thaliana ecotype LER-0 chromosome 5 locus MRN17.5
Length = 324
Score = 91.7 bits (46), Expect = 2e-016
Identities = 130/158 (82%)
Strand = Plus / Plus
Query: 298 ggcttcttgttgtagcgcgcaagcttggcagcctcgccggcgagcttctcgaagatgtcg 357
|||||||||||||| | |||||||| | || ||| || || |||||||| ||||| |||
Sbjct: 39 ggcttcttgttgtaccttgcaagcttcgaagactcaccagcaagcttctcaaagatatcg 98
Query: 358 ttgatgaaggagttcatgatggacatggccttggaagagatgccgatgtcggggtggacc 417
|||||||| ||||||||| |||||| ||| ||||| |||||||| || || ||
Sbjct: 99 ttgatgaaactgttcatgattcccatggctttgcttgagattccgatgtctggatgaact 158
Query: 418 tgcttcagcaccttgaagatgtagatcttgtaggtctc 455
||||||| |||||||||||||||||||||||| |||||
Sbjct: 159 tgcttcaacaccttgaagatgtagatcttgtatgtctc 196
>gb|AF471827.1| Arabidopsis thaliana ecotype EI-2 chromosome 5 locus MRN17.5
Length = 324
Score = 91.7 bits (46), Expect = 2e-016
Identities = 130/158 (82%)
Strand = Plus / Plus
Query: 298 ggcttcttgttgtagcgcgcaagcttggcagcctcgccggcgagcttctcgaagatgtcg 357
|||||||||||||| | |||||||| | || ||| || || |||||||| ||||| |||
Sbjct: 39 ggcttcttgttgtaccttgcaagcttcgaagactcaccagcaagcttctcaaagatatcg 98
Query: 358 ttgatgaaggagttcatgatggacatggccttggaagagatgccgatgtcggggtggacc 417
|||||||| ||||||||| |||||| ||| ||||| |||||||| || || ||
Sbjct: 99 ttgatgaaactgttcatgattcccatggctttgcttgagattccgatgtctggatgaact 158
Query: 418 tgcttcagcaccttgaagatgtagatcttgtaggtctc 455
||||||| |||||||||||||||||||||||| |||||
Sbjct: 159 tgcttcaacaccttgaagatgtagatcttgtatgtctc 196
>gb|AF471828.1| Arabidopsis thaliana ecotype SORBO chromosome 5 locus MRN17.5
Length = 324
Score = 91.7 bits (46), Expect = 2e-016
Identities = 130/158 (82%)
Strand = Plus / Plus
Query: 298 ggcttcttgttgtagcgcgcaagcttggcagcctcgccggcgagcttctcgaagatgtcg 357
|||||||||||||| | |||||||| | || ||| || || |||||||| ||||| |||
Sbjct: 39 ggcttcttgttgtaccttgcaagcttcgaagactcaccagcaagcttctcaaagatatcg 98
Query: 358 ttgatgaaggagttcatgatggacatggccttggaagagatgccgatgtcggggtggacc 417
|||||||| ||||||||| |||||| ||| ||||| |||||||| || || ||
Sbjct: 99 ttgatgaaactgttcatgattcccatggctttgcttgagattccgatgtctggatgaact 158
Query: 418 tgcttcagcaccttgaagatgtagatcttgtaggtctc 455
||||||| |||||||||||||||||||||||| |||||
Sbjct: 159 tgcttcaacaccttgaagatgtagatcttgtatgtctc 196
>gb|BP562087.2|BP562087 BP562087 RAFL9 Arabidopsis thaliana cDNA clone RAFL09-46-K06 5',
mRNA sequence
Length = 472
Score = 85.7 bits (43), Expect = 9e-015
Identities = 147/182 (80%)
Strand = Plus / Minus
Query: 274 tgaatctcccgagaggtgatggtgggcttcttgttgtagcgcgcaagcttggcagcctcg 333
|||||||||||||| ||||| || || ||||| ||||| | ||||||||| | |||||
Sbjct: 441 tgaatctcccgagaagtgatcgtaggtttcttattgtacctcgcaagcttcgacgcctct 382
Query: 334 ccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaa 393
|| |||||||||||||| ||||| ||||| ||||||||| ||| || |||
Sbjct: 381 tgagcaagcttctcgaagatatcgttnatgaaactgttcatgatccccatcgctttgctg 322
Query: 394 gagatgccgatgtcggggtggacctgcttcagcaccttgaagatgtagatcttgtaggtc 453
||||| ||||| ||||| || || ||||| |||||||||||||||||||||||||| |||
Sbjct: 321 gagattccgatatcgggatgaacttgcttaagcaccttgaagatgtagatcttgtaagtc 262
Query: 454 tc 455
||
Sbjct: 261 tc 260
>gb|AI999101.1|AI999101 701554459 A. thaliana, Columbia Col-0, rosette-3 Arabidopsis
thaliana cDNA clone 701554459, mRNA sequence
Length = 586
Score = 83.8 bits (42), Expect = 4e-014
Identities = 147/182 (80%)
Strand = Plus / Plus
Query: 274 tgaatctcccgagaggtgatggtgggcttcttgttgtagcgcgcaagcttggcagcctcg 333
|||||||||||||| ||||| || || ||||| ||||| | ||||||||| | |||||
Sbjct: 283 tgaatctcccgagaagtgatcgtaggtttcttattgtacctcgcaagcttcgacgcctct 342
Query: 334 ccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaa 393
|| |||||||||||||| ||||| ||||| ||||||||| ||| || |||
Sbjct: 343 tgagcaagcttctcgaagatatcgttaatgaaactgttcatgatccccatcgctttgctg 402
Query: 394 gagatgccgatgtcggggtggacctgcttcagcaccttgaagatgtagatcttgtaggtc 453
||||| ||||| ||||| || || ||||| |||||||||||||||||||||||||| |||
Sbjct: 403 gagattccgatatcgggatgaacttgcttaagcaccttgaagatgtagatcttgtaagtc 462
Query: 454 tc 455
||
Sbjct: 463 tc 464
>gb|AU235967.1|AU235967 AU235967 RAFL14 Arabidopsis thaliana cDNA clone RAFL14-55-N17 5',
mRNA sequence
Length = 530
Score = 83.8 bits (42), Expect = 4e-014
Identities = 147/182 (80%)
Strand = Plus / Minus
Query: 274 tgaatctcccgagaggtgatggtgggcttcttgttgtagcgcgcaagcttggcagcctcg 333
|||||||||| ||| || || || |||||||||||||| | ||||||||| | || |||
Sbjct: 402 tgaatctccctagaagtaatcgtcggcttcttgttgtacctcgcaagcttcgaagactca 343
Query: 334 ccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaa 393
|| || || ||||| ||||| || |||||||| ||||||||| |||||| |||
Sbjct: 342 ccagcaagtttctcaaagatatcattgatgaaactgttcatgattcccatggctttgctg 283
Query: 394 gagatgccgatgtcggggtggacctgcttcagcaccttgaagatgtagatcttgtaggtc 453
||||| ||||| || || || || ||||||| |||||||||||||||||||||||| |||
Sbjct: 282 gagattccgatatctggatgaacttgcttcaacaccttgaagatgtagatcttgtatgtc 223
Query: 454 tc 455
||
Sbjct: 222 tc 221
>gb|BU636121.1|BU636121 045G06 Infected Arabidopsis Leaf Arabidopsis thaliana cDNA, mRNA
sequence
Length = 652
Score = 83.8 bits (42), Expect = 4e-014
Identities = 147/182 (80%)
Strand = Plus / Minus
Query: 274 tgaatctcccgagaggtgatggtgggcttcttgttgtagcgcgcaagcttggcagcctcg 333
|||||||||||||| ||||| || || ||||| ||||| | ||||||||| | |||||
Sbjct: 377 tgaatctcccgagaagtgatcgtaggtttcttattgtacctcgcaagcttcgacgcctct 318
Query: 334 ccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaa 393
|| |||||||||||||| ||||| ||||| ||||||||| ||| || |||
Sbjct: 317 tgagcaagcttctcgaagatatcgttaatgaaactgttcatgatccccatcgctttgctg 258
Query: 394 gagatgccgatgtcggggtggacctgcttcagcaccttgaagatgtagatcttgtaggtc 453
||||| ||||| ||||| || || ||||| |||||||||||||||||||||||||| |||
Sbjct: 257 gagattccgatatcgggatgaacttgcttaagcaccttgaagatgtagatcttgtaagtc 198
Query: 454 tc 455
||
Sbjct: 197 tc 196
Score = 40.1 bits (20), Expect = 0.49
Identities = 38/44 (86%)
Strand = Plus / Minus
Query: 589 gctggcttcttcgcagccggcttcttctccgccttgggcgccat 632
||||| |||||| |||| ||||||||||| || || ||||||||
Sbjct: 59 gctggtttcttctcagcgggcttcttctctgctttcggcgccat 16
>gb|AV521723.1|AV521723 AV521723 Arabidopsis thaliana aboveground organs two to six-week
old Arabidopsis thaliana cDNA clone APZ65f01F 3', mRNA
sequence
Length = 529
Score = 83.8 bits (42), Expect = 4e-014
Identities = 147/182 (80%)
Strand = Plus / Plus
Query: 274 tgaatctcccgagaggtgatggtgggcttcttgttgtagcgcgcaagcttggcagcctcg 333
|||||||||||||| ||||| || || ||||| ||||| | ||||||||| | |||||
Sbjct: 274 tgaatctcccgagaagtgatcgtaggtttcttattgtacctcgcaagcttcgacgcctct 333
Query: 334 ccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaa 393
|| |||||||||||||| ||||| ||||| ||||||||| ||| || |||
Sbjct: 334 tgagcaagcttctcgaagatatcgttaatgaaactgttcatgatccccatcgctttgctg 393
Query: 394 gagatgccgatgtcggggtggacctgcttcagcaccttgaagatgtagatcttgtaggtc 453
||||| ||||| ||||| || || ||||| |||||||||||||||||||||||||| |||
Sbjct: 394 gagattccgatatcgggatgaacttgcttaagcaccttgaagatgtagatcttgtaagtc 453
Query: 454 tc 455
||
Sbjct: 454 tc 455
>gb|AV557883.1|AV557883 AV557883 Arabidopsis thaliana green siliques Columbia Arabidopsis
thaliana cDNA clone SQ083c05F 3', mRNA sequence
Length = 637
Score = 83.8 bits (42), Expect = 4e-014
Identities = 147/182 (80%)
Strand = Plus / Minus
Query: 274 tgaatctcccgagaggtgatggtgggcttcttgttgtagcgcgcaagcttggcagcctcg 333
|||||||||||||| ||||| || || ||||| ||||| | ||||||||| | |||||
Sbjct: 418 tgaatctcccgagaagtgatcgtaggtttcttattgtacctcgcaagcttcgacgcctct 359
Query: 334 ccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaa 393
|| |||||||||||||| ||||| ||||| ||||||||| ||| || |||
Sbjct: 358 tgagcaagcttctcgaagatatcgttaatgaaactgttcatgatccccatcgctttgctg 299
Query: 394 gagatgccgatgtcggggtggacctgcttcagcaccttgaagatgtagatcttgtaggtc 453
||||| ||||| ||||| || || ||||| |||||||||||||||||||||||||| |||
Sbjct: 298 gagattccgatatcgggatgaacttgcttaagcaccttgaagatgtagatcttgtaagtc 239
Query: 454 tc 455
||
Sbjct: 238 tc 237
Score = 40.1 bits (20), Expect = 0.49
Identities = 38/44 (86%)
Strand = Plus / Minus
Query: 589 gctggcttcttcgcagccggcttcttctccgccttgggcgccat 632
||||| |||||| |||| ||||||||||| || || ||||||||
Sbjct: 100 gctggtttcttctcagcgggcttcttctctgctttcggcgccat 57
>gb|AV559679.1|AV559679 AV559679 Arabidopsis thaliana green siliques Columbia Arabidopsis
thaliana cDNA clone SQ121g01F 3', mRNA sequence
Length = 419
Score = 83.8 bits (42), Expect = 4e-014
Identities = 147/182 (80%)
Strand = Plus / Minus
Query: 274 tgaatctcccgagaggtgatggtgggcttcttgttgtagcgcgcaagcttggcagcctcg 333
|||||||||||||| ||||| || || ||||| ||||| | ||||||||| | |||||
Sbjct: 418 tgaatctcccgagaagtgatcgtaggtttcttattgtacctcgcaagcttcgacgcctct 359
Query: 334 ccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaa 393
|| |||||||||||||| ||||| ||||| ||||||||| ||| || |||
Sbjct: 358 tgagcaagcttctcgaagatatcgttaatgaaactgttcatgatccccatcgctttgctg 299
Query: 394 gagatgccgatgtcggggtggacctgcttcagcaccttgaagatgtagatcttgtaggtc 453
||||| ||||| ||||| || || ||||| |||||||||||||||||||||||||| |||
Sbjct: 298 gagattccgatatcgggatgaacttgcttaagcaccttgaagatgtagatcttgtaagtc 239
Query: 454 tc 455
||
Sbjct: 238 tc 237
Score = 40.1 bits (20), Expect = 0.49
Identities = 38/44 (86%)
Strand = Plus / Minus
Query: 589 gctggcttcttcgcagccggcttcttctccgccttgggcgccat 632
||||| |||||| |||| ||||||||||| || || ||||||||
Sbjct: 100 gctggtttcttctcagcgggcttcttctctgctttcggcgccat 57
>gb|CK117656.1|CK117656 215c08.p1 AtM1 Arabidopsis thaliana cDNA clone MPMGp2011C08215
5-PRIME, mRNA sequence
Length = 494
Score = 83.8 bits (42), Expect = 4e-014
Identities = 147/182 (80%)
Strand = Plus / Minus
Query: 274 tgaatctcccgagaggtgatggtgggcttcttgttgtagcgcgcaagcttggcagcctcg 333
|||||||||||||| ||||| || || ||||| ||||| | ||||||||| | |||||
Sbjct: 427 tgaatctcccgagaagtgatcgtaggtttcttattgtacctcgcaagcttcgacgcctct 368
Query: 334 ccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaa 393
|| |||||||||||||| ||||| ||||| ||||||||| ||| || |||
Sbjct: 367 tgagcaagcttctcgaagatatcgttaatgaaactgttcatgatccccatcgctttgctg 308
Query: 394 gagatgccgatgtcggggtggacctgcttcagcaccttgaagatgtagatcttgtaggtc 453
||||| ||||| ||||| || || ||||| |||||||||||||||||||||||||| |||
Sbjct: 307 gagattccgatatcgggatgaacttgcttaagcaccttgaagatgtagatcttgtaagtc 248
Query: 454 tc 455
||
Sbjct: 247 tc 246
Score = 40.1 bits (20), Expect = 0.49
Identities = 38/44 (86%)
Strand = Plus / Minus
Query: 589 gctggcttcttcgcagccggcttcttctccgccttgggcgccat 632
||||| |||||| |||| ||||||||||| || || ||||||||
Sbjct: 109 gctggtttcttctcagcgggcttcttctctgctttcggcgccat 66
>gb|CK117669.1|CK117669 214j19.p1 AtM1 Arabidopsis thaliana cDNA clone MPMGp2011J19214
5-PRIME, mRNA sequence
Length = 543
Score = 83.8 bits (42), Expect = 4e-014
Identities = 147/182 (80%)
Strand = Plus / Minus
Query: 274 tgaatctcccgagaggtgatggtgggcttcttgttgtagcgcgcaagcttggcagcctcg 333
|||||||||| ||| || || || |||||||||||||| | ||||||||| | || |||
Sbjct: 379 tgaatctccctagaagtaatcgtcggcttcttgttgtacctcgcaagcttcgaagactca 320
Query: 334 ccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaa 393
|| || || ||||| ||||| || |||||||| ||||||||| |||||| |||
Sbjct: 319 ccagcaagtttctcaaagatatcattgatgaaactgttcatgattcccatggctttgctg 260
Query: 394 gagatgccgatgtcggggtggacctgcttcagcaccttgaagatgtagatcttgtaggtc 453
||||| ||||| || || || || ||||||| |||||||||||||||||||||||| |||
Sbjct: 259 gagattccgatatctggatgaacttgcttcaacaccttgaagatgtagatcttgtatgtc 200
Query: 454 tc 455
||
Sbjct: 199 tc 198
>gb|CK117801.1|CK117801 204g20.p1 AtM1 Arabidopsis thaliana cDNA clone MPMGp2011G20204
5-PRIME, mRNA sequence
Length = 694
Score = 83.8 bits (42), Expect = 4e-014
Identities = 147/182 (80%)
Strand = Plus / Minus
Query: 274 tgaatctcccgagaggtgatggtgggcttcttgttgtagcgcgcaagcttggcagcctcg 333
|||||||||||||| ||||| || || ||||| ||||| | ||||||||| | |||||
Sbjct: 427 tgaatctcccgagaagtgatcgtaggtttcttattgtacctcgcaagcttcgacgcctct 368
Query: 334 ccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaa 393
|| |||||||||||||| ||||| ||||| ||||||||| ||| || |||
Sbjct: 367 tgagcaagcttctcgaagatatcgttaatgaaactgttcatgatccccatcgctttgctg 308
Query: 394 gagatgccgatgtcggggtggacctgcttcagcaccttgaagatgtagatcttgtaggtc 453
||||| ||||| ||||| || || ||||| |||||||||||||||||||||||||| |||
Sbjct: 307 gagattccgatatcgggatgaacttgcttaagcaccttgaagatgtagatcttgtaagtc 248
Query: 454 tc 455
||
Sbjct: 247 tc 246
Score = 40.1 bits (20), Expect = 0.49
Identities = 38/44 (86%)
Strand = Plus / Minus
Query: 589 gctggcttcttcgcagccggcttcttctccgccttgggcgccat 632
||||| |||||| |||| ||||||||||| || || ||||||||
Sbjct: 109 gctggtttcttctcagcgggcttcttctctgctttcggcgccat 66
>gb|CK118019.1|CK118019 207g23.p1 AtM1 Arabidopsis thaliana cDNA clone MPMGp2011G23207
5-PRIME, mRNA sequence
Length = 608
Score = 83.8 bits (42), Expect = 4e-014
Identities = 147/182 (80%)
Strand = Plus / Minus
Query: 274 tgaatctcccgagaggtgatggtgggcttcttgttgtagcgcgcaagcttggcagcctcg 333
|||||||||| ||| || || || |||||||||||||| | ||||||||| | || |||
Sbjct: 376 tgaatctccctagaagtaatcgtcggcttcttgttgtacctcgcaagcttcgaagactca 317
Query: 334 ccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaa 393
|| || || ||||| ||||| || |||||||| ||||||||| |||||| |||
Sbjct: 316 ccagcaagtttctcaaagatatcattgatgaaactgttcatgattcccatggctttgctg 257
Query: 394 gagatgccgatgtcggggtggacctgcttcagcaccttgaagatgtagatcttgtaggtc 453
||||| ||||| || || || || ||||||| |||||||||||||||||||||||| |||
Sbjct: 256 gagattccgatatctggatgaacttgcttcaacaccttgaagatgtagatcttgtatgtc 197
Query: 454 tc 455
||
Sbjct: 196 tc 195
>gb|CK118307.1|CK118307 217h22.p1 AtM1 Arabidopsis thaliana cDNA clone MPMGp2011H22217
5-PRIME, mRNA sequence
Length = 585
Score = 83.8 bits (42), Expect = 4e-014
Identities = 147/182 (80%)
Strand = Plus / Minus
Query: 274 tgaatctcccgagaggtgatggtgggcttcttgttgtagcgcgcaagcttggcagcctcg 333
|||||||||||||| ||||| || || ||||| ||||| | ||||||||| | |||||
Sbjct: 412 tgaatctcccgagaagtgatcgtaggtttcttattgtacctcgcaagcttcgacgcctct 353
Query: 334 ccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaa 393
|| |||||||||||||| ||||| ||||| ||||||||| ||| || |||
Sbjct: 352 tgagcaagcttctcgaagatatcgttaatgaaactgttcatgatccccatcgctttgctg 293
Query: 394 gagatgccgatgtcggggtggacctgcttcagcaccttgaagatgtagatcttgtaggtc 453
||||| ||||| ||||| || || ||||| |||||||||||||||||||||||||| |||
Sbjct: 292 gagattccgatatcgggatgaacttgcttaagcaccttgaagatgtagatcttgtaagtc 233
Query: 454 tc 455
||
Sbjct: 232 tc 231
Score = 40.1 bits (20), Expect = 0.49
Identities = 38/44 (86%)
Strand = Plus / Minus
Query: 589 gctggcttcttcgcagccggcttcttctccgccttgggcgccat 632
||||| |||||| |||| ||||||||||| || || ||||||||
Sbjct: 94 gctggtttcttctcagcgggcttcttctctgctttcggcgccat 51
>gb|CK118414.1|CK118414 217b16.p1 AtM1 Arabidopsis thaliana cDNA clone MPMGp2011B16217
5-PRIME, mRNA sequence
Length = 596
Score = 83.8 bits (42), Expect = 4e-014
Identities = 147/182 (80%)
Strand = Plus / Minus
Query: 274 tgaatctcccgagaggtgatggtgggcttcttgttgtagcgcgcaagcttggcagcctcg 333
|||||||||||||| ||||| || || ||||| ||||| | ||||||||| | |||||
Sbjct: 427 tgaatctcccgagaagtgatcgtaggtttcttattgtacctcgcaagcttcgacgcctct 368
Query: 334 ccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaa 393
|| |||||||||||||| ||||| ||||| ||||||||| ||| || |||
Sbjct: 367 tgagcaagcttctcgaagatatcgttaatgaaactgttcatgatccccatcgctttgctg 308
Query: 394 gagatgccgatgtcggggtggacctgcttcagcaccttgaagatgtagatcttgtaggtc 453
||||| ||||| ||||| || || ||||| |||||||||||||||||||||||||| |||
Sbjct: 307 gagattccgatatcgggatgaacttgcttaagcaccttgaagatgtagatcttgtaagtc 248
Query: 454 tc 455
||
Sbjct: 247 tc 246
Score = 40.1 bits (20), Expect = 0.49
Identities = 38/44 (86%)
Strand = Plus / Minus
Query: 589 gctggcttcttcgcagccggcttcttctccgccttgggcgccat 632
||||| |||||| |||| ||||||||||| || || ||||||||
Sbjct: 109 gctggtttcttctcagcgggcttcttctctgctttcggcgccat 66
>gb|CK118523.1|CK118523 216n23.p1 AtM1 Arabidopsis thaliana cDNA clone MPMGp2011N23216
5-PRIME, mRNA sequence
Length = 627
Score = 83.8 bits (42), Expect = 4e-014
Identities = 147/182 (80%)
Strand = Plus / Minus
Query: 274 tgaatctcccgagaggtgatggtgggcttcttgttgtagcgcgcaagcttggcagcctcg 333
|||||||||||||| ||||| || || ||||| ||||| | ||||||||| | |||||
Sbjct: 412 tgaatctcccgagaagtgatcgtaggtttcttattgtacctcgcaagcttcgacgcctct 353
Query: 334 ccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaa 393
|| |||||||||||||| ||||| ||||| ||||||||| ||| || |||
Sbjct: 352 tgagcaagcttctcgaagatatcgttaatgaaactgttcatgatccccatcgctttgctg 293
Query: 394 gagatgccgatgtcggggtggacctgcttcagcaccttgaagatgtagatcttgtaggtc 453
||||| ||||| ||||| || || ||||| |||||||||||||||||||||||||| |||
Sbjct: 292 gagattccgatatcgggatgaacttgcttaagcaccttgaagatgtagatcttgtaagtc 233
Query: 454 tc 455
||
Sbjct: 232 tc 231
Score = 40.1 bits (20), Expect = 0.49
Identities = 38/44 (86%)
Strand = Plus / Minus
Query: 589 gctggcttcttcgcagccggcttcttctccgccttgggcgccat 632
||||| |||||| |||| ||||||||||| || || ||||||||
Sbjct: 94 gctggtttcttctcagcgggcttcttctctgctttcggcgccat 51
>gb|CK119044.1|CK119044 214l11.p1 AtM1 Arabidopsis thaliana cDNA clone MPMGp2011L11214
5-PRIME, mRNA sequence
Length = 543
Score = 83.8 bits (42), Expect = 4e-014
Identities = 147/182 (80%)
Strand = Plus / Minus
Query: 274 tgaatctcccgagaggtgatggtgggcttcttgttgtagcgcgcaagcttggcagcctcg 333
|||||||||| ||| || || || |||||||||||||| | ||||||||| | || |||
Sbjct: 379 tgaatctccctagaagtaatcgtcggcttcttgttgtacctcgcaagcttcgaagactca 320
Query: 334 ccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaa 393
|| || || ||||| ||||| || |||||||| ||||||||| |||||| |||
Sbjct: 319 ccagcaagtttctcaaagatatcattgatgaaactgttcatgattcccatggctttgctg 260
Query: 394 gagatgccgatgtcggggtggacctgcttcagcaccttgaagatgtagatcttgtaggtc 453
||||| ||||| || || || || ||||||| |||||||||||||||||||||||| |||
Sbjct: 259 gagattccgatatctggatgaacttgcttcaacaccttgaagatgtagatcttgtatgtc 200
Query: 454 tc 455
||
Sbjct: 199 tc 198
>gb|CK119663.1|CK119663 211c17.p1 AtM1 Arabidopsis thaliana cDNA clone MPMGp2011C17211
5-PRIME, mRNA sequence
Length = 653
Score = 83.8 bits (42), Expect = 4e-014
Identities = 147/182 (80%)
Strand = Plus / Minus
Query: 274 tgaatctcccgagaggtgatggtgggcttcttgttgtagcgcgcaagcttggcagcctcg 333
|||||||||| ||| || || || |||||||||||||| | ||||||||| | || |||
Sbjct: 379 tgaatctccctagaagtaatcgtcggcttcttgttgtacctcgcaagcttcgaagactca 320
Query: 334 ccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaa 393
|| || || ||||| ||||| || |||||||| ||||||||| |||||| |||
Sbjct: 319 ccagcaagtttctcaaagatatcattgatgaaactgttcatgattcccatggctttgctg 260
Query: 394 gagatgccgatgtcggggtggacctgcttcagcaccttgaagatgtagatcttgtaggtc 453
||||| ||||| || || || || ||||||| |||||||||||||||||||||||| |||
Sbjct: 259 gagattccgatatctggatgaacttgcttcaacaccttgaagatgtagatcttgtatgtc 200
Query: 454 tc 455
||
Sbjct: 199 tc 198
>gb|CK119903.1|CK119903 210g05.p1 AtM1 Arabidopsis thaliana cDNA clone MPMGp2011G05210
5-PRIME, mRNA sequence
Length = 627
Score = 83.8 bits (42), Expect = 4e-014
Identities = 147/182 (80%)
Strand = Plus / Minus
Query: 274 tgaatctcccgagaggtgatggtgggcttcttgttgtagcgcgcaagcttggcagcctcg 333
|||||||||||||| ||||| || || ||||| ||||| | ||||||||| | |||||
Sbjct: 412 tgaatctcccgagaagtgatcgtaggtttcttattgtacctcgcaagcttcgacgcctct 353
Query: 334 ccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaa 393
|| |||||||||||||| ||||| ||||| ||||||||| ||| || |||
Sbjct: 352 tgagcaagcttctcgaagatatcgttaatgaaactgttcatgatccccatcgctttgctg 293
Query: 394 gagatgccgatgtcggggtggacctgcttcagcaccttgaagatgtagatcttgtaggtc 453
||||| ||||| ||||| || || ||||| |||||||||||||||||||||||||| |||
Sbjct: 292 gagattccgatatcgggatgaacttgcttaagcaccttgaagatgtagatcttgtaagtc 233
Query: 454 tc 455
||
Sbjct: 232 tc 231
Score = 40.1 bits (20), Expect = 0.49
Identities = 38/44 (86%)
Strand = Plus / Minus
Query: 589 gctggcttcttcgcagccggcttcttctccgccttgggcgccat 632
||||| |||||| |||| ||||||||||| || || ||||||||
Sbjct: 94 gctggtttcttctcagcgggcttcttctctgctttcggcgccat 51
>gb|CK120137.1|CK120137 208l20.p1 AtM1 Arabidopsis thaliana cDNA clone MPMGp2011L20208
5-PRIME, mRNA sequence
Length = 713
Score = 83.8 bits (42), Expect = 4e-014
Identities = 147/182 (80%)
Strand = Plus / Minus
Query: 274 tgaatctcccgagaggtgatggtgggcttcttgttgtagcgcgcaagcttggcagcctcg 333
|||||||||||||| ||||| || || ||||| ||||| | ||||||||| | |||||
Sbjct: 412 tgaatctcccgagaagtgatcgtaggtttcttattgtacctcgcaagcttcgacgcctct 353
Query: 334 ccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaa 393
|| |||||||||||||| ||||| ||||| ||||||||| ||| || |||
Sbjct: 352 tgagcaagcttctcgaagatatcgttaatgaaactgttcatgatccccatcgctttgctg 293
Query: 394 gagatgccgatgtcggggtggacctgcttcagcaccttgaagatgtagatcttgtaggtc 453
||||| ||||| ||||| || || ||||| |||||||||||||||||||||||||| |||
Sbjct: 292 gagattccgatatcgggatgaacttgcttaagcaccttgaagatgtagatcttgtaagtc 233
Query: 454 tc 455
||
Sbjct: 232 tc 231
Score = 40.1 bits (20), Expect = 0.49
Identities = 38/44 (86%)
Strand = Plus / Minus
Query: 589 gctggcttcttcgcagccggcttcttctccgccttgggcgccat 632
||||| |||||| |||| ||||||||||| || || ||||||||
Sbjct: 94 gctggtttcttctcagcgggcttcttctctgctttcggcgccat 51
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 313,656
Number of Sequences: 1013581
Number of extensions: 313656
Number of successful extensions: 23145
Number of sequences better than 0.5: 377
Number of HSP's better than 0.5 without gapping: 379
Number of HSP's successfully gapped in prelim test: 5
Number of HSP's that attempted gapping in prelim test: 20583
Number of HSP's gapped (non-prelim): 2489
length of query: 694
length of database: 908,940,872
effective HSP length: 20
effective length of query: 674
effective length of database: 888,669,252
effective search space: 598963075848
effective search space used: 598963075848
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)